Mercurial > repos > devteam > bowtie2
comparison bowtie2_wrapper.xml @ 2:c1ec08cb34f9 draft
Uploaded
| author | devteam |
|---|---|
| date | Fri, 12 Dec 2014 11:12:27 -0500 |
| parents | 96d2e31a3938 |
| children | ceb6467e276c |
comparison
equal
deleted
inserted
replaced
| 1:a54de7e658f7 | 2:c1ec08cb34f9 |
|---|---|
| 1 <tool id="bowtie2" name="Bowtie2" version="0.2"> | 1 <tool id="bowtie2" name="Bowtie2" version="0.3"> |
| 2 <!-- Wrapper compatible with Bowtie version 2.0.0 --> | 2 <!-- Wrapper compatible with Bowtie version 2.2.4 --> |
| 3 <description>is a short-read aligner</description> | 3 <description>- map reads against reference genome</description> |
| 4 <version_command>bowtie2 --version</version_command> | 4 <version_command>bowtie2 --version</version_command> |
| 5 <requirements> | 5 <requirements> |
| 6 <requirement type="package" version="2.1.0">bowtie2</requirement> | 6 <requirement type="package" version="2.2.4">bowtie2</requirement> |
| 7 <requirement type="package" version="0.1.18">samtools</requirement> | 7 <requirement type="package" version="0.1.18">samtools</requirement> |
| 8 </requirements> | 8 </requirements> |
| 9 | |
| 10 <command> | 9 <command> |
| 10 | |
| 11 ## prepare bowtie2 index | 11 ## prepare bowtie2 index |
| 12 #set index_path = '' | 12 #set index_path = '' |
| 13 #if str($reference_genome.source) == "history": | 13 #if str($reference_genome.source) == "history": |
| 14 bowtie2-build "$reference_genome.own_file" genome; ln -s "$reference_genome.own_file" genome.fa; | 14 bowtie2-build "$reference_genome.own_file" genome && |
| 15 ln -s "$reference_genome.own_file" genome.fa && | |
| 15 #set index_path = 'genome' | 16 #set index_path = 'genome' |
| 16 #else: | 17 #else: |
| 17 #set index_path = $reference_genome.index.fields.path | 18 #set index_path = $reference_genome.index.fields.path |
| 18 #end if | 19 #end if |
| 19 | 20 |
| 20 ## execute bowtie2 | 21 ## execute bowtie2 |
| 22 | |
| 21 bowtie2 | 23 bowtie2 |
| 22 | 24 |
| 23 ## number of threads | 25 ## number of threads |
| 24 -p \${GALAXY_SLOTS:-4} | 26 -p \${GALAXY_SLOTS:-4} |
| 25 | 27 |
| 26 ## index file path | 28 ## index file path |
| 27 -x $index_path | 29 -x $index_path |
| 28 | 30 |
| 29 ## check for single/pair-end | 31 |
| 30 #if str( $library.type ) == "single" | 32 ## Fastq inputs |
| 31 ## prepare inputs | 33 #if str( $library.type ) == "single": |
| 32 -U $library.input_1 | 34 -U "${input_1}" |
| 33 | 35 #if str( $library.unaligned_file ) == "true": |
| 34 #if $output_unaligned_reads_l | |
| 35 --un $output_unaligned_reads_l | 36 --un $output_unaligned_reads_l |
| 36 #end if | 37 #end if |
| 38 #elif str( $library.type ) == "paired": | |
| 39 -1 "${input_1}" | |
| 40 -2 "${input_2}" | |
| 41 #if str( $library.paired_options.paired_options_selector ) == "yes": | |
| 42 -I "${library.paired_options.I}" | |
| 43 -X "${library.paired_options.X}" | |
| 44 ${library.paired_options.fr_rf_ff} | |
| 45 ${library.paired_options.no_mixed} | |
| 46 ${library.paired_options.no_discordant} | |
| 47 ${library.paired_options.dovetail} | |
| 48 ${library.paired_options.no_contain} | |
| 49 ${library.paired_options.no_overlap} | |
| 50 #end if | |
| 51 #if str( $library.unaligned_file ) == "true": | |
| 52 --un-conc $output_unaligned_reads_l | |
| 53 #end if | |
| 37 #else | 54 #else |
| 38 ## prepare inputs | 55 ## prepare collection |
| 39 -1 $library.input_1 | 56 -1 $library.input_1.forward |
| 40 -2 $library.input_2 | 57 -2 $library.input_1.reverse |
| 41 -I $library.min_insert | 58 #if str( $library.paired_options.paired_options_selector ) == "yes": |
| 42 -X $library.max_insert | 59 -I "${library.paired_options.I}" |
| 43 | 60 -X "${library.paired_options.X}" |
| 44 #if $output_unaligned_reads_l | 61 ${library.paired_options.fr_rf_ff} |
| 62 ${library.paired_options.no_mixed} | |
| 63 ${library.paired_options.no_discordant} | |
| 64 ${library.paired_options.dovetail} | |
| 65 ${library.paired_options.no_contain} | |
| 66 ${library.paired_options.no_overlap} | |
| 67 #end if | |
| 68 #if str( $library.unaligned_file ) == "true": | |
| 45 --un-conc $output_unaligned_reads_l | 69 --un-conc $output_unaligned_reads_l |
| 46 #end if | 70 #end if |
| 47 #end if | 71 #end if |
| 48 | 72 |
| 49 ## configure settings | 73 ## Readgroups |
| 50 #if str($params.full) == "yes": | 74 #if str( $read_group.read_group_selector ) == "yes": |
| 51 ## add alignment type | 75 --rg-id "${read_group.rgid}" |
| 52 $params.align_type | 76 --rg "SM:${read_group.rgsm}" |
| 53 | 77 --rg "LB:${read_group.rglb}" |
| 54 ## add performance | 78 --rg "PL:${read_group.rgpl}" |
| 55 $params.performance | |
| 56 | |
| 57 ## add time flag | |
| 58 $params.time | |
| 59 | |
| 60 ## add nofw/norc | |
| 61 $params.nofw_norc | |
| 62 | |
| 63 ## set gbar | |
| 64 --gbar $params.gbar | |
| 65 | |
| 66 ## check skip | |
| 67 #if str($params.skip) != "0": | |
| 68 -s $params.skip | |
| 69 #end if | |
| 70 | |
| 71 ## check upto | |
| 72 #if str($params.upto) != "0": | |
| 73 -u $params.upto | |
| 74 #end if | |
| 75 | |
| 76 ## check trim5 | |
| 77 #if str($params.trim5) != "0": | |
| 78 -5 $params.trim5 | |
| 79 #end if | |
| 80 | |
| 81 ## check trim3 | |
| 82 #if str($params.trim3) != "0": | |
| 83 -3 $params.trim3 | |
| 84 #end if | |
| 85 #end if | 79 #end if |
| 86 | 80 |
| 87 ## read group information | 81 ## Analysis type |
| 88 #if str($read_group.selection) == "yes": | 82 #if ( str( $analysis_type.analysis_type_selector ) == "simple" and str( $analysis_type.presets ) != "no_presets" ): |
| 89 #if $read_group.rgid and $read_group.rglb and $read_group.rgpl and $read_group.rgsm: | 83 $analysis_type.presets |
| 90 --rg-id "$read_group.rgid" | 84 #elif str( $analysis_type.analysis_type_selector ) == "full": |
| 91 --rg "LB:$read_group.rglb" | 85 #if str( $analysis_type.input_options.input_options_selector ) == "yes": |
| 92 --rg "PL:$read_group.rgpl" | 86 --skip "${analysis_type.input_options.skip}" |
| 93 --rg "SM:$read_group.rgsm" | 87 --qupto "${analysis_type.input_options.qupto}" |
| 94 #end if | 88 --trim5 "${analysis_type.input_options.trim5}" |
| 95 #end if | 89 --trim3 "${analysis_type.input_options.trim3}" |
| 96 | 90 ${analysis_type.input_options.qv_encoding} |
| 97 ## view/sort and output file | 91 ${analysis_type.input_options.solexa-quals} |
| 92 ${analysis_type.input_options.int-quals} | |
| 93 #end if | |
| 94 | |
| 95 #if str( $analysis_type.alignment_options.alignment_options_selector ) == "yes": | |
| 96 -N "${$analysis_type.alignment_options.N}" | |
| 97 -L "${$analysis_type.alignment_options.L}" | |
| 98 -i "${$analysis_type.alignment_options.i}" | |
| 99 --n_ceil "${$analysis_type.alignment_options.n_ceil}" | |
| 100 --dpad "${$analysis_type.alignment_options.dpad}" | |
| 101 --gbar "${$analysis_type.alignment_options.gbar}" | |
| 102 ${analysis_type.alignment_options.ignore-quals} | |
| 103 ${analysis_type.alignment_options.nofw} | |
| 104 ${analysis_type.alignment_options.norc} | |
| 105 ${analysis_type.alignment_options.no_1mm_upfront} | |
| 106 #if str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "end-to-end": | |
| 107 --end-to-end | |
| 108 --score-min "${$analysis_type.alignment_options.align_mode.core-min}" | |
| 109 #elif str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local": | |
| 110 --local | |
| 111 --score-min "${$analysis_type.alignment_options.align_mode.core-min}" | |
| 112 #end if | |
| 113 #end if | |
| 114 | |
| 115 #if str( $analysis_type.scoring_options.scoring_options_selector ) == "yes": | |
| 116 --ma "${analysis_type.scoring_options.ma}" | |
| 117 --mp "${analysis_type.scoring_options.mp}" | |
| 118 --np "${analysis_type.scoring_options.np}" | |
| 119 --rdg "${analysis_type.scoring_options.rdg_read_open},${analysis_type.scoring_options.rdg_read_extend}" | |
| 120 --rfg "${analysis_type.scoring_options.rfg_ref_open},${analysis_type.scoring_options.rfg_ref_extend}" | |
| 121 #end if | |
| 122 | |
| 123 #if str( $analysis_type.reporting_options.reporting_options_selector ) == "k": | |
