--- a/egglib/CalculateDiversityIndexes.xml	Wed Feb 07 22:08:47 2018 -0500
+++ b/egglib/CalculateDiversityIndexes.xml	Mon Apr 16 09:00:24 2018 -0400
@@ -1,5 +1,11 @@
-<tool id="calculate_diversity" name="Diversity by gene" version="2.1.6">
-	<description>calculates various diversity indexes with EggLib.</description>
+<tool id="calculate_diversity" name="Diversity by gene" version="2.0.0">
+    <description>Calculates various diversity indexes with EggLib</description>
+    <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work -->
+    <requirements>
+        <requirement type="binary">perl</requirement>
+        <requirement type="package" version="1.6.924">perl-bioperl</requirement>
+        <requirement type="package" version="1.90b4">plink</requirement>
+    </requirements>
     <!-- [STRONGLY RECOMMANDED] Exit code rules -->
     <stdio>
         <!-- [HELP] If no exit code rule is defined, the tool will stop if anything is written to STDERR -->
@@ -21,33 +27,28 @@
         <!-- [HELP] Multiple tests can be defined with different parameters -->
         <test>
          <param name="input" value="egglib-alignment.fa" />
-         <output name="output" file="egglib-result.txt" />
+         <output name="output" file="egglib-result.txt" compare="sim_size" delta="0" />
         </test>
     </tests>
-	<help>
-	
-
+	<help><![CDATA[
 
 .. class:: infomark
 
-**Authors** EggLib_
+**Authors** EggLib : http://mycor.nancy.inra.fr/egglib/
 
-.. _EggLib: http://egglib.sourceforge.net/
-
-  | "EggLib: processing, analysis and simulation tools for population genetics and genomics.", **De Mita S. and M. Siol.**, BMC Genet. 2012. 13:27.
+  | **Please cite** "EggLib: processing, analysis and simulation tools for population genetics and genomics.", **De Mita S. and M. Siol.**, BMC Genet. 2012. 13:27.
+  | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
 
 .. class:: infomark
 
-**Galaxy integration** South Green.
+**Galaxy integration** Provided by Southgreen & Dereeper Alexis (IRD) & Marcon Valentin (IFB & INRA)
 
 .. class:: infomark
 
-**Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
+**Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr
 
 ---------------------------------------------------
 
-
-
 ==================
 Diversity by genes
 ==================
@@ -57,24 +58,23 @@
 -----------
 
   | Provides various diversity indexes using EggLib library.
-  | For further informations, please visite the EggLib website_.
+  | For further informations, please visit the EggLib website_.
 
 .. _website: http://egglib.sourceforge.net/
 
-
------------------
-Workflow position
------------------
-
-**Upstream tool**
+------------
+Dependencies
+------------
+PLINK
+        plink_ 1.90b4, Conda version
+Bioperl
+        perl-bioperl_ 1.6.924, Conda version
+egglib
+        egglib_ 2.1.5, supplied with the wrapper
 
-=============== ====================== ===========
-Name            output file(s)         format 
-=============== ====================== ===========
-VCF to Hapmap   Fasta alignment        fasta
-=============== ====================== ===========
-
-
+.. _plink: https://anaconda.org/bioconda/plink
+.. _perl-bioperl: https://anaconda.org/bioconda/perl-bioperl
+.. _egglib: https://anaconda.org/bioconda/egglib
 
 ----------
 Input file
@@ -83,22 +83,15 @@
 Fasta file
 	Fasta alignment
 
-
-
 ------------
 Output files
 ------------
 
 Diversity
+        Diversity indexes
 
 Log file
-
-
-------------
-Dependencies
-------------
-EggLib 
-	version 2.1.5
+        Log file 
 
 ---------------------------------------------------
 
@@ -106,8 +99,8 @@
 Working example
 ---------------
 
-Input files
-===========
+Input file
+==========
 
 Fasta file
 ----------
@@ -143,8 +136,8 @@
 	GCTGGTTTTGCTCAGAGAGCGGGCGCGTGTTCGCCGCGGGTCTCAACGACTTCGGGCAGCTCGGGATAGGCTCCTCCGTGACTCATTCCCTGGTACTGAGCTTCTTGTACATCATGCCTCCA
 	TGTGAAATTTTCATCTACATTGTGAGCCAGCCTACTTTTACACAGTAAGCGAAAGCTGGCTGGACATATCAGAGTTGCAATGGGGATTGACCAAATCAATTCTGACTCCTGTTACATGTTGC
 
-Output files
-============
+Output file
+===========
 
 Diversity
 ---------
@@ -155,7 +148,7 @@
 	LOCOs11g09160;8;6577;6577;2;0.00011728;0.000130324;0.414213;2;0.428571;0.857143;0;1;
 
 
-	</help>
+	]]></help>
     <citations>
         <!-- [HELP] As DOI or BibTex entry -->
     	<citation type="bibtex">@article{Dereeper03062015,