bowtie2: bowtie2_wrapper.xml comparison

comparison bowtie2_wrapper.xml @ 3:ceb6467e276c draft

Uploaded

author	devteam
date	Mon, 09 Mar 2015 11:58:43 -0400
parents	c1ec08cb34f9
children	1fc845afa3ac

comparison

equal deleted inserted replaced

-:c1ec08cb34f9
+:ceb6467e276c
-<tool id="bowtie2" name="Bowtie2" version="0.3">
+<tool id="bowtie2" name="Bowtie2" version="0.4">
 <!-- Wrapper compatible with Bowtie version 2.2.4 -->
 <description>- map reads against reference genome</description>
 <version_command>bowtie2 --version</version_command>
 <requirements>
 <requirement type="package" version="2.2.4">bowtie2</requirement>
 -x $index_path
 ## Fastq inputs
 #if str( $library.type ) == "single":
--U "${input_1}"
+-U "${library.input_1}"
 #if str( $library.unaligned_file ) == "true":
 --un $output_unaligned_reads_l
 #end if
 #elif str( $library.type ) == "paired":
--1 "${input_1}"
+-1 "${library.input_1}"
--2 "${input_2}"
+-2 "${library.input_2}"
 #if str( $library.paired_options.paired_options_selector ) == "yes":
 -I "${library.paired_options.I}"
 -X "${library.paired_options.X}"
 ${library.paired_options.fr_rf_ff}
 ${library.paired_options.no_mixed}
 --skip "${analysis_type.input_options.skip}"
 --qupto "${analysis_type.input_options.qupto}"
 --trim5 "${analysis_type.input_options.trim5}"
 --trim3 "${analysis_type.input_options.trim3}"
 ${analysis_type.input_options.qv_encoding}
-${analysis_type.input_options.solexa-quals}
+${analysis_type.input_options.solexa_quals}
-${analysis_type.input_options.int-quals}
+${analysis_type.input_options.int_quals}
 #end if
 #if str( $analysis_type.alignment_options.alignment_options_selector ) == "yes":
--N "${$analysis_type.alignment_options.N}"
+-N "${analysis_type.alignment_options.N}"
--L "${$analysis_type.alignment_options.L}"
+-L "${analysis_type.alignment_options.L}"
--i "${$analysis_type.alignment_options.i}"
+-i "${analysis_type.alignment_options.i}"
---n_ceil "${$analysis_type.alignment_options.n_ceil}"
+--n-ceil "${analysis_type.alignment_options.n_ceil}"
---dpad "${$analysis_type.alignment_options.dpad}"
+--dpad "${analysis_type.alignment_options.dpad}"
---gbar "${$analysis_type.alignment_options.gbar}"
+--gbar "${analysis_type.alignment_options.gbar}"
-${analysis_type.alignment_options.ignore-quals}
+${analysis_type.alignment_options.ignore_quals}
 ${analysis_type.alignment_options.nofw}
 ${analysis_type.alignment_options.norc}
 ${analysis_type.alignment_options.no_1mm_upfront}
 #if str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "end-to-end":
 --end-to-end
---score-min "${$analysis_type.alignment_options.align_mode.core-min}"
+--score-min "${analysis_type.alignment_options.align_mode.score_min_ete}"
 #elif str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local":
 --local
---score-min "${$analysis_type.alignment_options.align_mode.core-min}"
+--score-min "${analysis_type.alignment_options.align_mode.score_min_loc}"
 #end if
 #end if
 #if str( $analysis_type.scoring_options.scoring_options_selector ) == "yes":
---ma "${analysis_type.scoring_options.ma}"
+#if ( str( $analysis_type.alignment_options.alignment_options_selector ) == "yes" and str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local" ):
+--ma "${analysis_type.scoring_options.ma}"
+#end if
 --mp "${analysis_type.scoring_options.mp}"
 --np "${analysis_type.scoring_options.np}"
 --rdg "${analysis_type.scoring_options.rdg_read_open},${analysis_type.scoring_options.rdg_read_extend}"
 --rfg "${analysis_type.scoring_options.rfg_ref_open},${analysis_type.scoring_options.rfg_ref_extend}"
 #end if
 -D "${analysis_type.effort_options.D}"
 -R "${analysis_type.effort_options.R}"
 #end if
 #if str( $analysis_type.sam_options.sam_options_selector ) == "yes":
-${analysis_type.sam_options.no-unal}
+${analysis_type.sam_options.no_unal}
-${analysis_type.sam_options.omit-sec-seq}
+${analysis_type.sam_options.omit_sec_seq}
 #end if
 #if str( $analysis_type.other_options.other_options_selector ) == "yes":
-${analysis_type.other_options.reorder}
+${analysis_type.other_options.non_deterministic}
-${analysis_type.other_options.non-deterministic}
 --seed "${analysis_type.other_options.seed}"
 #end if
 #elif str( $analysis_type.analysis_type_selector ) == "cline":
 ${analysis_type.cline}
 #end if
 ## view/sort and output BAM file
 | samtools view -Su - | samtools sort -o - - > $output
 ## rename unaligned sequence files
 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r:
 #set left  = str($output_unaligned_reads_l).replace( '.dat', '.1.dat' )
 #set right = str($output_unaligned_reads_l).replace( '.dat', '.2.dat' )
 <option value="no" selected="True">No</option>
 <option value="yes">Yes</option>
 </param>
 <when value="yes">
 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins;  E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied).  A 19-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run.  This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
-<param name="X" type="integer" value="500" min="0" lable="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied).  A 61-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Deafult=500"/>
+<param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied).  A 61-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
-<param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid.  Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriatefor Illumina's Paired-end Sequencing Assay)">
+<param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid.  Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
 <option value="--fr" selected="True">--fr</option>
-<option value="--rf">--fr</option>
