bowtie2: bowtie2_wrapper.xml annotate

annotate bowtie2_wrapper.xml @ 12:781e3a3b9d31 draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a326a3469adfd33babe792cf58544438582a56a1

author	devteam
date	Sun, 08 Jan 2017 07:58:27 -0500
parents	b4e9cf5f2ae8
children	12450efac659

rev	line source
12 781e3a3b9d31 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a326a3469adfd33babe792cf58544438582a56a1 devteam parents: 11 diff changeset	1 <tool id="bowtie2" name="Bowtie2" version="2.3.0">
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	2 <description>- map reads against reference genome</description>
5 42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	3 <macros>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	4 <import>read_group_macros.xml</import>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	5 </macros>
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	6 <requirements>
12 781e3a3b9d31 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a326a3469adfd33babe792cf58544438582a56a1 devteam parents: 11 diff changeset	7 <requirement type="package" version="2.3.0">bowtie2</requirement>
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	8 <requirement type="package" version="1.3.1">samtools</requirement>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	9 </requirements>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	10 <version_command>bowtie2 --version</version_command>
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	11 <command detect_errors="exit_code"><![CDATA[
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	12 ## prepare bowtie2 index
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	13 #set index_path = ''
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	14 #if str($reference_genome.source) == "history":
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	15 bowtie2-build --threads \${GALAXY_SLOTS:-4} '$reference_genome.own_file' genome &&
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	16 ln -s -f '$reference_genome.own_file' genome.fa &&
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	17 #set index_path = 'genome'
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	18 #else:
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	19 #set index_path = '$reference_genome.index.fields.path'
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	20 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	21
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	22 ## execute bowtie2
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	23
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	24 bowtie2
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	25
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	26 ## number of threads
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	27 -p \${GALAXY_SLOTS:-4}
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	28
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	29 ## index file path
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	30 -x '$index_path'
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	31
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	32 ## Fastq inputs
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	33 #if str( $library.type ) == "single":
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	34 -U '${library.input_1}'
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	35 #if str( $library.unaligned_file ) == "true":
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	36 --un '$output_unaligned_reads_l'
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	37 #end if
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	38 #if str( $library.aligned_file ) == "true":
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	39 --al '$output_aligned_reads_l'
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	40 #end if
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	41 #elif str( $library.type ) == "paired":
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	42 -1 '${library.input_1}'
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	43 -2 '${library.input_2}'
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	44 #if str( $library.paired_options.paired_options_selector ) == "yes":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	45 -I "${library.paired_options.I}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	46 -X "${library.paired_options.X}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	47 ${library.paired_options.fr_rf_ff}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	48 ${library.paired_options.no_mixed}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	49 ${library.paired_options.no_discordant}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	50 ${library.paired_options.dovetail}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	51 ${library.paired_options.no_contain}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	52 ${library.paired_options.no_overlap}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	53 #end if
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	54 #if str( $library.unaligned_file ) == "true":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	55 --un-conc $output_unaligned_reads_l
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	56 #end if
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	57 #if str( $library.aligned_file ) == "true":
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	58 --al-conc $output_aligned_reads_l
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	59 #end if
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	60 #else
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	61 ## prepare collection
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	62 -1 $library.input_1.forward
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	63 -2 $library.input_1.reverse
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	64 #if str( $library.paired_options.paired_options_selector ) == "yes":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	65 -I "${library.paired_options.I}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	66 -X "${library.paired_options.X}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	67 ${library.paired_options.fr_rf_ff}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	68 ${library.paired_options.no_mixed}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	69 ${library.paired_options.no_discordant}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	70 ${library.paired_options.dovetail}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	71 ${library.paired_options.no_contain}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	72 ${library.paired_options.no_overlap}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	73 #end if
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	74 #if str( $library.unaligned_file ) == "true":
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	75 --un-conc '$output_unaligned_reads_l'
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	76 #end if
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	77 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	78
5 42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	79 ## Read group information.
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	80 @define_read_group_helpers@
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	81 #if str( $library.type ) == "single":
6 e23b0cdeeba6 planemo upload commit 5ad726dc73203a704666033cd3bf70b82575978f devteam parents: 5 diff changeset	82 #set $rg_auto_name = $read_group_name_default($library.input_1)
5 42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	83 #elif str( $library.type ) == "paired":
6 e23b0cdeeba6 planemo upload commit 5ad726dc73203a704666033cd3bf70b82575978f devteam parents: 5 diff changeset	84 #set $rg_auto_name = $read_group_name_default($library.input_1, $library.input_2)
5 42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	85 #else
6 e23b0cdeeba6 planemo upload commit 5ad726dc73203a704666033cd3bf70b82575978f devteam parents: 5 diff changeset	86 #set $rg_auto_name = $read_group_name_default($library.input_1)
5 42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	87 #end if
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	88 @set_use_rg_var@
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	89 @set_read_group_vars@
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	90 #if $use_rg
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	91 $format_read_group("", $rg_id, '"', arg='--rg-id ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	92 $format_read_group("SM:", $rg_sm, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	93 $format_read_group("PL:", $rg_pl, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	94 $format_read_group("LB:", $rg_lb, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	95 $format_read_group("CN:", $rg_cn, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	96 $format_read_group("DS:", $rg_ds, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	97 $format_read_group("DT:", $rg_dt, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	98 $format_read_group("FO:", $rg_fo, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	99 $format_read_group("KS:", $rg_ks, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	100 $format_read_group("PG:", $rg_pg, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	101 $format_read_group("PI:", $rg_pi, '"', arg='--rg ')
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	102 $format_read_group("PU:", $rg_pu, '"', arg='--rg ')
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	103 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	104
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	105 ## Analysis type
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	106 #if ( str( $analysis_type.analysis_type_selector ) == "simple" and str( $analysis_type.presets ) != "no_presets" ):
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	107 $analysis_type.presets
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	108 #elif str( $analysis_type.analysis_type_selector ) == "full":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	109 #if str( $analysis_type.input_options.input_options_selector ) == "yes":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	110 --skip "${analysis_type.input_options.skip}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	111 --qupto "${analysis_type.input_options.qupto}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	112 --trim5 "${analysis_type.input_options.trim5}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	113 --trim3 "${analysis_type.input_options.trim3}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	114 ${analysis_type.input_options.qv_encoding}
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	115 ${analysis_type.input_options.solexa_quals}
ceb6467e276c Uploaded devteam parents: 2 diff changeset	116 ${analysis_type.input_options.int_quals}
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	117 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	118
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	119 #if str( $analysis_type.alignment_options.alignment_options_selector ) == "yes":
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	120 -N "${analysis_type.alignment_options.N}"
ceb6467e276c Uploaded devteam parents: 2 diff changeset	121 -L "${analysis_type.alignment_options.L}"
ceb6467e276c Uploaded devteam parents: 2 diff changeset	122 -i "${analysis_type.alignment_options.i}"
ceb6467e276c Uploaded devteam parents: 2 diff changeset	123 --n-ceil "${analysis_type.alignment_options.n_ceil}"
ceb6467e276c Uploaded devteam parents: 2 diff changeset	124 --dpad "${analysis_type.alignment_options.dpad}"
ceb6467e276c Uploaded devteam parents: 2 diff changeset	125 --gbar "${analysis_type.alignment_options.gbar}"
ceb6467e276c Uploaded devteam parents: 2 diff changeset	126 ${analysis_type.alignment_options.ignore_quals}
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	127 ${analysis_type.alignment_options.nofw}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	128 ${analysis_type.alignment_options.norc}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	129 ${analysis_type.alignment_options.no_1mm_upfront}
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	130 #if str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "end-to-end":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	131 --end-to-end
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	132 --score-min "${analysis_type.alignment_options.align_mode.score_min_ete}"
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	133 #elif str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	134 --local
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	135 --score-min "${analysis_type.alignment_options.align_mode.score_min_loc}"