| 124 -k "${analysis_type.reporting_options.k}" | |
| 125 #elif str( $analysis_type.reporting_options.reporting_options_selector ) == "a": | |
| 126 -a | |
| 127 #end if | |
| 128 | |
| 129 #if str( $analysis_type.effort_options.effort_options_selector ) == "yes": | |
| 130 -D "${analysis_type.effort_options.D}" | |
| 131 -R "${analysis_type.effort_options.R}" | |
| 132 #end if | |
| 133 | |
| 134 #if str( $analysis_type.sam_options.sam_options_selector ) == "yes": | |
| 135 ${analysis_type.sam_options.no-unal} | |
| 136 ${analysis_type.sam_options.omit-sec-seq} | |
| 137 #end if | |
| 138 | |
| 139 #if str( $analysis_type.other_options.other_options_selector ) == "yes": | |
| 140 ${analysis_type.other_options.reorder} | |
| 141 ${analysis_type.other_options.non-deterministic} | |
| 142 --seed "${analysis_type.other_options.seed}" | |
| 143 #end if | |
| 144 | |
| 145 #elif str( $analysis_type.analysis_type_selector ) == "cline": | |
| 146 ${analysis_type.cline} | |
| 147 #end if | |
| 148 | |
| 149 ## view/sort and output BAM file | |
| 98 | samtools view -Su - | samtools sort -o - - > $output | 150 | samtools view -Su - | samtools sort -o - - > $output |
| 99 | 151 |
| 100 ## rename unaligned sequence files | 152 ## rename unaligned sequence files |
| 101 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r: | 153 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r: |
| 102 #set left = str($output_unaligned_reads_l).replace( '.dat', '.1.dat' ) | 154 #set left = str($output_unaligned_reads_l).replace( '.dat', '.1.dat' ) |
| 103 #set right = str($output_unaligned_reads_l).replace( '.dat', '.2.dat' ) | 155 #set right = str($output_unaligned_reads_l).replace( '.dat', '.2.dat' ) |
| 104 | 156 |
| 105 ; mv $left $output_unaligned_reads_l; | 157 ; mv $left $output_unaligned_reads_l; |
| 106 mv $right $output_unaligned_reads_r | 158 mv $right $output_unaligned_reads_r |
| 107 #end if | 159 #end if |
| 160 | |
| 108 </command> | 161 </command> |
| 109 | 162 |
| 110 <!-- basic error handling --> | 163 <!-- basic error handling --> |
| 111 <stdio> | 164 <stdio> |
| 112 <exit_code range="1:" level="fatal" description="Tool exception" /> | 165 <exit_code range="1:" level="fatal" description="Tool exception" /> |
| 113 </stdio> | 166 </stdio> |
| 114 | 167 |
| 115 <inputs> | 168 <inputs> |
| 116 <!-- single/paired --> | 169 <!-- single/paired --> |
| 117 <conditional name="library"> | 170 <conditional name="library"> |
| 118 <param name="type" type="select" label="Is this library mate-paired?"> | 171 <param name="type" type="select" label="Is this single or paired library"> |
| 119 <option value="single">Single-end</option> | 172 <option value="single">Single-end</option> |
| 120 <option value="paired">Paired-end</option> | 173 <option value="paired">Paired-end</option> |
| 174 <option value="paired_collection">Paired-end Dataset Collection</option> | |
| 121 </param> | 175 </param> |
| 176 | |
| 122 <when value="single"> | 177 <when value="single"> |
| 123 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33"/> | 178 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33"/> |
| 179 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" /> | |
| 124 </when> | 180 </when> |
| 125 <when value="paired"> | 181 <when value="paired"> |
| 126 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> | 182 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> |
| 127 <param name="input_2" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> | 183 <param name="input_2" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> |
| 128 <param name="min_insert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments" /> | 184 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" /> |
| 129 <param name="max_insert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments" /> | 185 <conditional name="paired_options"> |
| 186 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information"> | |
| 187 <option value="no" selected="True">No</option> | |
| 188 <option value="yes">Yes</option> | |
| 189 </param> | |
| 190 <when value="yes"> | |
| 191 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/> | |
| 192 <param name="X" type="integer" value="500" min="0" lable="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Deafult=500"/> | |
| 193 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriatefor Illumina's Paired-end Sequencing Assay)"> | |
| 194 <option value="--fr" selected="True">--fr</option> | |
| 195 <option value="--rf">--fr</option> | |
| 196 <option value="--ff">--ff</option> | |
| 197 </param> | |
| 198 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/> | |
| 199 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/> | |
| 200 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also: `Mates can overlap, contain or dovetail each other` in help section below; default=False"/> | |
| 201 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/> | |
| 202 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/> | |
| 203 </when> | |
| 204 <when value="no"> | |
| 205 <!-- do nothing --> | |
| 206 </when> | |
| 207 </conditional> | |
| 208 </when> | |
| 209 <when value="paired_collection"> | |
| 210 <param name="input_1" format="fastqsanger" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> | |
| 211 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" /> | |
| 212 <conditional name="paired_options"> | |
| 213 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information"> | |
| 214 <option value="no" selected="True">No</option> | |
| 215 <option value="yes">Yes</option> | |
| 216 </param> | |
| 217 <when value="yes"> | |
| 218 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/> | |
| 219 <param name="X" type="integer" value="500" min="0" lable="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Deafult=500"/> | |
| 220 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriatefor Illumina's Paired-end Sequencing Assay)"> | |
| 221 <option value="--fr" selected="True">--fr</option> | |
| 222 <option value="--rf">--fr</option> | |
| 223 <option value="--ff">--ff</option> | |
| 224 </param> | |
| 225 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/> | |
| 226 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/> | |
| 227 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also: `Mates can overlap, contain or dovetail each other` in help section below; default=False"/> | |
| 228 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/> | |
| 229 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/> | |
| 230 </when> | |
| 231 <when value="no"> | |
| 232 <!-- do nothing --> | |
| 233 </when> | |
| 234 </conditional> | |
| 130 </when> | 235 </when> |
| 131 </conditional> | 236 </conditional> |
| 132 | 237 |
| 133 <!-- unaligned file --> | |
| 134 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads to separate file(s)" /> | |
| 135 | |
| 136 <!-- reference genome --> | 238 <!-- reference genome --> |
| 137 <conditional name="reference_genome"> | 239 <conditional name="reference_genome"> |
| 138 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> | 240 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options. See `Indexes` section of help below"> |
| 139 <option value="indexed">Use a built-in index</option> | 241 <option value="indexed">Use a built-in genome index</option> |
| 140 <option value="history">Use one from the history</option> | 242 <option value="history">Use a genome from the history and build index</option> |
| 141 </param> | 243 </param> |
| 142 <when value="indexed"> | 244 <when value="indexed"> |
| 143 <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team"> | 245 <param name="index" type="select" label="Select reference genome" help="If your genome of interest is not listed, contact the Galaxy team"> |
| 144 <options from_data_table="bowtie2_indexes"> | 246 <options from_data_table="bowtie2_indexes"> |
| 145 <filter type="sort_by" column="2"/> | 247 <filter type="sort_by" column="2"/> |