+<option value="--rf">--rf</option>
 <option value="--ff">--ff</option>
 </param>
 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
-<param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant.  See also: `Mates can overlap, contain or dovetail each other` in help section below; default=False"/>
+<param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
-<param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/>
+<param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
-<param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant.  See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/>
+<param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
 </when>
 <when value="no">
 <!-- do nothing -->
 </when>
 </conditional>
 <option value="no" selected="True">No</option>
 <option value="yes">Yes</option>
 </param>
 <when value="yes">
 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins;  E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied).  A 19-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run.  This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
-<param name="X" type="integer" value="500" min="0" lable="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied).  A 61-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Deafult=500"/>
+<param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied).  A 61-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
-<param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid.  Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriatefor Illumina's Paired-end Sequencing Assay)">
+<param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid.  Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
 <option value="--fr" selected="True">--fr</option>
-<option value="--rf">--fr</option>
+<option value="--rf">--rf</option>
 <option value="--ff">--ff</option>
 </param>
 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
-<param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant.  See also: `Mates can overlap, contain or dovetail each other` in help section below; default=False"/>
+<param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
-<param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/>
+<param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
-<param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant.  See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/>
+<param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
 </when>
 <when value="no">
 <!-- do nothing -->
 </when>
 </conditional>
 <param name="input_options_selector" type="select" label="Do you want to tweak input options?" help="See &quot;Input Options&quot; section of Help below for information">
 <option value="yes">Yes</option>
 <option value="no" selected="true">No</option>
 </param>
 <when value="yes">
-<param name="skip" type="integer" min="0" value="0" lable="Skip (i.e. do not align) the first that many reads or pairs in the input" help="-s/--skip; default=0"/>
+<param name="skip" type="integer" min="0" value="0" label="Skip (i.e. do not align) the first that many reads or pairs in the input" help="-s/--skip; default=0"/>
-<param name="qupto" type="integer" min="-1" value="-1" label="Align the first that many reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop" help="-u/--qupto; default=-1 (no limit)"/>
+<param name="qupto" type="integer" min="1" value="100000000" label="Align the first that many reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop" help="-u/--qupto; for default behavior (no limit) leave this value very large"/>
 <param name="trim5" type="integer" min="0" value="0" label="Trim that many bases from 5' (left) end of each read before alignment" help="-5/--trim5; default=0"/>
 <param name="trim3" type="integer" min="0" value="0" label="Trim that many bases from 3' (right) end of each read before alignment" help="-3/--trim3; default=0"/>
 <param name="qv_encoding" type="select" display="radio" label="Select quality score encoding" help="See help below for more details">
-<option value="--phred33">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option>
+<option value="--phred33" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option>
-<option value="--phred64" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option>
+<option value="--phred64">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option>
 </param>
-<param name="solexa-quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default=False"/>
+<param name="solexa_quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default=False"/>
-<param name="int-quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified" help="--int-quals; default=False"/>
+<param name="int_quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified" help="--int-quals; default=False"/>
 </when>
 <when value="no">
 <!-- do nothing -->
 </when>
 </conditional>
 <option value="yes">Yes</option>
 <option value="no" selected="true">No</option>
 </param>
 <when value="yes">
 <param name="N" type="integer" min="0" max="1" value="0" label="Set the number of mismatches to be allowed in a seed alignment during multiseed alignment (see `Multiseed alignment` section of help below)" help="-N; Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity; default=0"/>
-<param name="L" type="integer" min="0" value="20" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more senstive. Default: the `--sensitive` preset is used by default, which sets `-L` to 20 both in `--end-to-end` mode and in `--local` mode"/>
+<param name="L" type="integer" min="0" max="32" value="22" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more sensitive. Default=22"/>