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	136 #end if
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	137 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	138
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	139 #if str( $analysis_type.scoring_options.scoring_options_selector ) == "yes":
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	140 #if ( str( $analysis_type.alignment_options.alignment_options_selector ) == "yes" and str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local" ):
ceb6467e276c Uploaded devteam parents: 2 diff changeset	141 --ma "${analysis_type.scoring_options.ma}"
ceb6467e276c Uploaded devteam parents: 2 diff changeset	142 #end if
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	143 --mp "${analysis_type.scoring_options.mp}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	144 --np "${analysis_type.scoring_options.np}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	145 --rdg "${analysis_type.scoring_options.rdg_read_open},${analysis_type.scoring_options.rdg_read_extend}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	146 --rfg "${analysis_type.scoring_options.rfg_ref_open},${analysis_type.scoring_options.rfg_ref_extend}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	147 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	148
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	149 #if str( $analysis_type.reporting_options.reporting_options_selector ) == "k":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	150 -k "${analysis_type.reporting_options.k}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	151 #elif str( $analysis_type.reporting_options.reporting_options_selector ) == "a":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	152 -a
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	153 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	154
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	155 #if str( $analysis_type.effort_options.effort_options_selector ) == "yes":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	156 -D "${analysis_type.effort_options.D}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	157 -R "${analysis_type.effort_options.R}"
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	158 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	159
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	160 #if str( $analysis_type.sam_options.sam_options_selector ) == "yes":
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	161 ${analysis_type.sam_options.no_unal}
ceb6467e276c Uploaded devteam parents: 2 diff changeset	162 ${analysis_type.sam_options.omit_sec_seq}
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	163 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	164
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	165 #if str( $analysis_type.other_options.other_options_selector ) == "yes":
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	166 ${analysis_type.other_options.reorder}
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	167 ${analysis_type.other_options.non_deterministic}
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	168 --seed "${analysis_type.other_options.seed}"
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	169 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	170
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	171 #elif str( $analysis_type.analysis_type_selector ) == "cline":
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	172 ${analysis_type.cline}
4 1fc845afa3ac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 32fe80982b5c59687eece667f0372002588566f8-dirty devteam parents: 3 diff changeset	173 #end if
1fc845afa3ac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 32fe80982b5c59687eece667f0372002588566f8-dirty devteam parents: 3 diff changeset	174
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	175 ## mapping stats (i.e. stderr from bowtie2)
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	176 #if $save_mapping_stats
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	177 2> '$mapping_stats'
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	178 #end if
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	179
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	180 ## output file
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	181 #if ( str( $analysis_type.analysis_type_selector ) != "full" or str( $analysis_type.sam_opt ) != "true" ):
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	182 \| samtools sort -O bam -o '$output'
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	183 #else
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	184 > '$output_sam'
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	185 #end if
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	186
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	187 ## rename unaligned sequence files
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	188 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r:
4 1fc845afa3ac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 32fe80982b5c59687eece667f0372002588566f8-dirty devteam parents: 3 diff changeset	189 #from os.path import splitext
1fc845afa3ac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 32fe80982b5c59687eece667f0372002588566f8-dirty devteam parents: 3 diff changeset	190 #set _unaligned_root, _unaligned_ext = splitext( str( $output_unaligned_reads_l ) )
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	191 && mv "${ _unaligned_root }.1${_unaligned_ext}" '$output_unaligned_reads_l'
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	192 && mv "${ _unaligned_root }.2${_unaligned_ext}" '$output_unaligned_reads_r'
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	193 #end if
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	194 #if $library.type == "paired" and $output_aligned_reads_l and $output_aligned_reads_r:
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	195 #from os.path import splitext
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	196 #set _aligned_root, _aligned_ext = splitext( str( $output_aligned_reads_l ) )
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	197 && mv "${ _aligned_root }.1${_aligned_ext}" '$output_aligned_reads_l'
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	198 && mv "${ _aligned_root }.2${_aligned_ext}" '$output_aligned_reads_r'
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	199 #end if
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	200
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	201 ]]></command>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	202 <inputs>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	203 <!-- single/paired -->
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	204 <conditional name="library">
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	205 <param name="type" type="select" label="Is this single or paired library">
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	206 <option value="single">Single-end</option>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	207 <option value="paired">Paired-end</option>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	208 <option value="paired_collection">Paired-end Dataset Collection</option>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	209 </param>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	210
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	211 <when value="single">
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	212 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Must be of datatype "fastqsanger"" />
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	213 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	214 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc; This triggers --al parameter for single reads and --al-conc for paired reads" />
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	215 </when>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	216 <when value="paired">
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	217 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file #1" help="Must be of datatype "fastqsanger"" />
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	218 <param name="input_2" format="fastqsanger" type="data" label="FASTQ file #2" help="Must be of datatype "fastqsanger"" />
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	219 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	220 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc; This triggers --al parameter for single reads and --al-conc for paired reads" />
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	221 <conditional name="paired_options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	222 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	223 <option value="no" selected="True">No</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	224 <option value="yes">Yes</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	225 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	226 <when value="yes">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	227 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	228 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
ceb6467e276c Uploaded devteam parents: 2 diff changeset	229 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	230 <option value="--fr" selected="True">--fr</option>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	231 <option value="--rf">--rf</option>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	232 <option value="--ff">--ff</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	233 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	234 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	235 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	236 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	237 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	238 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	239 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	240 <when value="no">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	241 <!-- do nothing -->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	242 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	243 </conditional>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	244 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	245 <when value="paired_collection">
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	246 <param name="input_1" format="fastqsanger" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype "fastqsanger"" />
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	247 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	248 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc; This triggers --al parameter for single reads and --al-conc for paired reads" />
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	249 <conditional name="paired_options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	250 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	251 <option value="no" selected="True">No</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	252 <option value="yes">Yes</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	253 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	254 <when value="yes">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	255 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	256 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
ceb6467e276c Uploaded devteam parents: 2 diff changeset	257 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	258 <option value="--fr" selected="True">--fr</option>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	259 <option value="--rf">--rf</option>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	260 <option value="--ff">--ff</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	261 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	262 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	263 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	264 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	265 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	266 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	267 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	268 <when value="no">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	269 <!-- do nothing -->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	270 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	271 </conditional>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	272 </when>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	273 </conditional>
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	274
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	275 <!-- reference genome -->