| 146 <validator type="no_options" message="No indexes are available for the selected input dataset"/> | 248 <validator type="no_options" message="No indexes are available for the selected input dataset"/> |
| 147 </options> | 249 </options> |
| 148 </param> | 250 </param> |
| 149 </when> | 251 </when> |
| 150 <when value="history"> | 252 <when value="history"> |
| 151 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" /> | 253 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select reference genome" /> |
| 152 </when> | 254 </when> |
| 153 </conditional> | 255 </conditional> |
| 154 | 256 |
| 155 <!-- group settings --> | 257 <!-- read group settings --> |
| 156 <conditional name="read_group"> | 258 <conditional name="read_group"> |
| 157 <param name="selection" type="select" label="Specify the read group for this file?"> | 259 <param name="read_group_selector" type="select" label="Specify the read group for this file?" help="Specifying readgroup information can greatly simplify your downstream analyses by allowing combining multiple datasets. See help below for more details"> |
| 158 <option value="yes">Yes</option> | 260 <option value="yes">Yes</option> |
| 159 <option value="no" selected="True">No</option> | 261 <option value="no" selected="True">No</option> |
| 160 </param> | 262 </param> |
| 161 <when value="yes"> | 263 <when value="yes"> |
| 162 <param name="rgid" type="text" size="25" label="Read group identifier (ID). Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section." help="Required if RG specified. Read group IDs may be modified when merging SAM files in order to handle collisions." /> | 264 <param name="rgid" type="text" size="25" label="Read group identifier (ID). Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section." help="--rg-id; Required if RG specified. Read group IDs may be modified when merging SAM files in order to handle collisions." /> |
| 163 <param name="rglb" type="text" size="25" label="Library name (LB)" help="Required if RG specified" /> | 265 <param name="rglb" type="text" size="25" label="Library name (LB)" help="--rg; Required if RG specified" /> |
| 164 <param name="rgpl" type="text" size="25" label="Platform/technology used to produce the reads (PL)" help="Required if RG specified. Valid values : CAPILLARY, LS454, ILLUMINA, SOLID, HELICOS, IONTORRENT and PACBIO" /> | 266 <param name="rgpl" type="text" size="25" label="Platform/technology used to produce the reads (PL)" help="--rg; Required if RG specified. Valid values : CAPILLARY, LS454, ILLUMINA, SOLID, HELICOS, IONTORRENT and PACBIO" /> |
| 165 <param name="rgsm" type="text" size="25" label="Sample (SM)" help="Required if RG specified. Use pool name where a pool is being sequenced" /> | 267 <param name="rgsm" type="text" size="25" label="Sample (SM)" help="--rg; Required if RG specified. Use pool name where a pool is being sequenced" /> |
| 166 </when> | 268 </when> |
| 167 <when value="no" /> | 269 <when value="no" /> |
| 168 </conditional> | 270 </conditional> |
| 169 | 271 |
| 170 <!-- full/advanced params. --> | 272 <conditional name="analysis_type"> |
| 171 <conditional name="params"> | 273 <param name="analysis_type_selector" type="select" label="Select analysis mode"> |
| 172 <param name="full" type="select" label="Parameter Settings" help="You can use the default settings or set custom values for any of Bowtie's parameters."> | 274 <option value="simple">1: Default setting only</option> |
| 173 <option value="no">Use defaults</option> | 275 <option value="full">2: Full parameter list</option> |
| 174 <option value="yes">Full parameter list</option> | |
| 175 </param> | 276 </param> |
| 176 <when value="yes"> | 277 <when value="simple"> |
| 177 <param name="align_type" type="select" label="Type of alignment"> | 278 <param name="presets" type="select" display="radio" label="Do you want to use presets?" help="Allow selecting among several preset parameter settings. Choosing between these will result in dramatic changes in runtime. See help below to understand effects of these presets."> |
| 178 <option value="" selected="true">End to end</option> | 279 <option value="no_presets" selected="True">No, just use defaults</option> |
| 179 <option value="--local">Local</option> | 280 <option value="--very-fast">Very fast end-to-end (--very-fast)</option> |
| 281 <option value="--fast">Fast end-to-end (--fast)</option> | |
| 282 <option value="--sensitive">Sensitive end-to-end (--sensitive)</option> | |
| 283 <option value="--very-sensitive">Very sensitive end-to-end (--very-sensitive)</option> | |
| 284 <option value="--very-fast-local">Very fast local (--very-fast-local)</option> | |
| 285 <option value="--fast-local">Fast local (--fast-local)</option> | |
| 286 <option value="--sensitive-local">Sensitive local (--sensitive-local)</option> | |
| 287 <option value="--very-sensitive-local">Very sensitive local (--very-sensitive-local)</option> | |
| 180 </param> | 288 </param> |
| 289 </when> | |
| 290 <when value="full"> | |
| 291 <conditional name="input_options"> | |
| 292 <param name="input_options_selector" type="select" label="Do you want to tweak input options?" help="See "Input Options" section of Help below for information"> | |
| 293 <option value="yes">Yes</option> | |
| 294 <option value="no" selected="true">No</option> | |
| 295 </param> | |
| 296 <when value="yes"> | |
| 297 <param name="skip" type="integer" min="0" value="0" lable="Skip (i.e. do not align) the first that many reads or pairs in the input" help="-s/--skip; default=0"/> | |
| 298 <param name="qupto" type="integer" min="-1" value="-1" label="Align the first that many reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop" help="-u/--qupto; default=-1 (no limit)"/> | |
| 299 <param name="trim5" type="integer" min="0" value="0" label="Trim that many bases from 5' (left) end of each read before alignment" help="-5/--trim5; default=0"/> | |
| 300 <param name="trim3" type="integer" min="0" value="0" label="Trim that many bases from 3' (right) end of each read before alignment" help="-3/--trim3; default=0"/> | |
| 301 <param name="qv_encoding" type="select" display="radio" label="Select quality score encoding" help="See help below for more details"> | |
| 302 <option value="--phred33">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option> | |
| 303 <option value="--phred64" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option> | |
| 304 </param> | |
| 305 <param name="solexa-quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default=False"/> | |
| 306 <param name="int-quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified" help="--int-quals; default=False"/> | |
| 307 </when> | |
| 308 <when value="no"> | |
| 309 <!-- do nothing --> | |
| 310 </when> | |
| 311 </conditional> | |
| 312 <conditional name="alignment_options"> | |
| 313 <param name="alignment_options_selector" type="select" label="Do you want to tweak alignment options?" help="See "Alignment Options" section of Help below for information"> | |
| 314 <option value="yes">Yes</option> | |
| 315 <option value="no" selected="true">No</option> | |
| 316 </param> | |
| 317 <when value="yes"> | |
| 318 <param name="N" type="integer" min="0" max="1" value="0" label="Set the number of mismatches to be allowed in a seed alignment during multiseed alignment (see `Multiseed alignment` section of help below)" help="-N; Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity; default=0"/> | |
| 319 <param name="L" type="integer" min="0" value="20" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more senstive. Default: the `--sensitive` preset is used by default, which sets `-L` to 20 both in `--end-to-end` mode and in `--local` mode"/> | |
| 320 <param name="i" type="text" value="S,1,1.15" size="10" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. See also `Setting function options` below in help section. If the function returns a result less than 1, it is rounded up to 1. Default: the `--sensitive` preset is used by default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75` in `--local` mode"/> | |
