Mercurial > repos > devteam > bowtie2
diff bowtie2_wrapper.xml @ 3:ceb6467e276c draft
Uploaded
| author | devteam |
|---|---|
| date | Mon, 09 Mar 2015 11:58:43 -0400 |
| parents | c1ec08cb34f9 |
| children | 1fc845afa3ac |
line wrap: on
line diff
--- a/bowtie2_wrapper.xml Fri Dec 12 11:12:27 2014 -0500 +++ b/bowtie2_wrapper.xml Mon Mar 09 11:58:43 2015 -0400 @@ -1,4 +1,4 @@ -<tool id="bowtie2" name="Bowtie2" version="0.3"> +<tool id="bowtie2" name="Bowtie2" version="0.4"> <!-- Wrapper compatible with Bowtie version 2.2.4 --> <description>- map reads against reference genome</description> <version_command>bowtie2 --version</version_command> @@ -31,13 +31,13 @@ ## Fastq inputs #if str( $library.type ) == "single": - -U "${input_1}" + -U "${library.input_1}" #if str( $library.unaligned_file ) == "true": --un $output_unaligned_reads_l #end if #elif str( $library.type ) == "paired": - -1 "${input_1}" - -2 "${input_2}" + -1 "${library.input_1}" + -2 "${library.input_2}" #if str( $library.paired_options.paired_options_selector ) == "yes": -I "${library.paired_options.I}" -X "${library.paired_options.X}" @@ -88,32 +88,34 @@ --trim5 "${analysis_type.input_options.trim5}" --trim3 "${analysis_type.input_options.trim3}" ${analysis_type.input_options.qv_encoding} - ${analysis_type.input_options.solexa-quals} - ${analysis_type.input_options.int-quals} + ${analysis_type.input_options.solexa_quals} + ${analysis_type.input_options.int_quals} #end if #if str( $analysis_type.alignment_options.alignment_options_selector ) == "yes": - -N "${$analysis_type.alignment_options.N}" - -L "${$analysis_type.alignment_options.L}" - -i "${$analysis_type.alignment_options.i}" - --n_ceil "${$analysis_type.alignment_options.n_ceil}" - --dpad "${$analysis_type.alignment_options.dpad}" - --gbar "${$analysis_type.alignment_options.gbar}" - ${analysis_type.alignment_options.ignore-quals} + -N "${analysis_type.alignment_options.N}" + -L "${analysis_type.alignment_options.L}" + -i "${analysis_type.alignment_options.i}" + --n-ceil "${analysis_type.alignment_options.n_ceil}" + --dpad "${analysis_type.alignment_options.dpad}" + --gbar "${analysis_type.alignment_options.gbar}" + ${analysis_type.alignment_options.ignore_quals} ${analysis_type.alignment_options.nofw} ${analysis_type.alignment_options.norc} ${analysis_type.alignment_options.no_1mm_upfront} #if str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "end-to-end": --end-to-end - --score-min "${$analysis_type.alignment_options.align_mode.core-min}" + --score-min "${analysis_type.alignment_options.align_mode.score_min_ete}" #elif str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local": --local - --score-min "${$analysis_type.alignment_options.align_mode.core-min}" + --score-min "${analysis_type.alignment_options.align_mode.score_min_loc}" #end if #end if #if str( $analysis_type.scoring_options.scoring_options_selector ) == "yes": - --ma "${analysis_type.scoring_options.ma}" + #if ( str( $analysis_type.alignment_options.alignment_options_selector ) == "yes" and str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local" ): + --ma "${analysis_type.scoring_options.ma}" + #end if --mp "${analysis_type.scoring_options.mp}" --np "${analysis_type.scoring_options.np}" --rdg "${analysis_type.scoring_options.rdg_read_open},${analysis_type.scoring_options.rdg_read_extend}" @@ -132,13 +134,12 @@ #end if #if str( $analysis_type.sam_options.sam_options_selector ) == "yes": - ${analysis_type.sam_options.no-unal} - ${analysis_type.sam_options.omit-sec-seq} + ${analysis_type.sam_options.no_unal} + ${analysis_type.sam_options.omit_sec_seq} #end if #if str( $analysis_type.other_options.other_options_selector ) == "yes": - ${analysis_type.other_options.reorder} - ${analysis_type.other_options.non-deterministic} + ${analysis_type.other_options.non_deterministic} --seed "${analysis_type.other_options.seed}" #end if @@ -148,7 +149,7 @@ ## view/sort and output BAM file | samtools view -Su - | samtools sort -o - - > $output - + ## rename unaligned sequence files #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r: #set left = str($output_unaligned_reads_l).replace( '.dat', '.1.dat' ) @@ -189,17 +190,17 @@ </param> <when value="yes"> <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/> - <param name="X" type="integer" value="500" min="0" lable="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Deafult=500"/> - <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriatefor Illumina's Paired-end Sequencing Assay)"> + <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/> + <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)"> <option value="--fr" selected="True">--fr</option> - <option value="--rf">--fr</option> + <option value="--rf">--rf</option> <option value="--ff">--ff</option> </param> <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/> <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/> - <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also: `Mates can overlap, contain or dovetail each other` in help section below; default=False"/> - <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/> - <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/> + <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/> + <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/> + <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/> </when> <when value="no"> <!