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	276 <conditional name="reference_genome">
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	277 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options. See `Indexes` section of help below">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	278 <option value="indexed">Use a built-in genome index</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	279 <option value="history">Use a genome from the history and build index</option>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	280 </param>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	281 <when value="indexed">
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	282 <param name="index" type="select" label="Select reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	283 <options from_data_table="bowtie2_indexes">
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	284 <filter type="sort_by" column="2"/>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	285 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	286 </options>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	287 </param>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	288 </when>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	289 <when value="history">
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	290 <param name="own_file" type="data" format="fasta" label="Select reference genome" />
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	291 </when>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	292 </conditional>
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	293
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	294 <!-- read group settings -->
5 42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	295 <expand macro="read_group_conditional" />
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	296 <conditional name="analysis_type">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	297 <param name="analysis_type_selector" type="select" label="Select analysis mode">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	298 <option value="simple">1: Default setting only</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	299 <option value="full">2: Full parameter list</option>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	300 </param>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	301 <when value="simple">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	302 <param name="presets" type="select" display="radio" label="Do you want to use presets?" help="Allow selecting among several preset parameter settings. Choosing between these will result in dramatic changes in runtime. See help below to understand effects of these presets.">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	303 <option value="no_presets" selected="True">No, just use defaults</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	304 <option value="--very-fast">Very fast end-to-end (--very-fast)</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	305 <option value="--fast">Fast end-to-end (--fast)</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	306 <option value="--sensitive">Sensitive end-to-end (--sensitive)</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	307 <option value="--very-sensitive">Very sensitive end-to-end (--very-sensitive)</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	308 <option value="--very-fast-local">Very fast local (--very-fast-local)</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	309 <option value="--fast-local">Fast local (--fast-local)</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	310 <option value="--sensitive-local">Sensitive local (--sensitive-local)</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	311 <option value="--very-sensitive-local">Very sensitive local (--very-sensitive-local)</option>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	312 </param>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	313 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	314 <when value="full">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	315 <conditional name="input_options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	316 <param name="input_options_selector" type="select" label="Do you want to tweak input options?" help="See "Input Options" section of Help below for information">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	317 <option value="yes">Yes</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	318 <option value="no" selected="true">No</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	319 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	320 <when value="yes">
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	321 <param name="skip" type="integer" min="0" value="0" label="Skip (i.e. do not align) the first that many reads or pairs in the input" help="-s/--skip; default=0"/>
ceb6467e276c Uploaded devteam parents: 2 diff changeset	322 <param name="qupto" type="integer" min="1" value="100000000" label="Align the first that many reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop" help="-u/--qupto; for default behavior (no limit) leave this value very large"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	323 <param name="trim5" type="integer" min="0" value="0" label="Trim that many bases from 5' (left) end of each read before alignment" help="-5/--trim5; default=0"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	324 <param name="trim3" type="integer" min="0" value="0" label="Trim that many bases from 3' (right) end of each read before alignment" help="-3/--trim3; default=0"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	325 <param name="qv_encoding" type="select" display="radio" label="Select quality score encoding" help="See help below for more details">
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	326 <option value="--phred33" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option>
ceb6467e276c Uploaded devteam parents: 2 diff changeset	327 <option value="--phred64">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	328 </param>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	329 <param name="solexa_quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default=False"/>
ceb6467e276c Uploaded devteam parents: 2 diff changeset	330 <param name="int_quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified" help="--int-quals; default=False"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	331 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	332 <when value="no">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	333 <!-- do nothing -->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	334 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	335 </conditional>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	336 <conditional name="alignment_options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	337 <param name="alignment_options_selector" type="select" label="Do you want to tweak alignment options?" help="See "Alignment Options" section of Help below for information">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	338 <option value="yes">Yes</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	339 <option value="no" selected="true">No</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	340 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	341 <when value="yes">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	342 <param name="N" type="integer" min="0" max="1" value="0" label="Set the number of mismatches to be allowed in a seed alignment during multiseed alignment (see `Multiseed alignment` section of help below)" help="-N; Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity; default=0"/>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	343 <param name="L" type="integer" min="0" max="32" value="22" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more sensitive. Default=22"/>
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	344 <param name="i" type="text" value="S,1,1.15" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. If the function returns a result less than 1, it is rounded up to 1. Default=`S,1,1.15`"/>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	345 <param name="n_ceil" type="text" value="L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. Reads exceeding this ceiling are filtered out. Default=`L,0,0.15`"/>
ceb6467e276c Uploaded devteam parents: 2 diff changeset	346 <param name="dpad" type="integer" min="0" value="15" label="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	347 <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/>
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	348 <param name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	349 <param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	350 <param name="norc" type="boolean" truevalue="--norc" falsevalue="" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	351 <param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help below)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read before trying the multiseed heuristic. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	352 <conditional name="align_mode">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	353 <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	354 <option value="end-to-end" selected="True">End to End (--end-to-end)</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	355 <option value="local">Local (--local)</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	356 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	357 <when value="end-to-end">
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	358 <param name="score_min_ete" type="text" value="L,-0.6,-0.6" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	359 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	360 <when value="local">
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	361 <param name="score_min_loc" type="text" value="G,20,8" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	362 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	363 </conditional>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	364 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	365 <when value="no">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	366 <!-- do nothing -->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	367 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	368 </conditional>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	369 <conditional name="scoring_options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	370 <param name="scoring_options_selector" type="select" label="Do you want to tweak scoring options?" help="See "Scoring Options" section of Help below for information">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	371 <option value="yes">Yes</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	372 <option value="no" selected="true">No</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	373 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	374 <when value="yes">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	375 <param name="ma" type="integer" value="2" label="Set the match bonus" help="--ma; In `--local` mode match bonus is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in `--end-to-end` mode; Default=2"/>