| 321 <param name="n_ceil" type="text" value="`L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. See also: [setting function options]. Reads exceeding this ceiling are [filtered out]. Default=`L,0,0.15`"/> | |
| 322 <param name="dpad" type="integer" min="0" value="15" lable="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/> | |
| 323 <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/> | |
| 324 <param name="ignore-quals" type="boolean" truevalue="--ignore-quals" falsevalue="" selected="False" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/> | |
| 325 <param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/> | |
| 326 <param name="norc" type="boolean" truevalue="--norc" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/> | |
| 327 <param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" selected="False" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help baelow)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the [multiseed heuristic]. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the [multiseed heuristic], like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the [multiseed heuristic], which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/> | |
| 328 <conditional name="align_mode"> | |
| 329 <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end"> | |
| 330 <option value="end-to-end" selected="True">End to End (--end-to-end)</option> | |
| 331 <option value="local">Local (--local)</option> | |
| 332 </param> | |
| 333 <when value="end-to-end"> | |
| 334 <param name="score-min" type="text" value="G,20,8" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/> | |
| 335 </when> | |
| 336 <when value="local"> | |
| 337 <param name="score-min" type="text" value="L,-0.6,-0.6" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/> | |
| 338 </when> | |
| 339 </conditional> | |
| 340 </when> | |
| 341 <when value="no"> | |
| 342 <!-- do nothing --> | |
| 343 </when> | |
| 344 </conditional> | |
| 345 <conditional name="scoring_options"> | |
| 346 <param name="scoring_options_selector" type="select" label="Do you want to tweak scoring options?" help="See "Scoring Options" section of Help below for information"> | |
| 347 <option value="yes">Yes</option> | |
| 348 <option value="no" selected="true">No</option> | |
| 349 </param> | |
| 350 <when value="yes"> | |
| 351 <param name="ma" type="integer" value="2" label="Set the match bonus" help="--ma; In `--local` mode match bonus is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in `--end-to-end` mode; Default=2"/> | |
| 352 <param name="mp" type="text" size="10" value="6,2" label="Set the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers" help="--mp; A number less than or equal to `MX` and greater than or equal to `MN` is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`. Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )` where Q is the Phred quality value; Default=6,2"/> | |
| 353 <param name="np" type="integer" value="1" label="Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as `N`" help="--np; Default=1"/> | |
| 354 <param name="rdg_read_open" type="integer" value="5" label="Set the read gap opening penalty" help="--rdg; this is the first component of --rdg flag - opening penalty; Default=5"/> | |
| 355 <param name="rdg_read_extend" type="integer" value="3" label="Set the read gap extension penalty" help="--rdg; this is the second component of --rdg flag - extension penalty; Default=3"/> | |
| 356 <param name="rfg_ref_open" type="integer" value="5" label="Set the reference gap opening penalty" help="--rfg; this is the first component of --rfg flag - opening penalty; Default=5"/> | |
| 357 <param name="rfg_ref_extend" type="integer" value="3" label="Set the reference gap extension penalty" help="--rfg; this is the second component of --rfg flag - extension penalty; Default=3"/> | |
| 358 </when> | |
| 359 <when value="no"> | |
| 360 <!-- do nothing --> | |
| 361 </when> | |
| 362 </conditional> | |
| 363 <conditional name="reporting_options"> | |
| 364 <param name="reporting_options_selector" type="select" label="Do you want to use -a or -k options" help="Make sure you understand implications of setting -k and -a. See "Reporting Options" section of Help below for information on -k and -a options"> | |
| 365 <option value="no" selected="true">No, do not set</option> | |
| 366 <option value="k">Set -k option and enter -k value</option> | |
| 367 <option value="a">Set -a option</option> | |
| 368 </param> | |
| 369 <when value="no"> | |
| 370 <!-- do nothing --> | |
| 371 </when> | |
| 372 <when value="-k"> | |
| 373 <param name="k" type="integer" min="0" value="1" label="Searches for at most that many distinct, valid alignments for each read" help="-k; see detalied description of this option in the help section below. Note: Bowtie 2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow"/> | |
| 374 </when> | |
| 375 <when value="-a"> | |
| 376 <!-- do nothing here; set -a flag on the command line--> | |
| 377 </when> | |
| 378 </conditional> | |
| 379 <conditional name="effort_options"> | |
| 380 <param name="effort_options_selector" type="select" label="Do you want to tweak effort options?" help="See "Effort Options" section of Help below for information"> | |
| 381 <option value="yes">Yes</option> | |
| 382 <option value="no" selected="true">No</option> | |
| 383 </param> | |
| 384 <when value="yes"> | |
| 385 <param name="D" type="integer" value="15" min="0" label="Attemp that many consecutive seed extension attempts to `fail` before Bowtie 2 moves on, using the alignments found so far" help="-D; A seed extension `fails` if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default=15"/> | |
| 386 <param name="R" type="integer" value="2" min="0" label="Set the maximum number of times Bowtie 2 will `re-seed` reads with repetitive seeds" help="When `re-seeding`, Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default=2"/> | |
| 387 </when> | |
| 388 <when value="no"> | |
| 389 <!-- do nothing --> | |
| 390 </when> | |
| 391 </conditional> | |
| 181 | 392 |
| 182 <param name="performance" type="select" label="Preset option"> | 393 <conditional name="sam_options"> |
| 183 <option value="">Default</option> | 394 <param name="sam_options_selector" type="select" label="Do you want to tweak SAM/BAM Options?" help="See "Output Options" section of Help below for information"> |
| 184 <option value="--very-fast">Very fast</option> | 395 <option value="yes">Yes</option> |
| 185 <option value="--fast">Fast</option> | 396 <option value="no" selected="true">No</option> |
| 186 <option value="--sensitive" selected="true">Sensitive</option> | 397 </param> |
| 187 <option value="--very-sensitive">Very sensitive</option> | 398 <when value="yes"> |
| 188 </param> | 399 <param name="no-unal" type="boolean" truevalue="--no-unal" falsevalue="" label="Suppress SAM records for reads that failed to align" help="--no-unal; Default=False"/> |
| 189 | 400 <param name="omit-sec-seq" type="boolean" truevalue="--omit-sec-seq" falsevalue="" label="Suppress SEQ and QUAL strings for secondary alignments" help="--omit-sec-seq; Default=False"/> |
| 190 <param name="gbar" type="integer" value="4" label="Disallow gaps within n-positions of read" /> | 401 </when> |
| 191 | 402 <when value="no"> |
| 192 <param name="trim5" type="integer" value="0" label="Trim n-bases from 5' of each read" /> | 403 <!-- do nothing --> |
| 193 | 404 </when> |
| 194 <param name="trim3" type="integer" value="0" label="Trim n-bases from 3' of each read" /> | 405 </conditional> |
| 195 | 406 <conditional name="other_options"> |
| 196 <param name="skip" type="integer" value="0" label="Skip the first n-reads" /> | 407 <param name="other_options_selector" type="select" label="Do you want to tweak Other Options?" help="See "Other Options" section of Help below for information"> |
| 197 | 408 <option value="yes">Yes</option> |
| 198 <param name="upto" type="integer" value="0" label="Number of reads to be aligned (0 = unlimited)" /> | 409 <option value="no" selected="true">No</option> |