-<param name="i" type="text" value="S,1,1.15" size="10" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. See also `Setting function options` below in help section. If the function returns a result less than 1, it is rounded up to 1. Default: the `--sensitive` preset is used by default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75` in `--local` mode"/>
+<param name="i" type="text" value="S,1,1.15" size="10" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. If the function returns a result less than 1, it is rounded up to 1. Default=`S,1,1.15`"/>
-<param name="n_ceil" type="text" value="`L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length.  See also: [setting function options]. Reads exceeding this ceiling are [filtered out]. Default=`L,0,0.15`"/>
+<param name="n_ceil" type="text" value="L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. Reads exceeding this ceiling are filtered out. Default=`L,0,0.15`"/>
-<param name="dpad" type="integer" min="0" value="15" lable="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/>
+<param name="dpad" type="integer" min="0" value="15" label="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/>
 <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/>
-<param name="ignore-quals" type="boolean" truevalue="--ignore-quals" falsevalue="" selected="False" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/>
+<param name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" selected="False" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/>
 <param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
 <param name="norc" type="boolean" truevalue="--norc" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
-<param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" selected="False" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help baelow)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the [multiseed heuristic].  Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments.  However, this can lead to unexpected alignments when the user also sets options governing the [multiseed heuristic], like `-L` and `-N`.  For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported.  This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the [multiseed heuristic], which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/>
+<param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" selected="False" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help below)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the multiseed heuristic.  Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments.  However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`.  For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported.  This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/>
 <conditional name="align_mode">
 <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end">
 <option value="end-to-end" selected="True">End to End (--end-to-end)</option>
 <option value="local">Local (--local)</option>
 </param>
 <when value="end-to-end">
-<param name="score-min" type="text" value="G,20,8" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length.  See also: [setting function options].  The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
+<param name="score_min_ete" type="text" value="L,-0.6,-0.6" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
 </when>
 <when value="local">
-<param name="score-min" type="text" value="L,-0.6,-0.6" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length.  See also: [setting function options].  The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
+<param name="score_min_loc" type="text" value="G,20,8" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
 </when>
 </conditional>
 </when>
 <when value="no">
 <!-- do nothing -->
 <option value="a">Set -a option</option>
 </param>
 <when value="no">
 <!-- do nothing -->
 </when>
-<when value="-k">
+<when value="k">
-<param name="k" type="integer" min="0" value="1" label="Searches for at most that many distinct, valid alignments for each read" help="-k; see detalied description of this option in the help section below. Note: Bowtie 2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow"/>
+<param name="k" type="integer" min="1" value="1" label="Searches for at most that many distinct, valid alignments for each read" help="-k; see detailed description of this option in the help section below. Note: Bowtie 2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow"/>
 </when>
-<when value="-a">
+<when value="a">
 <!-- do nothing here; set -a flag on the command line-->
 </when>
 </conditional>
 <conditional name="effort_options">
 <param name="effort_options_selector" type="select" label="Do you want to tweak effort options?" help="See &quot;Effort Options&quot; section of Help below for information">
 <option value="yes">Yes</option>
 <option value="no" selected="true">No</option>
 </param>
 <when value="yes">
-<param name="D" type="integer" value="15" min="0" label="Attemp that many consecutive seed extension attempts to `fail` before Bowtie 2 moves on, using the alignments found so far" help="-D; A seed extension `fails` if it does not yield a new best or a new second-best alignment.  This limit is automatically adjusted up when -k or -a are specified. Default=15"/>
+<param name="D" type="integer" value="15" min="0" label="Attempt that many consecutive seed extension attempts to `fail` before Bowtie 2 moves on, using the alignments found so far" help="-D; A seed extension `fails` if it does not yield a new best or a new second-best alignment.  This limit is automatically adjusted up when -k or -a are specified. Default=15"/>