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	376 <param name="mp" type="text" value="6,2" label="Set the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers" help="--mp; A number less than or equal to `MX` and greater than or equal to `MN` is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`. Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )` where Q is the Phred quality value; Default=6,2"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	377 <param name="np" type="integer" value="1" label="Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as `N`" help="--np; Default=1"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	378 <param name="rdg_read_open" type="integer" value="5" label="Set the read gap opening penalty" help="--rdg; this is the first component of --rdg flag - opening penalty; Default=5"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	379 <param name="rdg_read_extend" type="integer" value="3" label="Set the read gap extension penalty" help="--rdg; this is the second component of --rdg flag - extension penalty; Default=3"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	380 <param name="rfg_ref_open" type="integer" value="5" label="Set the reference gap opening penalty" help="--rfg; this is the first component of --rfg flag - opening penalty; Default=5"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	381 <param name="rfg_ref_extend" type="integer" value="3" label="Set the reference gap extension penalty" help="--rfg; this is the second component of --rfg flag - extension penalty; Default=3"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	382 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	383 <when value="no">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	384 <!-- do nothing -->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	385 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	386 </conditional>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	387 <conditional name="reporting_options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	388 <param name="reporting_options_selector" type="select" label="Do you want to use -a or -k options" help="Make sure you understand implications of setting -k and -a. See "Reporting Options" section of Help below for information on -k and -a options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	389 <option value="no" selected="true">No, do not set</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	390 <option value="k">Set -k option and enter -k value</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	391 <option value="a">Set -a option</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	392 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	393 <when value="no">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	394 <!-- do nothing -->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	395 </when>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	396 <when value="k">
ceb6467e276c Uploaded devteam parents: 2 diff changeset	397 <param name="k" type="integer" min="1" value="1" label="Searches for at most that many distinct, valid alignments for each read" help="-k; see detailed description of this option in the help section below. Note: Bowtie 2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	398 </when>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	399 <when value="a">
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	400 <!-- do nothing here; set -a flag on the command line-->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	401 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	402 </conditional>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	403 <conditional name="effort_options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	404 <param name="effort_options_selector" type="select" label="Do you want to tweak effort options?" help="See "Effort Options" section of Help below for information">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	405 <option value="yes">Yes</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	406 <option value="no" selected="true">No</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	407 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	408 <when value="yes">
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	409 <param name="D" type="integer" value="15" min="0" label="Attempt that many consecutive seed extension attempts to `fail` before Bowtie 2 moves on, using the alignments found so far" help="-D; A seed extension `fails` if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default=15"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	410 <param name="R" type="integer" value="2" min="0" label="Set the maximum number of times Bowtie 2 will `re-seed` reads with repetitive seeds" help="When `re-seeding`, Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default=2"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	411 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	412 <when value="no">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	413 <!-- do nothing -->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	414 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	415 </conditional>
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	416
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	417 <conditional name="sam_options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	418 <param name="sam_options_selector" type="select" label="Do you want to tweak SAM/BAM Options?" help="See "Output Options" section of Help below for information">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	419 <option value="yes">Yes</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	420 <option value="no" selected="true">No</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	421 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	422 <when value="yes">
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	423 <param name="no_unal" type="boolean" truevalue="--no-unal" falsevalue="" label="Suppress SAM records for reads that failed to align" help="--no-unal; Default=False"/>
ceb6467e276c Uploaded devteam parents: 2 diff changeset	424 <param name="omit_sec_seq" type="boolean" truevalue="--omit-sec-seq" falsevalue="" label="Suppress SEQ and QUAL strings for secondary alignments" help="--omit-sec-seq; Default=False"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	425 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	426 <when value="no">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	427 <!-- do nothing -->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	428 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	429 </conditional>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	430 <conditional name="other_options">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	431 <param name="other_options_selector" type="select" label="Do you want to tweak Other Options?" help="See "Other Options" section of Help below for information">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	432 <option value="yes">Yes</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	433 <option value="no" selected="true">No</option>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	434 </param>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	435 <when value="yes">
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	436 <param name="reorder" type="boolean" truevalue="--reorder" falsevalue="" label="Guarantee that output SAM records are printed in an order corresponding to the order of the reads in the original input file" help="--reorder; Default=False"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	437 <param name="seed" type="integer" value="0" min="0" label="Use this number as the seed for pseudo-random number generator" help="--seed; Default=0"/>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	438 <param name="non_deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="--non-deterministic; see Help below for explanation of this option; default=False"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	439 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	440 <when value="no">
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	441 <!-- do nothing -->
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	442 </when>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	443 </conditional>
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	444 <param name="sam_opt" type="boolean" truevalue="true" falsevalue="false" label="Would you like the output to be a SAM file" help="By default, the output from this Bowtie2 wrapper is a sorted BAM file."/>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	445 </when>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	446 </conditional>
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	447 <param name="save_mapping_stats" type="boolean" checked="False" label="Save the bowtie2 mapping statistics to the history" />
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	448 </inputs>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	449
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	450 <!-- define outputs -->
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	451
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	452 <outputs>
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	453
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	454 <data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" >
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	455 <filter>library['unaligned_file'] is True</filter>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	456 <actions>
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	457 <conditional name="library.type">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	458 <when value="single">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	459 <action type="format">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	460 <option type="from_param" name="library.input_1" param_attribute="ext" />
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	461 </action>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	462 </when>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	463 <when value="paired">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	464 <action type="format">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	465 <option type="from_param" name="library.input_1" param_attribute="ext" />
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	466 </action>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	467 </when>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	468 <when value="paired_collection">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	469 <action type="format">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	470 <option type="from_param" name="library.input_1" param_attribute="forward.ext" />
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	471 </action>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	472 </when>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	473 </conditional>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	474 </actions>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	475 </data>
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	476 <data format="fastqsanger" name="output_aligned_reads_l" label="${tool.name} on ${on_string}: aligned reads (L)" >
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	477 <filter>library['aligned_file'] is True</filter>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	478 <actions>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	479 <conditional name="library.type">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	480 <when value="single">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	481 <action type="format">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	482 <option type="from_param" name="library.input_1" param_attribute="ext" />
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	483 </action>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	484 </when>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	485 <when value="paired">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	486 <action type="format">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	487 <option type="from_param" name="library.input_1" param_attribute="ext" />
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	488 </action>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	489 </when>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	490 <when value="paired_collection">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	491 <action type="format">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	492 <option type="from_param" name="library.input_1" param_attribute="forward.ext" />
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	493 </action>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	494 </when>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	495 </conditional>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	496 </actions>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	497 </data>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	498 <data format="fastqsanger" name="output_aligned_reads_r" label="${tool.name} on ${on_string}: aligned reads (R)">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	499 <filter>( library['type'] == "paired" or library['type'] == "paired_collection" ) and library['aligned_file'] is True</filter>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	500 <actions>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	501 <conditional name="library.type">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	502 <when value="paired">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	503 <action type="format">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	504 <option type="from_param" name="library.input_2" param_attribute="ext" />
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	505 </action>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	506 </when>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	507 <when value="paired_collection">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	508 <action type="format">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	509 <option type="from_param" name="library.input_1" param_attribute="reverse.ext" />