| 199 | 410 </param> |
| 200 <param name="nofw_norc" type="select" label="Strand directions"> | 411 <when value="yes"> |
| 201 <option value="">Both</option> | 412 <param name="reorder" type="boolean" truevalue="--reorder" falsevalue="" label="Guarantee that output SAM records are printed in an order corresponding to the order of the reads in the original input file" help="--reorder; Default=False"/> |
| 202 <option value="--nofw">Disable forward</option> | 413 <param name="seed" type="integer" value="0" min="0" label="Use this number as the seed for pseudo-random number generator" help="--seed; Default=0"/> |
| 203 <option value="--norc">Disable reverse</option> | 414 <param name="non-deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="--non-deterministic; see Help below for explanation of this option; default=False"/> |
| 204 </param> | 415 </when> |
| 205 | 416 <when value="no"> |
| 206 <param name="time" type="select" label="Log mapping time"> | 417 <!-- do nothing --> |
| 207 <option value="">No</option> | 418 </when> |
| 208 <option value="--time">Yes</option> | 419 </conditional> |
| 209 </param> | |
| 210 | |
| 211 </when> | 420 </when> |
| 212 <when value="no" /> | |
| 213 </conditional> | 421 </conditional> |
| 214 | |
| 215 </inputs> | 422 </inputs> |
| 216 | 423 |
| 217 <!-- define outputs --> | 424 <!-- define outputs --> |
| 425 | |
| 218 <outputs> | 426 <outputs> |
| 427 | |
| 219 <data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" > | 428 <data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" > |
| 220 <filter>unaligned_file is True</filter> | 429 <filter>library['unaligned_file'] is True</filter> |
| 221 <actions> | 430 <actions> |
| 222 <action type="format"> | 431 <action type="format"> |
| 223 <option type="from_param" name="library.input_1" param_attribute="ext" /> | 432 <option type="from_param" name="library.input_1" param_attribute="ext" /> |
| 224 </action> | 433 </action> |
| 225 </actions> | 434 </actions> |
| 226 </data> | 435 </data> |
| 227 <data format="fastqsanger" name="output_unaligned_reads_r" label="${tool.name} on ${on_string}: unaligned reads (R)"> | 436 <data format="fastqsanger" name="output_unaligned_reads_r" label="${tool.name} on ${on_string}: unaligned reads (R)"> |
| 228 <filter>library['type'] == "paired" and unaligned_file is True</filter> | 437 <filter>( library['type'] == "paired" or library['type'] == "paired_collection" ) and library['unaligned_file'] is True</filter> |
| 229 <actions> | 438 <actions> |
| 230 <action type="format"> | 439 <action type="format"> |
| 231 <option type="from_param" name="library.input_1" param_attribute="ext" /> | 440 <option type="from_param" name="library.input_1" param_attribute="ext" /> |
| 232 </action> | 441 </action> |
| 233 </actions> | 442 </actions> |
| 234 </data> | 443 </data> |
| 235 <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads"> | 444 |
| 445 <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads in BAM format"> | |
| 236 <actions> | 446 <actions> |
| 237 <conditional name="reference_genome.source"> | 447 <conditional name="reference_genome.source"> |
| 238 <when value="indexed"> | 448 <when value="indexed"> |
| 239 <action type="metadata" name="dbkey"> | 449 <action type="metadata" name="dbkey"> |
| 240 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0"> | 450 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0"> |
| 254 </outputs> | 464 </outputs> |
| 255 | 465 |
| 256 <tests> | 466 <tests> |
| 257 <test> | 467 <test> |
| 258 <!-- basic test on single paired default run --> | 468 <!-- basic test on single paired default run --> |
| 259 <param name="type" value="single"/> | 469 <param name="type" value="paired"/> |
| 260 <param name="selection" value="no"/> | 470 <param name="selection" value="no"/> |
| 261 <param name="full" value="no"/> | 471 <param name="paired_options_selector" value="no"/> |
| 262 <param name="unaligned_file" value="false"/> | 472 <param name="unaligned_file" value="false"/> |
| 473 <param name="analysis_type_selector" value="simple"/> | |
| 263 <param name="source" value="history" /> | 474 <param name="source" value="history" /> |
| 264 <param name="input_1" value="bowtie2/phix_reads.fastq" ftype="fastqsanger"/> | 475 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/> |
| 265 <param name="own_file" value="bowtie2/phix_genome.fasta" /> | 476 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/> |
| 266 <output name="output" file="bowtie2/phix_mapped.bam" /> | 477 <param name="own_file" value="bowtie2-ref.fasta" /> |
| 478 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> | |
| 267 </test> | 479 </test> |
| 268 </tests> | 480 </tests> |
| 269 | 481 |
| 270 <help> | 482 <help> |
| 483 | |
| 271 **Bowtie2 Overview** | 484 **Bowtie2 Overview** |
| 272 | 485 |
| 273 Bowtie_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Bowtie 2 outputs alignments in SAM format, enabling interoperation with a large number of other tools. | 486 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site. |
| 274 | 487 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead. |
| 275 *Please cite:* Langmead, B., Trapnell, C., Pop, M. and Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25 (2009) | 488 |
| 276 | 489 .. _Bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/ |
| 277 .. _Bowtie: http://bowtie-bio.sourceforge.net/bowtie2/ | 490 .. _`Bowtie2 manual`: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml |
| 491 .. _`BAM format`: http://samtools.github.io/hts-specs/SAMv1.pdf | |
| 492 | |
| 493 ----- | |
| 494 | |
| 495 **Selecting reference genomes for Bowtie2** | |
| 496 | |
| 497 Galaxy wrapper for Bowtie2 allows you select between precomputed and user-defined indices for reference genomes using **Will you select a reference genome from your history or use a built-in index?** flag. This flag has two options: | |
| 498 | |
| 499 1. **Use a built-in genome index** - when selected (this is default), Galaxy provides the user with **Select reference genome index** dropdown. Genomes listed in this dropdown have been pre-indexed with bowtie2-build utility and are ready to be mapped against. | |
| 500 2. **Use a genome from the history and build index** - when selected, Galaxy provides the user with **Select reference genome sequence** dropdown. This dropdown is populated by all FASTA formatted files listed in your current history. If your genome of interest is uploaded into history it will be shown there. Selecting a genome from this dropdown will cause Galaxy to first transparently index it using bowtie2-build command, and then run mapping with bowtie2. | |
| 501 | |
| 502 If your genome of interest is not listed here you have two choices: | |
| 503 | |
| 504 1. Contact galaxy team using **Help->Support** link at the top of the interface and let us know that an index needs to be added | |
| 505 2. Upload your genome of interest as a FASTA file to Galaxy history and selected **Use a genome from the history and build index** option. | |
| 278 | 506 |
| 279 ------ | 507 ------ |
| 280 | 508 |
| 509 .. class:: infomark | |
| 510 | |
| 511 **Bowtie2 options** | |
| 512 | |
| 513 Galaxy wrapper for Bowtie2 implements most but not all options available through the command line. Supported options are described below. | |
| 514 | |
| 515 ----- | |
| 516 | |
| 281 **Inputs** | 517 **Inputs** |
| 282 | 518 |
| 283 Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files. | 519 Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files. |
| 284 | 520 |
| 285 ------ | 521 ------ |
| 286 | 522 |
| 287 **Outputs** | 523 **Input options**:: |
| 288 | 524 |
| 289 The mapped sequence reads are provided as BAM file, while unmapped reads are optionally available as SAM records. When Bowtie 2 finishes running, it prints messages summarizing what happened. These messages are printed to the "standard error" ("stderr") filehandle. For datasets consisting of unpaired reads, the summary might look like this:: | 525 -s/--skip <int> |