 <param name="R" type="integer" value="2" min="0" label="Set the maximum number of times Bowtie 2 will `re-seed` reads with repetitive seeds" help="When `re-seeding`, Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments.  A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300.  Default=2"/>
 </when>
 <when value="no">
 <!-- do nothing -->
 </when>
 <param name="sam_options_selector" type="select" label="Do you want to tweak SAM/BAM Options?" help="See &quot;Output Options&quot; section of Help below for information">
 <option value="yes">Yes</option>
 <option value="no" selected="true">No</option>
 </param>
 <when value="yes">
-<param name="no-unal" type="boolean" truevalue="--no-unal" falsevalue="" label="Suppress SAM records for reads that failed to align" help="--no-unal; Default=False"/>
+<param name="no_unal" type="boolean" truevalue="--no-unal" falsevalue="" label="Suppress SAM records for reads that failed to align" help="--no-unal; Default=False"/>
-<param name="omit-sec-seq" type="boolean" truevalue="--omit-sec-seq" falsevalue="" label="Suppress SEQ and QUAL strings for secondary alignments" help="--omit-sec-seq; Default=False"/>
+<param name="omit_sec_seq" type="boolean" truevalue="--omit-sec-seq" falsevalue="" label="Suppress SEQ and QUAL strings for secondary alignments" help="--omit-sec-seq; Default=False"/>
 </when>
 <when value="no">
 <!-- do nothing -->
 </when>
 </conditional>
 <param name="other_options_selector" type="select" label="Do you want to tweak Other Options?" help="See &quot;Other Options&quot; section of Help below for information">
 <option value="yes">Yes</option>
 <option value="no" selected="true">No</option>
 </param>
 <when value="yes">
-<param name="reorder" type="boolean" truevalue="--reorder" falsevalue="" label="Guarantee that output SAM records are printed in an order corresponding to the order of the reads in the original input file" help="--reorder; Default=False"/>
 <param name="seed" type="integer" value="0" min="0" label="Use this number as the seed for pseudo-random number generator" help="--seed; Default=0"/>
-<param name="non-deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="--non-deterministic; see Help below for explanation of this option; default=False"/>
+<param name="non_deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="--non-deterministic; see Help below for explanation of this option; default=False"/>
 </when>
 <when value="no">
 <!-- do nothing -->
 </when>
 </conditional>
 <option type="from_param" name="library.input_1" param_attribute="ext" />
 </action>
 </actions>
 </data>
-<data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads in BAM format">
+<data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads (sorted BAM)">
 <actions>
 <conditional name="reference_genome.source">
 <when value="indexed">
 <action type="metadata" name="dbkey">
 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0">
 </action>
 </when>
 </conditional>
 </actions>
 </data>
 </outputs>
 <tests>
 <test>
 <!-- basic test on single paired default run -->
 Input qualities are ASCII chars equal to the Phred quality plus 33.  This is
 also called the "Phred+33" encoding, which is used by the very latest Illumina
 pipelines.
 --phred64
-Input qualities are ASCII chars equal to the [Phred quality] plus 64.  This is
+Input qualities are ASCII chars equal to the Phred quality plus 64.  This is
 also called the "Phred+64" encoding.
 --solexa-quals
 Convert input qualities from Solexa Phred quality (which can be negative) to
 Phred Phred quality (which can't).  This scheme was used in older Illumina GA
 Pipeline versions (prior to 1.3).  Default: off.
 --int-quals
 Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`....
-Integers are treated as being on the [Phred quality] scale unless
+Integers are treated as being on the Phred quality scale unless
 `--solexa-quals` is also specified. Default: off.
 ------
 **Presets in `--end-to-end` mode**::
 ------
 **Alignment options**::
 -N &lt;int&gt;
-Sets the number of mismatches to allowed in a seed alignment during [multiseed
+Sets the number of mismatches to allowed in a seed alignment during multiseed
-alignment].  Can be set to 0 or 1. Setting this higher makes alignment slower
+alignment.  Can be set to 0 or 1. Setting this higher makes alignment slower
 (often much slower) but increases sensitivity.  Default: 0.
 -L &lt;int&gt;
-Sets the length of the seed substrings to align during [multiseed alignment].
+Sets the length of the seed substrings to align during multiseed alignment.
-Smaller values make alignment slower but more senstive. Default: the
+Smaller values make alignment slower but more sensitive. Default: the
-`--sensitive` preset is used by default, which sets `-L` to 20 both in
+`--sensitive` preset is used by default, which sets `-L` to 22 in
-`--end-to-end` mode and in `--local` mode.
+`--end-to-end` mode and to 20 in `--local` mode.
 -i &lt;func&gt;
 Sets a function governing the interval between seed substrings to use during
-[multiseed alignment].  For instance, if the read has 30 characers, and seed
+multiseed alignment.  For instance, if the read has 30 characers, and seed
 length is 10, and the seed interval is 6, the seeds extracted will be:
 Read:      TAGCTACGCTCTACGCTATCATGCATAAAC
 Seed 1 fw: TAGCTACGCT
 Seed 1 rc: AGCGTAGCTA
 Since it's best to use longer intervals for longer reads, this parameter sets
 the interval as a function of the read length, rather than a single
 one-size-fits-all number.  For instance, specifying `-i S,1,2.5` sets the
 interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length.