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	510 </action>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	511 </when>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	512 </conditional>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	513 </actions>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	514 </data>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	515 <data format="fastqsanger" name="output_unaligned_reads_r" label="${tool.name} on ${on_string}: unaligned reads (R)">
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	516 <filter>( library['type'] == "paired" or library['type'] == "paired_collection" ) and library['unaligned_file'] is True</filter>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	517 <actions>
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	518 <conditional name="library.type">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	519 <when value="paired">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	520 <action type="format">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	521 <option type="from_param" name="library.input_2" param_attribute="ext" />
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	522 </action>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	523 </when>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	524 <when value="paired_collection">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	525 <action type="format">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	526 <option type="from_param" name="library.input_1" param_attribute="reverse.ext" />
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	527 </action>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	528 </when>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	529 </conditional>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	530 </actions>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	531 </data>
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	532
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	533 <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads (sorted BAM)">
7 4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	534 <filter>analysis_type['analysis_type_selector'] == "simple" or analysis_type['sam_opt'] is False</filter>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	535 <actions>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	536 <conditional name="reference_genome.source">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	537 <when value="indexed">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	538 <action type="metadata" name="dbkey">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	539 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	540 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	541 <filter type="param_value" ref="reference_genome.index" column="0"/>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	542 </option>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	543 </action>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	544 </when>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	545 <when value="history">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	546 <action type="metadata" name="dbkey">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	547 <option type="from_param" name="reference_genome.own_file" param_attribute="dbkey" />
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	548 </action>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	549 </when>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	550 </conditional>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	551 </actions>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	552 </data>
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	553
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	554 <data format="sam" name="output_sam" label="${tool.name} on ${on_string}: aligned reads (SAM)">
4f92dccc808a planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a1517c9d22029095120643bbe2c8fa53754dd2b7 devteam parents: 6 diff changeset	555 <filter>analysis_type['analysis_type_selector'] == "full" and analysis_type['sam_opt'] is True</filter>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	556 <actions>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	557 <conditional name="reference_genome.source">
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	558 <when value="indexed">
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	559 <action type="metadata" name="dbkey">
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	560 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0">
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	561 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	562 <filter type="param_value" ref="reference_genome.index" column="0"/>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	563 </option>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	564 </action>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	565 </when>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	566 <when value="history">
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	567 <action type="metadata" name="dbkey">
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	568 <option type="from_param" name="reference_genome.own_file" param_attribute="dbkey" />
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	569 </action>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	570 </when>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	571 </conditional>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	572 </actions>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	573 </data>
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	574 <data format="txt" name="mapping_stats" label="${tool.name} on ${on_string}: mapping stats">
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	575 <filter>save_mapping_stats is True</filter>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	576 </data>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	577
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	578 </outputs>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	579
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	580 <tests>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	581 <test>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	582 <!-- basic test on single paired default run -->
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	583 <param name="type" value="paired"/>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	584 <param name="selection" value="no"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	585 <param name="paired_options_selector" value="no"/>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	586 <param name="unaligned_file" value="false"/>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	587 <param name="analysis_type_selector" value="simple"/>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	588 <param name="source" value="history" />
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	589 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	590 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	591 <param name="own_file" value="bowtie2-ref.fasta" />
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	592 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	593 </test>
5 42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	594 <test>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	595 <!-- basic test on single paired default run -->
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	596 <param name="type" value="paired"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	597 <param name="selection" value="no"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	598 <param name="paired_options_selector" value="no"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	599 <param name="unaligned_file" value="false"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	600 <param name="analysis_type_selector" value="simple"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	601 <param name="rg_selector" value="set"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	602 <param name="ID" value="rg1"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	603 <param name="PL" value="CAPILLARY"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	604 <param name="source" value="history" />
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	605 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	606 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	607 <param name="own_file" value="bowtie2-ref.fasta" />
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	608 <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/>
42bb952b4e3c planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e3412c58bd3bdc1a483a1e2f7f9c2aa5c87a1f-dirty devteam parents: 4 diff changeset	609 </test>
10 a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	610 <test>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	611 <!-- basic test on single paired default run with stats-->
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	612 <param name="type" value="paired"/>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	613 <param name="selection" value="no"/>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	614 <param name="paired_options_selector" value="no"/>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	615 <param name="unaligned_file" value="false"/>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	616 <param name="analysis_type_selector" value="simple"/>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	617 <param name="source" value="history" />
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	618 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	619 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	620 <param name="own_file" value="bowtie2-ref.fasta" />
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	621 <param name="save_mapping_stats" value="true" />
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	622 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	623 <output name="mapping_stats" file="bowtie2-stats.out" ftype="txt"/>
a9d4f71dbfb0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 320f7fb84d2fda19f6cccdb38b4ef49edec4169d devteam parents: 8 diff changeset	624 </test>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	625 </tests>
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	626
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	627 <help><![CDATA[
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	628
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	629 Bowtie2 Overview
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	630
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	631 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	632 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	633
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	634 .. _Bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	635 .. _`Bowtie2 manual`: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	636 .. _`BAM format`: http://samtools.github.io/hts-specs/SAMv1.pdf
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	637
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	638 -----
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	639
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	640 Selecting reference genomes for Bowtie2
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	641
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	642 Galaxy wrapper for Bowtie2 allows you select between precomputed and user-defined indices for reference genomes using Will you select a reference genome from your history or use a built-in index? flag. This flag has two options:
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	643
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	644 1. Use a built-in genome index - when selected (this is default), Galaxy provides the user with Select reference genome index dropdown. Genomes listed in this dropdown have been pre-indexed with bowtie2-build utility and are ready to be mapped against.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	645 2. Use a genome from the history and build index - when selected, Galaxy provides the user with Select reference genome sequence dropdown. This dropdown is populated by all FASTA formatted files listed in your current history. If your genome of interest is uploaded into history it will be shown there. Selecting a genome from this dropdown will cause Galaxy to first transparently index it using bowtie2-build command, and then run mapping with bowtie2.