-- do nothing --> @@ -216,17 +217,17 @@ </param> <when value="yes"> <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/> - <param name="X" type="integer" value="500" min="0" lable="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Deafult=500"/> - <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriatefor Illumina's Paired-end Sequencing Assay)"> + <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/> + <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)"> <option value="--fr" selected="True">--fr</option> - <option value="--rf">--fr</option> + <option value="--rf">--rf</option> <option value="--ff">--ff</option> </param> <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/> <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/> - <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also: `Mates can overlap, contain or dovetail each other` in help section below; default=False"/> - <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/> - <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/> + <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/> + <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/> + <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/> </when> <when value="no"> <!-- do nothing --> @@ -294,16 +295,16 @@ <option value="no" selected="true">No</option> </param> <when value="yes"> - <param name="skip" type="integer" min="0" value="0" lable="Skip (i.e. do not align) the first that many reads or pairs in the input" help="-s/--skip; default=0"/> - <param name="qupto" type="integer" min="-1" value="-1" label="Align the first that many reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop" help="-u/--qupto; default=-1 (no limit)"/> + <param name="skip" type="integer" min="0" value="0" label="Skip (i.e. do not align) the first that many reads or pairs in the input" help="-s/--skip; default=0"/> + <param name="qupto" type="integer" min="1" value="100000000" label="Align the first that many reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop" help="-u/--qupto; for default behavior (no limit) leave this value very large"/> <param name="trim5" type="integer" min="0" value="0" label="Trim that many bases from 5' (left) end of each read before alignment" help="-5/--trim5; default=0"/> <param name="trim3" type="integer" min="0" value="0" label="Trim that many bases from 3' (right) end of each read before alignment" help="-3/--trim3; default=0"/> <param name="qv_encoding" type="select" display="radio" label="Select quality score encoding" help="See help below for more details"> - <option value="--phred33">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option> - <option value="--phred64" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option> + <option value="--phred33" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option> + <option value="--phred64">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option> </param> - <param name="solexa-quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default=False"/> - <param name="int-quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified" help="--int-quals; default=False"/> + <param name="solexa_quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default=False"/> + <param name="int_quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified" help="--int-quals; default=False"/> </when> <when value="no"> <!-- do nothing --> @@ -316,25 +317,25 @@ </param> <when value="yes"> <param name="N" type="integer" min="0" max="1" value="0" label="Set the number of mismatches to be allowed in a seed alignment during multiseed alignment (see `Multiseed alignment` section of help below)" help="-N; Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity; default=0"/> - <param name="L" type="integer" min="0" value="20" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more senstive. Default: the `--sensitive` preset is used by default, which sets `-L` to 20 both in `--end-to-end` mode and in `--local` mode"/> - <param name="i" type="text" value="S,1,1.15" size="10" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. See also `Setting function options` below in help section. If the function returns a result less than 1, it is rounded up to 1. Default: the `--sensitive` preset is used by default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75` in `--local` mode"/> - <param name="n_ceil" type="text" value="`L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. See also: [setting function options]. Reads exceeding this ceiling are [filtered out]. Default=`L,0,0.15`"/> - <param name="dpad" type="integer" min="0" value="15" lable="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/> + <param name="L" type="integer" min="0" max="32" value="22" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more sensitive. Default=22"/> + <param name="i" type="text" value="S,1,1.15" size="10" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. If the function returns a result less than 1, it is rounded up to 1. Default=`S,1,1.15`"/> + <param name="n_ceil" type="text" value="L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. Reads exceeding this ceiling are filtered out. Default=`L,0,0.15`"/> + <param name="dpad" type="integer" min="0" value="15" label="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/> <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/> - <param name="ignore-quals" type="boolean" truevalue="--ignore-quals" falsevalue="" selected="False" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/> + <param name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" selected="False" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/> <param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/> <param name="norc" type="boolean" truevalue="--norc" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/> - <param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" selected="False" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help baelow)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the [multiseed heuristic]. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the [multiseed heuristic], like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the [multiseed heuristic], which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/> + <param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" selected="False" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help below)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the multiseed heuristic. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/> <conditional name="align_mode"> <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end"> <option value="end-to-end" selected="True">End to End (--end-to-end)</option> <option value="local">Local (--local)</option> </param> <when value="end-to-end"> - <param name="score-min" type="text" value="G,20,8" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/> + <param name="score_min_ete" type="text" value="L,-0.6,-0.6" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/> </when> <when value="local"> - <param name="score-min" type="text" value="L,-0.6,-0.6" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/> + <param name="score_min_loc" type="text" value="G,20,8" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/> </when> </conditional> </when> @@ -369,10 +370,10 @@ <when value="no"> <!-- do nothing --> </when> - <when value="-k"> - <param name="k" type="integer" min="0" value="1" label="Searches for at most that many distinct, valid alignments for each read" help="-k; see detalied description of this option in the help section below. Note: Bowtie 2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow"/> + <when value="k"> + <param name="k" type="integer" min="1" value="1" label="Searches for at most that many distinct, valid alignments for each read" help="-k; see detailed description of this option in the help section below. Note: Bowtie 2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow"/> </when> - <when value="-a"> + <when value="a"> <!-- do nothing here; set -a flag on the command line--> </when> </conditional> @@ -382,7 +383,7 @@ <option value="no" selected="true">No</option> </param> <when value="yes"> - <param name="D" type="integer" value="15" min="0" label="Attemp that many consecutive seed extension attempts to `fail` before Bowtie 2 moves on, using the alignments found so far" help="-D; A seed extension `fails` if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default=15"/> + <param name="D" type="integer" value="15" min="0" label="Attempt that many consecutive seed extension attempts to `fail` before Bowtie 2 moves on, using the alignments found so far" help="-D; A seed extension `fails` if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default=15"/> <param name="R" type="integer" value="2" min="0" label="Set the maximum number of times Bowtie 2 will `re-seed` reads with repetitive seeds" help="When `re-seeding`, Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default=2"/> </when> <when value="no"> @@ -396,8 +397,8 @@ <option value="no" selected="true">No</option> </param> <when value="yes"> - <param name="no-unal" type="boolean" truevalue="--no-unal" falsevalue="" label="Suppress SAM records for reads that failed to align" help="--no-unal; Default=False"/> - <param name="omit-sec-seq" type="boolean" truevalue="--omit-sec-seq" falsevalue="" label="Suppress SEQ and QUAL strings for secondary alignments" help="--omit-sec-seq; Default=False"/> + <param name="no_unal" type="boolean" truevalue="--no-unal" falsevalue="" label="Suppress SAM records for reads that failed to align" help="--no-unal; Default=False"/> + <param name="omit_sec_seq" type="boolean" truevalue="--omit-sec-seq" falsevalue="" label="Suppress SEQ and QUAL strings for secondary alignments" help="--omit-sec-seq; Default=False"/> </when> <when value="no"> <!-- do nothing --> @@ -409,9 +410,8 @@ <option value="no" selected="true">No</option> </param> <when value="yes"> - <param name="reorder" type="boolean" truevalue="--reorder" falsevalue="" label="Guarantee that output SAM records are printed in an order corresponding to the order of the reads in the original input file" help="--reorder; Default=False"/> <param name="seed" type="integer" value="0" min="0" label="Use this number as the seed for pseudo-random number generator" help="--seed; Default=0"/> - <param name="non-deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="--non-deterministic; see Help below for explanation of this option; default=False"/> + <param name="non_deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="--non-deterministic; see Help below for explanation of this option; default=False"/> </when> <when value="no"> <!