-See also: [setting function options]. If the function returns a result less than
+If the function returns a result less than
 1, it is rounded up to 1. Default: the `--sensitive` preset is used by
 default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75`
 in `--local` mode.
 --n-ceil &lt;func&gt;
 Sets a function governing the maximum number of ambiguous characters (usually
 `N`s and/or `.`s) allowed in a read as a function of read length.  For instance,
 specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`,
-where x is the read length.  See also: [setting function options].  Reads
+where x is the read length.  Reads exceeding this ceiling are filtered out.
-exceeding this ceiling are [filtered out].  Default: `L,0,0.15`.
+Default: `L,0,0.15`.
 --dpad &lt;int&gt;
 "Pads" dynamic programming problems by `&lt;int&gt;` columns on either side to allow
 gaps.  Default: 15.
 paired-end configurations corresponding to fragments from the reverse-complement
 (Crick) strand.  Default: both strands enabled.
 --no-1mm-upfront
 By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch
-end-to-end alignment for the read *before* trying the [multiseed heuristic].  Such
+end-to-end alignment for the read *before* trying the multiseed heuristic.  Such
 alignments can be found very quickly, and many short read alignments have exact or
 near-exact end-to-end alignments.  However, this can lead to unexpected
-alignments when the user also sets options governing the [multiseed heuristic],
+alignments when the user also sets options governing the multiseed heuristic,
 like `-L` and `-N`.  For instance, if the user specifies `-N 0` and `-L` equal
 to the length of the read, the user will be surprised to find 1-mismatch alignments
 reported.  This option prevents Bowtie 2 from searching for 1-mismatch end-to-end
-alignments before using the [multiseed heuristic], which leads to the expected
+alignments before using the multiseed heuristic, which leads to the expected
 behavior when combined with options such as `-L` and `-N`.  This comes at the
 expense of speed.
 --end-to-end
 In this mode, Bowtie 2 requires that the entire read align from one end to the
 --score-min &lt;func&gt;
 Sets a function governing the minimum alignment score needed for an alignment to
 be considered "valid" (i.e. good enough to report).  This is a function of read
 length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f`
-to `f(x) = 0 + -0.6 * x`, where `x` is the read length.  See also: [setting
+to `f(x) = 0 + -0.6 * x`, where `x` is the read length.  The default in `--end-to-end` mode is `L,-0.6,-0.6` and
-function options].  The default in `--end-to-end` mode is `L,-0.6,-0.6` and
 the default in `--local` mode is `G,20,8`.
 -----
 **Reporting options**::
 (`--fr`/`--rf`/`--ff`, `-I`, `-X`).  This option disables that behavior.
 --dovetail
 If the mates "dovetail", that is if one mate alignment extends past the
 beginning of the other such that the wrong mate begins upstream, consider that
-to be concordant.  See also: [Mates can overlap, contain or dovetail each
+to be concordant.  Default: mates cannot dovetail in a concordant alignment.
-other].  Default: mates cannot dovetail in a concordant alignment.
 --no-contain
 If one mate alignment contains the other, consider that to be non-concordant.
-See also: [Mates can overlap, contain or dovetail each other].  Default: a mate
+Default: a mate can contain the other in a concordant alignment.
-can contain the other in a concordant alignment.
 --no-overlap
 If one mate alignment overlaps the other at all, consider that to be
-non-concordant.  See also: [Mates can overlap, contain or dovetail each other].
+non-concordant.  Default: mates can overlap in a concordant alignment.
-Default: mates can overlap in a concordant alignment.
 ------
 **SAM options**::
 value set to `&lt;text&gt;`.
 --rg &lt;text&gt;
 Add `&lt;text&gt;` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the
 `@RG` header line.  Note: in order for the `@RG` line to appear, `--rg-id`
-must also be specified.  This is because the `ID` tag is required by the [SAM
+must also be specified.  This is because the `ID` tag is required by the SAM
-Spec][SAM].  Specify `--rg` multiple times to set multiple fields.  See the
+Specification.  Specify `--rg` multiple times to set multiple fields.  See the
-[SAM Spec][SAM] for details about what fields are legal.
+SAM Specification for details about what fields are legal.
 --omit-sec-seq
 When printing secondary alignments, Bowtie 2 by default will write out the `SEQ`
 and `QUAL` strings.  Specifying this option causes Bowtie 2 to print an asterix
 in those fields instead.

Mercurial > repos > devteam > bowtie2

comparison bowtie2_wrapper.xml @ 3:ceb6467e276c draft