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	646
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	647 If your genome of interest is not listed here you have two choices:
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	648
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	649 1. Contact galaxy team using Help->Support link at the top of the interface and let us know that an index needs to be added
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	650 2. Upload your genome of interest as a FASTA file to Galaxy history and selected Use a genome from the history and build index option.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	651
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	652 ------
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	653
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	654 .. class:: infomark
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	655
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	656 Bowtie2 options
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	657
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	658 Galaxy wrapper for Bowtie2 implements most but not all options available through the command line. Supported options are described below.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	659
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	660 -----
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	661
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	662 Inputs
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	663
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	664 Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files.
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	665
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	666 ------
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	667
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	668 Input options::
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	669
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	670 -s/--skip <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	671 Skip (i.e. do not align) the first `<int>` reads or pairs in the input.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	672
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	673 -u/--qupto <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	674 Align the first `<int>` reads or read pairs from the input (after the
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	675 `-s`/`--skip` reads or pairs have been skipped), then stop. Default: no limit.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	676
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	677 -5/--trim5 <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	678 Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0).
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	679
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	680 -3/--trim3 <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	681 Trim `<int>` bases from 3' (right) end of each read before alignment (default: 0).
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	682
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	683 --phred33
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	684 Input qualities are ASCII chars equal to the Phred quality plus 33. This is
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	685 also called the "Phred+33" encoding, which is used by the very latest Illumina
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	686 pipelines.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	687
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	688 --phred64
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	689 Input qualities are ASCII chars equal to the Phred quality plus 64. This is
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	690 also called the "Phred+64" encoding.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	691
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	692 --solexa-quals
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	693 Convert input qualities from Solexa Phred quality (which can be negative) to
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	694 Phred Phred quality (which can't). This scheme was used in older Illumina GA
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	695 Pipeline versions (prior to 1.3). Default: off.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	696
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	697 --int-quals
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	698 Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`....
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	699 Integers are treated as being on the Phred quality scale unless
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	700 `--solexa-quals` is also specified. Default: off.
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	701
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	702 ------
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	703
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	704 Presets in `--end-to-end` mode::
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	705
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	706 --very-fast
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	707 Same as: `-D 5 -R 1 -N 0 -L 22 -i S,0,2.50`
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	708
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	709 --fast
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	710 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50`
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	711
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	712 --sensitive
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	713 Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in `--end-to-end` mode)
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	714
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	715 --very-sensitive
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	716 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	717
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	718 ------
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	719
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	720 Presets options in `--local` mode::
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	721
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	722 --very-fast-local
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	723 Same as: `-D 5 -R 1 -N 0 -L 25 -i S,1,2.00`
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	724
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	725 --fast-local
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	726 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,1,1.75`
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	727
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	728 --sensitive-local
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	729 Same as: `-D 15 -R 2 -N 0 -L 20 -i S,1,0.75` (default in `--local` mode)
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	730
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	731 --very-sensitive-local
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	732 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	733
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	734 ------
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	735
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	736 Alignment options::
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	737
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	738 -N <int>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	739 Sets the number of mismatches to allowed in a seed alignment during multiseed
ceb6467e276c Uploaded devteam parents: 2 diff changeset	740 alignment. Can be set to 0 or 1. Setting this higher makes alignment slower
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	741 (often much slower) but increases sensitivity. Default: 0.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	742
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	743 -L <int>
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	744 Sets the length of the seed substrings to align during multiseed alignment.
ceb6467e276c Uploaded devteam parents: 2 diff changeset	745 Smaller values make alignment slower but more sensitive. Default: the
ceb6467e276c Uploaded devteam parents: 2 diff changeset	746 `--sensitive` preset is used by default, which sets `-L` to 22 in
ceb6467e276c Uploaded devteam parents: 2 diff changeset	747 `--end-to-end` mode and to 20 in `--local` mode.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	748
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	749 -i <func>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	750 Sets a function governing the interval between seed substrings to use during
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	751 multiseed alignment. For instance, if the read has 30 characers, and seed
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	752 length is 10, and the seed interval is 6, the seeds extracted will be:
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	753
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	754 Read: TAGCTACGCTCTACGCTATCATGCATAAAC
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	755 Seed 1 fw: TAGCTACGCT
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	756 Seed 1 rc: AGCGTAGCTA
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	757 Seed 2 fw: CGCTCTACGC
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	758 Seed 2 rc: GCGTAGAGCG
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	759 Seed 3 fw: ACGCTATCAT
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	760 Seed 3 rc: ATGATAGCGT
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	761 Seed 4 fw: TCATGCATAA
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	762 Seed 4 rc: TTATGCATGA
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	763
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	764 Since it's best to use longer intervals for longer reads, this parameter sets
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	765 the interval as a function of the read length, rather than a single
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	766 one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	767 interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length.
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	768 If the function returns a result less than
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	769 1, it is rounded up to 1. Default: the `--sensitive` preset is used by
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	770 default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75`
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	771 in `--local` mode.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	772
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	773 --n-ceil <func>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	774 Sets a function governing the maximum number of ambiguous characters (usually
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	775 `N`s and/or `.`s) allowed in a read as a function of read length. For instance,
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	776 specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`,
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	777 where x is the read length. Reads exceeding this ceiling are filtered out.
ceb6467e276c Uploaded devteam parents: 2 diff changeset	778 Default: `L,0,0.15`.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	779
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	780 --dpad <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	781 "Pads" dynamic programming problems by `<int>` columns on either side to allow
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	782 gaps. Default: 15.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	783
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	784 --gbar <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	785 Disallow gaps within `<int>` positions of the beginning or end of the read.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	786 Default: 4.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	787
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	788 --ignore-quals
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	789 When calculating a mismatch penalty, always consider the quality value at the
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	790 mismatched position to be the highest possible, regardless of the actual value.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	791 I.e. input is treated as though all quality values are high. This is also the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	792 default behavior when the input doesn't specify quality values (e.g. in `-f`,
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	793 `-r`, or `-c` modes).