-- do nothing --> @@ -442,7 +442,7 @@ </actions> </data> - <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads in BAM format"> + <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads (sorted BAM)"> <actions> <conditional name="reference_genome.source"> <when value="indexed"> @@ -461,6 +461,7 @@ </conditional> </actions> </data> + </outputs> <tests> @@ -541,7 +542,7 @@ pipelines. --phred64 - Input qualities are ASCII chars equal to the [Phred quality] plus 64. This is + Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding. --solexa-quals @@ -551,7 +552,7 @@ --int-quals Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`.... - Integers are treated as being on the [Phred quality] scale unless + Integers are treated as being on the Phred quality scale unless `--solexa-quals` is also specified. Default: off. ------ @@ -591,19 +592,19 @@ **Alignment options**:: -N <int> - Sets the number of mismatches to allowed in a seed alignment during [multiseed - alignment]. Can be set to 0 or 1. Setting this higher makes alignment slower + Sets the number of mismatches to allowed in a seed alignment during multiseed + alignment. Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity. Default: 0. -L <int> - Sets the length of the seed substrings to align during [multiseed alignment]. - Smaller values make alignment slower but more senstive. Default: the - `--sensitive` preset is used by default, which sets `-L` to 20 both in - `--end-to-end` mode and in `--local` mode. + Sets the length of the seed substrings to align during multiseed alignment. + Smaller values make alignment slower but more sensitive. Default: the + `--sensitive` preset is used by default, which sets `-L` to 22 in + `--end-to-end` mode and to 20 in `--local` mode. -i <func> Sets a function governing the interval between seed substrings to use during - [multiseed alignment]. For instance, if the read has 30 characers, and seed + multiseed alignment. For instance, if the read has 30 characers, and seed length is 10, and the seed interval is 6, the seeds extracted will be: Read: TAGCTACGCTCTACGCTATCATGCATAAAC @@ -620,7 +621,7 @@ the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. - See also: [setting function options]. If the function returns a result less than + If the function returns a result less than 1, it is rounded up to 1. Default: the `--sensitive` preset is used by default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75` in `--local` mode. @@ -629,8 +630,8 @@ Sets a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length. For instance, specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, - where x is the read length. See also: [setting function options]. Reads - exceeding this ceiling are [filtered out]. Default: `L,0,0.15`. + where x is the read length. Reads exceeding this ceiling are filtered out. + Default: `L,0,0.15`. --dpad <int> "Pads" dynamic programming problems by `<int>` columns on either side to allow @@ -658,14 +659,14 @@ --no-1mm-upfront By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch - end-to-end alignment for the read *before* trying the [multiseed heuristic]. Such + end-to-end alignment for the read *before* trying the multiseed heuristic. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected - alignments when the user also sets options governing the [multiseed heuristic], + alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end - alignments before using the [multiseed heuristic], which leads to the expected + alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed. @@ -721,8 +722,7 @@ Sets a function governing the minimum alignment score needed for an alignment to be considered "valid" (i.e. good enough to report). This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` - to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting - function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and + to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`. ----- @@ -840,18 +840,15 @@ --dovetail If the mates "dovetail", that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that - to be concordant. See also: [Mates can overlap, contain or dovetail each - other]. Default: mates cannot dovetail in a concordant alignment. + to be concordant. Default: mates cannot dovetail in a concordant alignment. --no-contain If one mate alignment contains the other, consider that to be non-concordant. - See also: [Mates can overlap, contain or dovetail each other]. Default: a mate - can contain the other in a concordant alignment. + Default: a mate can contain the other in a concordant alignment. --no-overlap If one mate alignment overlaps the other at all, consider that to be - non-concordant. See also: [Mates can overlap, contain or dovetail each other]. - Default: mates can overlap in a concordant alignment. + non-concordant. Default: mates can overlap in a concordant alignment. ------ @@ -866,9 +863,9 @@ --rg <text> Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the `@RG` header line. Note: in order for the `@RG` line to appear, `--rg-id` - must also be specified. This is because the `ID` tag is required by the [SAM - Spec][SAM]. Specify `--rg` multiple times to set multiple fields. See the - [SAM Spec][SAM] for details about what fields are legal. + must also be specified. This is because the `ID` tag is required by the SAM + Specification. Specify `--rg` multiple times to set multiple fields. See the + SAM Specification for details about what fields are legal. --omit-sec-seq When printing secondary alignments, Bowtie 2 by default will write out the `SEQ`