| 290 | 526 Skip (i.e. do not align) the first `<int>` reads or pairs in the input. |
| 291 20000 reads; of these: | 527 |
| 292 20000 (100.00%) were unpaired; of these: | 528 -u/--qupto <int> |
| 293 1247 (6.24%) aligned 0 times | 529 Align the first `<int>` reads or read pairs from the input (after the |
| 294 18739 (93.69%) aligned exactly 1 time | 530 `-s`/`--skip` reads or pairs have been skipped), then stop. Default: no limit. |
| 295 14 (0.07%) aligned >1 times | 531 |
| 296 93.77% overall alignment rate | 532 -5/--trim5 <int> |
| 297 | 533 Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0). |
| 534 | |
| 535 -3/--trim3 <int> | |
| 536 Trim `<int>` bases from 3' (right) end of each read before alignment (default: 0). | |
| 537 | |
| 538 --phred33 | |
| 539 Input qualities are ASCII chars equal to the Phred quality plus 33. This is | |
| 540 also called the "Phred+33" encoding, which is used by the very latest Illumina | |
| 541 pipelines. | |
| 542 | |
| 543 --phred64 | |
| 544 Input qualities are ASCII chars equal to the [Phred quality] plus 64. This is | |
| 545 also called the "Phred+64" encoding. | |
| 546 | |
| 547 --solexa-quals | |
| 548 Convert input qualities from Solexa Phred quality (which can be negative) to | |
| 549 Phred Phred quality (which can't). This scheme was used in older Illumina GA | |
| 550 Pipeline versions (prior to 1.3). Default: off. | |
| 551 | |
| 552 --int-quals | |
| 553 Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`.... | |
| 554 Integers are treated as being on the [Phred quality] scale unless | |
| 555 `--solexa-quals` is also specified. Default: off. | |
| 556 | |
| 298 ------ | 557 ------ |
| 299 | 558 |
| 300 **Alignment options** | 559 **Presets in `--end-to-end` mode**:: |
| 301 | 560 |
| 302 *--end-to-end/--local* | 561 --very-fast |
| 303 | 562 Same as: `-D 5 -R 1 -N 0 -L 22 -i S,0,2.50` |
| 304 By default, Bowtie 2 performs end-to-end read alignment. That is, it searches for alignments involving all of the read characters. This is also called an "untrimmed" or "unclipped" alignment. When the --local option is specified, Bowtie 2 performs local read alignment. In this mode, Bowtie 2 might "trim" or "clip" some read characters from one or both ends of the alignment if doing so maximizes the alignment score. | 563 |
| 305 | 564 --fast |
| 306 End-to-end alignment example:: | 565 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50` |
| 307 | 566 |
| 308 Read GACTGGGCGATCTCGACTTCG | 567 --sensitive |
| 309 ||||| |||||||||||||| | 568 Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in `--end-to-end` mode) |
| 310 Reference GACTG--CGATCTCGACATCG | 569 |
| 311 | 570 --very-sensitive |
| 312 Local alignment example:: | 571 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50` |
| 313 | |
| 314 Read ACGGTTGCGTTAA-TCCGCCACG | |
| 315 ||||||||| |||||| | |
| 316 Reference TAACTTGCGTTAAATCCGCCTGG | |
| 317 | |
| 318 *-s/--skip (default: 0)* | |
| 319 | |
| 320 Skip (i.e. do not align) the first n-reads or pairs in the input. | |
| 321 | |
| 322 *-u/--qupto (default: no limit)* | |
| 323 | |
| 324 Align the first n-reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop. | |
| 325 | |
| 326 *-5/--trim5 (default: 0)* | |
| 327 | |
| 328 Trim n-bases from 5' (left) end of each read before alignment. | |
| 329 | |
| 330 *-3/--trim3 (default: 0)* | |
| 331 | |
| 332 Trim n-bases from 3' (right) end of each read before alignment. | |
| 333 | |
| 334 *--nofw/--norc (default: both strands enabled)* | |
| 335 | |
| 336 If --nofw is specified, Bowtie 2 will not attempt to align unpaired reads to the forward (Watson) reference strand. If --norc is specified, bowtie2 will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --nofw causes Bowtie 2 to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default: both strands enabled. | |
| 337 | |
| 338 *--gbar (default: 4)* | |
| 339 | |
| 340 Disallow gaps within n-positions of the beginning or end of the read. | |
| 341 | 572 |
| 342 ------ | 573 ------ |
| 343 | 574 |
| 344 **Paired-end options** | 575 **Presets options in `--local` mode**:: |
| 345 | 576 |
| 346 *-I/--minins (default: 0)* | 577 --very-fast-local |
| 347 | 578 Same as: `-D 5 -R 1 -N 0 -L 25 -i S,1,2.00` |
| 348 The minimum fragment length for valid paired-end alignments. E.g. if -I 60 is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as -X is also satisfied). A 19-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -I constraint is applied with respect to the untrimmed mates. | 579 |
| 349 | 580 --fast-local |
| 350 The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. | 581 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,1,1.75` |
| 351 | 582 |
| 352 *-X/--maxins (default: 0)* | 583 --sensitive-local |
| 353 | 584 Same as: `-D 15 -R 2 -N 0 -L 20 -i S,1,0.75` (default in `--local` mode) |
| 354 The maximum fragment length for valid paired-end alignments. E.g. if -X 100 is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied). A 61-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -X constraint is applied with respect to the untrimmed mates, not the trimmed mates. | 585 |
| 355 | 586 --very-sensitive-local |
| 356 The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. | 587 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50` |
| 357 | 588 |
| 358 ------ | 589 ------ |
| 359 | 590 |
| 360 **SAM options** | 591 **Alignment options**:: |
| 361 | 592 |
| 362 *--rg-id [text]* | 593 -N <int> |
| 363 | 594 Sets the number of mismatches to allowed in a seed alignment during [multiseed |
| 364 Set the read group ID to [text]. This causes the SAM @RG header line to be printed, with [text] as the value associated with the ID: tag. It also causes the RG:Z: extra field to be attached to each SAM output record, with value set to [text]. | 595 alignment]. Can be set to 0 or 1. Setting this higher makes alignment slower |
| 365 | 596 (often much slower) but increases sensitivity. Default: 0. |
| 366 *--rg [text]* | 597 |
| 367 | 598 -L <int> |
| 368 Add [text] as a field on the @RG header line. Note: in order for the @RG line to appear, --rg-id must also be specified. This is because the ID tag is required by the SAM Spec. Specify --rg multiple times to set multiple fields. See the SAM Spec for details about what fields are legal. | 599 Sets the length of the seed substrings to align during [multiseed alignment]. |
| 369 | 600 Smaller values make alignment slower but more senstive. Default: the |
| 601 `--sensitive` preset is used by default, which sets `-L` to 20 both in | |
| 602 `--end-to-end` mode and in `--local` mode. | |
| 603 | |
| 604 -i <func> | |
| 605 Sets a function governing the interval between seed substrings to use during | |
| 606 [multiseed alignment]. For instance, if the read has 30 characers, and seed | |
| 607 length is 10, and the seed interval is 6, the seeds extracted will be: | |
| 608 | |
| 609 Read: TAGCTACGCTCTACGCTATCATGCATAAAC | |
| 610 Seed 1 fw: TAGCTACGCT | |
| 611 Seed 1 rc: AGCGTAGCTA | |
| 612 Seed 2 fw: CGCTCTACGC | |
| 613 Seed 2 rc: GCGTAGAGCG | |
| 614 Seed 3 fw: ACGCTATCAT | |
| 615 Seed 3 rc: ATGATAGCGT | |
| 616 Seed 4 fw: TCATGCATAA | |
| 617 Seed 4 rc: TTATGCATGA | |
| 618 | |
| 619 Since it's best to use longer intervals for longer reads, this parameter sets | |
| 620 the interval as a function of the read length, rather than a single | |
| 621 one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the | |
| 622 interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. | |
| 623 See also: [setting function options]. If the function returns a result less than | |
| 624 1, it is rounded up to 1. Default: the `--sensitive` preset is used by | |
| 625 default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75` | |
| 626 in `--local` mode. | |
| 627 | |
| 628 --n-ceil <func> | |
| 629 Sets a function governing the maximum number of ambiguous characters (usually | |
| 630 `N`s and/or `.`s) allowed in a read as a function of read length. For instance, | |