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	794
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	795 --nofw/--norc
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	796 If `--nofw` is specified, `bowtie2` will not attempt to align unpaired reads to
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	797 the forward (Watson) reference strand. If `--norc` is specified, `bowtie2` will
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	798 not attempt to align unpaired reads against the reverse-complement (Crick)
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	799 reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	800 fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	801 paired-end configurations corresponding to fragments from the reverse-complement
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	802 (Crick) strand. Default: both strands enabled.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	803
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	804 --no-1mm-upfront
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	805 By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	806 end-to-end alignment for the read before trying the multiseed heuristic. Such
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	807 alignments can be found very quickly, and many short read alignments have exact or
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	808 near-exact end-to-end alignments. However, this can lead to unexpected
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	809 alignments when the user also sets options governing the multiseed heuristic,
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	810 like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	811 to the length of the read, the user will be surprised to find 1-mismatch alignments
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	812 reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	813 alignments before using the multiseed heuristic, which leads to the expected
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	814 behavior when combined with options such as `-L` and `-N`. This comes at the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	815 expense of speed.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	816
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	817 --end-to-end
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	818 In this mode, Bowtie 2 requires that the entire read align from one end to the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	819 other, without any trimming (or "soft clipping") of characters from either end.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	820 The match bonus `--ma` always equals 0 in this mode, so all alignment scores
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	821 are less than or equal to 0, and the greatest possible alignment score is 0.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	822 This is mutually exclusive with `--local`. `--end-to-end` is the default mode.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	823
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	824 --local
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	825 In this mode, Bowtie 2 does not require that the entire read align from one end
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	826 to the other. Rather, some characters may be omitted ("soft clipped") from the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	827 ends in order to achieve the greatest possible alignment score. The match bonus
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	828 `--ma` is used in this mode, and the best possible alignment score is equal to
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	829 the match bonus (`--ma`) times the length of the read. Specifying `--local`
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	830 and one of the presets (e.g. `--local --very-fast`) is equivalent to specifying
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	831 the local version of the preset (`--very-fast-local`). This is mutually
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	832 exclusive with `--end-to-end`. `--end-to-end` is the default mode.
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	833
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	834 -----
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	835
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	836 Scoring options::
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	837
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	838 --ma <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	839 Sets the match bonus. In `--local` mode `<int>` is added to the alignment
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	840 score for each position where a read character aligns to a reference character
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	841 and the characters match. Not used in `--end-to-end` mode. Default: 2.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	842
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	843 --mp MX,MN
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	844 Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers. A
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	845 number less than or equal to `MX` and greater than or equal to `MN` is
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	846 subtracted from the alignment score for each position where a read character
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	847 aligns to a reference character, the characters do not match, and neither is an
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	848 `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	849 Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )`
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	850 where Q is the Phred quality value. Default: `MX` = 6, `MN` = 2.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	851
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	852 --np <int>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	853 Sets penalty for positions where the read, reference, or both, contain an
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	854 ambiguous character such as `N`. Default: 1.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	855
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	856 --rdg <int1>,<int2>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	857 Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties. A read gap of
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	858 length N gets a penalty of `<int1>` + N * `<int2>`. Default: 5, 3.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	859
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	860 --rfg <int1>,<int2>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	861 Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties. A
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	862 reference gap of length N gets a penalty of `<int1>` + N * `<int2>`. Default:
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	863 5, 3.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	864
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	865 --score-min <func>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	866 Sets a function governing the minimum alignment score needed for an alignment to
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	867 be considered "valid" (i.e. good enough to report). This is a function of read
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	868 length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f`
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	869 to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	870 the default in `--local` mode is `G,20,8`.
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	871
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	872 -----
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	873
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	874 Reporting options::
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	875
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	876 -k <int>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	877 By default, `bowtie2` searches for distinct, valid alignments for each read.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	878 When it finds a valid alignment, it continues looking for alignments that are
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	879 nearly as good or better. The best alignment found is reported (randomly
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	880 selected from among best if tied). Information about the best alignments is
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	881 used to estimate mapping quality and to set SAM optional fields, such as
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	882 `AS:i` and `XS:i`.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	883
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	884 When `-k` is specified, however, `bowtie2` behaves differently. Instead, it
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	885 searches for at most `<int>` distinct, valid alignments for each read. The
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	886 search terminates when it can't find more distinct valid alignments, or when it
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	887 finds `<int>`, whichever happens first. All alignments found are reported in
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	888 descending order by alignment score. The alignment score for a paired-end
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	889 alignment equals the sum of the alignment scores of the individual mates. Each
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	890 reported read or pair alignment beyond the first has the SAM 'secondary' bit
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	891 (which equals 256) set in its FLAGS field. For reads that have more than
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	892 `<int>` distinct, valid alignments, `bowtie2` does not guarantee that the
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	893 `<int>` alignments reported are the best possible in terms of alignment score.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	894 `-k` is mutually exclusive with `-a`.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	895
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	896 Note: Bowtie 2 is not designed with large values for `-k` in mind, and when
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	897 aligning reads to long, repetitive genomes large `-k` can be very, very slow.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	898
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	899 -a
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	900 Like `-k` but with no upper limit on number of alignments to search for. `-a`
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	901 is mutually exclusive with `-k`.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	902
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	903 Note: Bowtie 2 is not designed with `-a` mode in mind, and when
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	904 aligning reads to long, repetitive genomes this mode can be very, very slow.
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	905
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	906 -----
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	907
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	908 Effort options::
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	909
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	910 -D <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	911 Up to `<int>` consecutive seed extension attempts can "fail" before Bowtie 2
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	912 moves on, using the alignments found so far. A seed extension "fails" if it
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	913 does not yield a new best or a new second-best alignment. This limit is
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	914 automatically adjusted up when -k or -a are specified. Default: 15.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	915
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	916 -R <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	917 `<int>` is the maximum number of times Bowtie 2 will "re-seed" reads with
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	918 repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	919 (same length, same number of mismatches allowed) at different offsets and
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	920 searches for more alignments. A read is considered to have repetitive seeds if
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	921 the total number of seed hits divided by the number of seeds that aligned at
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	922 least once is greater than 300. Default: 2.
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	923
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	924 -----
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	925
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	926 Paired-end options::
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	927
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	928 -I/--minins <int>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	929 The minimum fragment length for valid paired-end alignments. E.g. if `-I 60` is
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	930 specified and a paired-end alignment consists of two 20-bp alignments in the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	931 appropriate orientation with a 20-bp gap between them, that alignment is
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	932 considered valid (as long as `-X` is also satisfied). A 19-bp gap would not
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	933 be valid in that case. If trimming options `-3` or `-5` are also used, the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	934 `-I` constraint is applied with respect to the untrimmed mates.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	935
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	936 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	937 run. This is because larger differences bewteen `-I` and `-X` require that
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	938 Bowtie 2 scan a larger window to determine if a concordant alignment exists.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	939 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	940 efficient.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	941
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	942 Default: 0 (essentially imposing no minimum)
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	943
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	944 -X/--maxins <int>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	945 The maximum fragment length for valid paired-end alignments. E.g. if `-X 100`
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	946 is specified and a paired-end alignment consists of two 20-bp alignments in the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	947 proper orientation with a 60-bp gap between them, that alignment is considered
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	948 valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	949 that case. If trimming options `-3` or `-5` are also used, the `-X`
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	950 constraint is applied with respect to the untrimmed mates, not the trimmed
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	951 mates.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	952
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	953 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	954 run. This is because larger differences bewteen `-I` and `-X` require that
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	955 Bowtie 2 scan a larger window to determine if a concordant alignment exists.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	956 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	957 efficient.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	958
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	959 Default: 500.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	960
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	961 --fr/--rf/--ff
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	962 The upstream/downstream mate orientations for a valid paired-end alignment
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	963 against the forward reference strand. E.g., if `--fr` is specified and there is
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	964 a candidate paired-end alignment where mate 1 appears upstream of the reverse
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	965 complement of mate 2 and the fragment length constraints (`-I` and `-X`) are
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	966 met, that alignment is valid. Also, if mate 2 appears upstream of the reverse
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	967 complement of mate 1 and all other constraints are met, that too is valid.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	968 `--rf` likewise requires that an upstream mate1 be reverse-complemented and a
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	969 downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	970 and a downstream mate 2 to be forward-oriented. Default: `--fr` (appropriate
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	971 for Illumina's Paired-end Sequencing Assay).
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	972
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	973 --no-mixed
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	974 By default, when `bowtie2` cannot find a concordant or discordant alignment for
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	975 a pair, it then tries to find alignments for the individual mates. This option
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	976 disables that behavior.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	977
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	978 --no-discordant
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	979 By default, `bowtie2` looks for discordant alignments if it cannot find any
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	980 concordant alignments. A discordant alignment is an alignment where both mates
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	981 align uniquely, but that does not satisfy the paired-end constraints
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	982 (`--fr`/`--rf`/`--ff`, `-I`, `-X`). This option disables that behavior.
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	983
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	984 --dovetail
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	985 If the mates "dovetail", that is if one mate alignment extends past the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	986 beginning of the other such that the wrong mate begins upstream, consider that
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	987 to be concordant. Default: mates cannot dovetail in a concordant alignment.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	988
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	989 --no-contain
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	990 If one mate alignment contains the other, consider that to be non-concordant.
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	991 Default: a mate can contain the other in a concordant alignment.
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	992
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	993 --no-overlap
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	994 If one mate alignment overlaps the other at all, consider that to be
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	995 non-concordant. Default: mates can overlap in a concordant alignment.
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	996
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	997 ------
96d2e31a3938 Imported from capsule None devteam parents: diff changeset	998
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	999 SAM options::
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	1000
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1001 --rg-id <text>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1002 Set the read group ID to `<text>`. This causes the SAM `@RG` header line to be
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1003 printed, with `<text>` as the value associated with the `ID:` tag. It also
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1004 causes the `RG:Z:` extra field to be attached to each SAM output record, with
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1005 value set to `<text>`.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	1006
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1007 --rg <text>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1008 Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1009 `@RG` header line. Note: in order for the `@RG` line to appear, `--rg-id`
3 ceb6467e276c Uploaded devteam parents: 2 diff changeset	1010 must also be specified. This is because the `ID` tag is required by the SAM
ceb6467e276c Uploaded devteam parents: 2 diff changeset	1011 Specification. Specify `--rg` multiple times to set multiple fields. See the
ceb6467e276c Uploaded devteam parents: 2 diff changeset	1012 SAM Specification for details about what fields are legal.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	1013
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1014 --omit-sec-seq
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1015 When printing secondary alignments, Bowtie 2 by default will write out the `SEQ`
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1016 and `QUAL` strings. Specifying this option causes Bowtie 2 to print an asterix
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1017 in those fields instead.
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1018
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1019 -----
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	1020
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1021 Other options::
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	1022
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1023 --reorder
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1024 Guarantees that output SAM records are printed in an order corresponding to the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1025 order of the reads in the original input file, even when `-p` is set greater
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1026 than 1. Specifying `--reorder` and setting `-p` greater than 1 causes Bowtie
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1027 2 to run somewhat slower and use somewhat more memory then if `--reorder` were
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1028 not specified. Has no effect if `-p` is set to 1, since output order will
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1029 naturally correspond to input order in that case.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	1030
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1031 --seed <int>
b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1032 Use `<int>` as the seed for pseudo-random number generator. Default: 0.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	1033
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1034 --non-deterministic
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1035 Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1036 seeds the generator with a number derived from (a) the read name, (b) the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1037 nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed`
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1038 option. This means that if two reads are identical (same name, same
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1039 nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s)
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1040 for both, even if there was ambiguity. When `--non-deterministic` is specified,
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1041 Bowtie 2 re-initializes its pseudo-random generator for each read using the
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1042 current time. This means that Bowtie 2 will not necessarily report the same
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1043 alignment for two identical reads. This is counter-intuitive for some users,
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1044 but might be more appropriate in situations where the input consists of many
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1045 identical reads.
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	1046
11 b4e9cf5f2ae8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1047 ]]></help>
2 c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1048 <citations>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1049 <citation type="doi">10.1186/gb-2009-10-3-r25</citation>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1050 <citation type="doi">10.1038/nmeth.1923</citation>
c1ec08cb34f9 Uploaded devteam parents: 0 diff changeset	1051 </citations>
0 96d2e31a3938 Imported from capsule None devteam parents: diff changeset	1052 </tool>

Mercurial > repos > devteam > bowtie2

annotate bowtie2_wrapper.xml @ 12:781e3a3b9d31 draft