| 631 specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, | |
| 632 where x is the read length. See also: [setting function options]. Reads | |
| 633 exceeding this ceiling are [filtered out]. Default: `L,0,0.15`. | |
| 634 | |
| 635 --dpad <int> | |
| 636 "Pads" dynamic programming problems by `<int>` columns on either side to allow | |
| 637 gaps. Default: 15. | |
| 638 | |
| 639 --gbar <int> | |
| 640 Disallow gaps within `<int>` positions of the beginning or end of the read. | |
| 641 Default: 4. | |
| 642 | |
| 643 --ignore-quals | |
| 644 When calculating a mismatch penalty, always consider the quality value at the | |
| 645 mismatched position to be the highest possible, regardless of the actual value. | |
| 646 I.e. input is treated as though all quality values are high. This is also the | |
| 647 default behavior when the input doesn't specify quality values (e.g. in `-f`, | |
| 648 `-r`, or `-c` modes). | |
| 649 | |
| 650 --nofw/--norc | |
| 651 If `--nofw` is specified, `bowtie2` will not attempt to align unpaired reads to | |
| 652 the forward (Watson) reference strand. If `--norc` is specified, `bowtie2` will | |
| 653 not attempt to align unpaired reads against the reverse-complement (Crick) | |
| 654 reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the | |
| 655 fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those | |
| 656 paired-end configurations corresponding to fragments from the reverse-complement | |
| 657 (Crick) strand. Default: both strands enabled. | |
| 658 | |
| 659 --no-1mm-upfront | |
| 660 By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch | |
| 661 end-to-end alignment for the read *before* trying the [multiseed heuristic]. Such | |
| 662 alignments can be found very quickly, and many short read alignments have exact or | |
| 663 near-exact end-to-end alignments. However, this can lead to unexpected | |
| 664 alignments when the user also sets options governing the [multiseed heuristic], | |
| 665 like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal | |
| 666 to the length of the read, the user will be surprised to find 1-mismatch alignments | |
| 667 reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end | |
| 668 alignments before using the [multiseed heuristic], which leads to the expected | |
| 669 behavior when combined with options such as `-L` and `-N`. This comes at the | |
| 670 expense of speed. | |
| 671 | |
| 672 --end-to-end | |
| 673 In this mode, Bowtie 2 requires that the entire read align from one end to the | |
| 674 other, without any trimming (or "soft clipping") of characters from either end. | |
| 675 The match bonus `--ma` always equals 0 in this mode, so all alignment scores | |
| 676 are less than or equal to 0, and the greatest possible alignment score is 0. | |
| 677 This is mutually exclusive with `--local`. `--end-to-end` is the default mode. | |
| 678 | |
| 679 --local | |
| 680 In this mode, Bowtie 2 does not require that the entire read align from one end | |
| 681 to the other. Rather, some characters may be omitted ("soft clipped") from the | |
| 682 ends in order to achieve the greatest possible alignment score. The match bonus | |
| 683 `--ma` is used in this mode, and the best possible alignment score is equal to | |
| 684 the match bonus (`--ma`) times the length of the read. Specifying `--local` | |
| 685 and one of the presets (e.g. `--local --very-fast`) is equivalent to specifying | |
| 686 the local version of the preset (`--very-fast-local`). This is mutually | |
| 687 exclusive with `--end-to-end`. `--end-to-end` is the default mode. | |
| 688 | |
| 689 ----- | |
| 690 | |
| 691 **Scoring options**:: | |
| 692 | |
| 693 --ma <int> | |
| 694 Sets the match bonus. In `--local` mode `<int>` is added to the alignment | |
| 695 score for each position where a read character aligns to a reference character | |
| 696 and the characters match. Not used in `--end-to-end` mode. Default: 2. | |
| 697 | |
| 698 --mp MX,MN | |
| 699 Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers. A | |
| 700 number less than or equal to `MX` and greater than or equal to `MN` is | |
| 701 subtracted from the alignment score for each position where a read character | |
| 702 aligns to a reference character, the characters do not match, and neither is an | |
| 703 `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`. | |
| 704 Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )` | |
| 705 where Q is the Phred quality value. Default: `MX` = 6, `MN` = 2. | |
| 706 | |
| 707 --np <int> | |
| 708 Sets penalty for positions where the read, reference, or both, contain an | |
| 709 ambiguous character such as `N`. Default: 1. | |
| 710 | |
| 711 --rdg <int1>,<int2> | |
| 712 Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties. A read gap of | |
| 713 length N gets a penalty of `<int1>` + N * `<int2>`. Default: 5, 3. | |
| 714 | |
| 715 --rfg <int1>,<int2> | |
| 716 Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties. A | |
| 717 reference gap of length N gets a penalty of `<int1>` + N * `<int2>`. Default: | |
| 718 5, 3. | |
| 719 | |
| 720 --score-min <func> | |
| 721 Sets a function governing the minimum alignment score needed for an alignment to | |
| 722 be considered "valid" (i.e. good enough to report). This is a function of read | |
| 723 length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` | |
| 724 to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting | |
| 725 function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and | |
| 726 the default in `--local` mode is `G,20,8`. | |
| 727 | |
| 728 ----- | |
| 729 | |
| 730 **Reporting options**:: | |
| 731 | |
| 732 -k <int> | |
| 733 By default, `bowtie2` searches for distinct, valid alignments for each read. | |
| 734 When it finds a valid alignment, it continues looking for alignments that are | |
| 735 nearly as good or better. The best alignment found is reported (randomly | |
| 736 selected from among best if tied). Information about the best alignments is | |
| 737 used to estimate mapping quality and to set SAM optional fields, such as | |
| 738 `AS:i` and `XS:i`. | |
| 739 | |
| 740 When `-k` is specified, however, `bowtie2` behaves differently. Instead, it | |
| 741 searches for at most `<int>` distinct, valid alignments for each read. The | |
| 742 search terminates when it can't find more distinct valid alignments, or when it | |
| 743 finds `<int>`, whichever happens first. All alignments found are reported in | |
| 744 descending order by alignment score. The alignment score for a paired-end | |
| 745 alignment equals the sum of the alignment scores of the individual mates. Each | |
| 746 reported read or pair alignment beyond the first has the SAM 'secondary' bit | |
| 747 (which equals 256) set in its FLAGS field. For reads that have more than | |
| 748 `<int>` distinct, valid alignments, `bowtie2` does not guarantee that the | |
| 749 `<int>` alignments reported are the best possible in terms of alignment score. | |
| 750 `-k` is mutually exclusive with `-a`. | |
| 751 | |
| 752 Note: Bowtie 2 is not designed with large values for `-k` in mind, and when | |
| 753 aligning reads to long, repetitive genomes large `-k` can be very, very slow. | |
| 754 | |
| 755 -a | |
| 756 Like `-k` but with no upper limit on number of alignments to search for. `-a` | |
| 757 is mutually exclusive with `-k`. | |
| 758 | |
| 759 Note: Bowtie 2 is not designed with `-a` mode in mind, and when | |
| 760 aligning reads to long, repetitive genomes this mode can be very, very slow. | |
| 761 | |
| 762 ----- | |
| 763 | |
| 764 **Effort options**:: | |
| 765 | |
| 766 -D <int> | |
| 767 Up to `<int>` consecutive seed extension attempts can "fail" before Bowtie 2 | |
| 768 moves on, using the alignments found so far. A seed extension "fails" if it | |
| 769 does not yield a new best or a new second-best alignment. This limit is | |
| 770 automatically adjusted up when -k or -a are specified. Default: 15. | |
| 771 | |
| 772 -R <int> | |
| 773 `<int>` is the maximum number of times Bowtie 2 will "re-seed" reads with | |
| 774 repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads | |
| 775 (same length, same number of mismatches allowed) at different offsets and | |
| 776 searches for more alignments. A read is considered to have repetitive seeds if | |
| 777 the total number of seed hits divided by the number of seeds that aligned at | |
| 778 least once is greater than 300. Default: 2. | |
| 779 | |
| 780 ----- | |
| 781 | |
| 782 **Paired-end options**:: | |
| 783 | |
| 784 -I/--minins <int> | |
| 785 The minimum fragment length for valid paired-end alignments. E.g. if `-I 60` is | |
| 786 specified and a paired-end alignment consists of two 20-bp alignments in the | |
| 787 appropriate orientation with a 20-bp gap between them, that alignment is | |
| 788 considered valid (as long as `-X` is also satisfied). A 19-bp gap would not | |
| 789 be valid in that case. If trimming options `-3` or `-5` are also used, the | |
| 790 `-I` constraint is applied with respect to the untrimmed mates. | |
| 791 | |
| 792 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will | |
| 793 run. This is because larger differences bewteen `-I` and `-X` require that | |
| 794 Bowtie 2 scan a larger window to determine if a concordant alignment exists. | |
| 795 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very | |
| 796 efficient. | |
| 797 | |
| 798 Default: 0 (essentially imposing no minimum) | |
| 799 | |
| 800 -X/--maxins <int> | |
| 801 The maximum fragment length for valid paired-end alignments. E.g. if `-X 100` | |
| 802 is specified and a paired-end alignment consists of two 20-bp alignments in the | |
| 803 proper orientation with a 60-bp gap between them, that alignment is considered | |
| 804 valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in | |
| 805 that case. If trimming options `-3` or `-5` are also used, the `-X` | |
| 806 constraint is applied with respect to the untrimmed mates, not the trimmed | |
| 807 mates. | |
| 808 | |
| 809 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will | |
| 810 run. This is because larger differences bewteen `-I` and `-X` require that | |
| 811 Bowtie 2 scan a larger window to determine if a concordant alignment exists. | |
| 812 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very | |
| 813 efficient. | |
| 814 | |
| 815 Default: 500. | |
| 816 | |
| 817 --fr/--rf/--ff | |
| 818 The upstream/downstream mate orientations for a valid paired-end alignment | |
| 819 against the forward reference strand. E.g., if `--fr` is specified and there is | |
| 820 a candidate paired-end alignment where mate 1 appears upstream of the reverse | |
| 821 complement of mate 2 and the fragment length constraints (`-I` and `-X`) are | |
| 822 met, that alignment is valid. Also, if mate 2 appears upstream of the reverse | |
| 823 complement of mate 1 and all other constraints are met, that too is valid. | |
| 824 `--rf` likewise requires that an upstream mate1 be reverse-complemented and a | |
| 825 downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1 | |
| 826 and a downstream mate 2 to be forward-oriented. Default: `--fr` (appropriate | |
| 827 for Illumina's Paired-end Sequencing Assay). | |
| 828 | |
| 829 --no-mixed | |
| 830 By default, when `bowtie2` cannot find a concordant or discordant alignment for | |
| 831 a pair, it then tries to find alignments for the individual mates. This option | |
| 832 disables that behavior. | |
| 833 | |
| 834 --no-discordant | |
| 835 By default, `bowtie2` looks for discordant alignments if it cannot find any | |
| 836 concordant alignments. A discordant alignment is an alignment where both mates | |
| 837 align uniquely, but that does not satisfy the paired-end constraints | |
| 838 (`--fr`/`--rf`/`--ff`, `-I`, `-X`). This option disables that behavior. | |
| 839 | |
| 840 --dovetail | |
| 841 If the mates "dovetail", that is if one mate alignment extends past the | |
| 842 beginning of the other such that the wrong mate begins upstream, consider that | |
| 843 to be concordant. See also: [Mates can overlap, contain or dovetail each | |
| 844 other]. Default: mates cannot dovetail in a concordant alignment. | |
| 845 | |
| 846 --no-contain | |
| 847 If one mate alignment contains the other, consider that to be non-concordant. | |
| 848 See also: [Mates can overlap, contain or dovetail each other]. Default: a mate | |
| 849 can contain the other in a concordant alignment. | |
| 850 | |
| 851 --no-overlap | |
| 852 If one mate alignment overlaps the other at all, consider that to be | |
| 853 non-concordant. See also: [Mates can overlap, contain or dovetail each other]. | |
| 854 Default: mates can overlap in a concordant alignment. | |
| 855 | |
| 370 ------ | 856 ------ |
| 371 | 857 |
| 372 **Output options** | 858 **SAM options**:: |
| 373 | 859 |
| 374 *--un/--un-conc* | 860 --rg-id <text> |
| 375 | 861 Set the read group ID to `<text>`. This causes the SAM `@RG` header line to be |
| 376 Write reads that fail to align concordantly to file(s). These reads correspond to the SAM records. | 862 printed, with `<text>` as the value associated with the `ID:` tag. It also |
| 377 | 863 causes the `RG:Z:` extra field to be attached to each SAM output record, with |
| 378 *-t/--time (default: off)* | 864 value set to `<text>`. |
| 379 | 865 |
| 380 Print the wall-clock time required to load the index files and align the reads. This is printed to the "standard error" ("stderr") filehandle. | 866 --rg <text> |
| 867 Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the | |
| 868 `@RG` header line. Note: in order for the `@RG` line to appear, `--rg-id` | |
| 869 must also be specified. This is because the `ID` tag is required by the [SAM | |
| 870 Spec][SAM]. Specify `--rg` multiple times to set multiple fields. See the | |
| 871 [SAM Spec][SAM] for details about what fields are legal. | |
| 872 | |
| 873 --omit-sec-seq | |
| 874 When printing secondary alignments, Bowtie 2 by default will write out the `SEQ` | |
| 875 and `QUAL` strings. Specifying this option causes Bowtie 2 to print an asterix | |
| 876 in those fields instead. | |
| 877 | |
| 878 ----- | |
| 879 | |
| 880 **Other options**:: | |
| 881 | |
| 882 --reorder | |
| 883 Guarantees that output SAM records are printed in an order corresponding to the | |
| 884 order of the reads in the original input file, even when `-p` is set greater | |
| 885 than 1. Specifying `--reorder` and setting `-p` greater than 1 causes Bowtie | |
| 886 2 to run somewhat slower and use somewhat more memory then if `--reorder` were | |
| 887 not specified. Has no effect if `-p` is set to 1, since output order will | |
| 888 naturally correspond to input order in that case. | |
| 889 | |
| 890 --seed <int> | |
| 891 Use `<int>` as the seed for pseudo-random number generator. Default: 0. | |
| 892 | |
| 893 --non-deterministic | |
| 894 Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It | |
| 895 seeds the generator with a number derived from (a) the read name, (b) the | |
| 896 nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed` | |
| 897 option. This means that if two reads are identical (same name, same | |
| 898 nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s) | |
| 899 for both, even if there was ambiguity. When `--non-deterministic` is specified, | |
| 900 Bowtie 2 re-initializes its pseudo-random generator for each read using the | |
| 901 current time. This means that Bowtie 2 will not necessarily report the same | |
| 902 alignment for two identical reads. This is counter-intuitive for some users, | |
| 903 but might be more appropriate in situations where the input consists of many | |
| 904 identical reads. | |
| 381 | 905 |
| 382 </help> | 906 </help> |
| 907 <citations> | |
| 908 <citation type="doi">10.1186/gb-2009-10-3-r25</citation> | |
| 909 <citation type="doi">10.1038/nmeth.1923</citation> | |
| 910 </citations> | |
| 383 </tool> | 911 </tool> |
