Mercurial > repos > devteam > count_covariates
changeset 0:14e304b70425 draft default tip
Imported from capsule None
| author | devteam |
|---|---|
| date | Tue, 01 Apr 2014 10:51:01 -0400 |
| parents | |
| children | |
| files | count_covariates.xml gatk_macros.xml gatk_wrapper.py test-data/1.bam test-data/a.tab test-data/gatk/fake_phiX_variant_locations.bed test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains test-data/gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam test-data/phiX.fasta tool-data/gatk_sorted_picard_index.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml |
| diffstat | 13 files changed, 1121 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/count_covariates.xml Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,292 @@ +<tool id="gatk_count_covariates" name="Count Covariates" version="0.0.5"> + <description>on BAM files</description> + <requirements> + <requirement type="package" version="1.4">gatk</requirement> + <requirement type="package" version="0.1.18">samtools</requirement> + </requirements> + <macros> + <import>gatk_macros.xml</import> + </macros> + <command interpreter="python">gatk_wrapper.py + --max_jvm_heap_fraction "1" + --stdout "${output_log}" + -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input" + #if str( $reference_source.input_bam.metadata.bam_index ) != "None": + -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index + #end if + -p 'java + -jar "\$JAVA_JAR_PATH/GenomeAnalysisTK.jar" + -T "CountCovariates" + --num_threads \${GALAXY_SLOTS:-4} + -et "NO_ET" ##ET no phone home + ##-log "${output_log}" ##don't use this to log to file, instead directly capture stdout + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + --recal_file "${output_recal}" + ${standard_covs} + #if str( $covariates ) != "None": + #for $cov in str( $covariates ).split( ',' ): + -cov "${cov}" + #end for + #end if + ' + + #set $snp_dataset_provided = False + #set $rod_binding_names = dict() + #for $rod_binding in $rod_bind: + #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom': + #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name + #else + #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector + #end if + #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'dbsnp': + #set $snp_dataset_provided = True + #end if + #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1 + -d "--knownSites:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}" + #end for + + #include source=$standard_gatk_options# + + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + #if $analysis_param_type.default_read_group_type.default_read_group_type_selector == "set": + --default_read_group "${analysis_param_type.default_read_group_type.default_read_group}" + #end if + #if str( $analysis_param_type.default_platform ) != "default": + --default_platform "${analysis_param_type.default_platform}" + #end if + #if str( $analysis_param_type.force_read_group_type.force_read_group_type_selector ) == "set": + --force_read_group "${analysis_param_type.force_read_group_type.force_read_group}" + #end if + #if str( $analysis_param_type.force_platform ) != "default": + --force_platform "${analysis_param_type.force_platform}" + #end if + ${analysis_param_type.exception_if_no_tile} + #if str( $analysis_param_type.solid_options_type.solid_options_type_selector ) == "set": + #if str( $analysis_param_type.solid_options_type.solid_recal_mode ) != "default": + --solid_recal_mode "${analysis_param_type.solid_options_type.solid_recal_mode}" + #end if + #if str( $analysis_param_type.solid_options_type.solid_nocall_strategy ) != "default": + --solid_nocall_strategy "${analysis_param_type.solid_options_type.solid_nocall_strategy}" + #end if + #end if + --window_size_nqs "${analysis_param_type.window_size_nqs}" + --homopolymer_nback "${analysis_param_type.homopolymer_nback}" + ' + #end if + #if not $snp_dataset_provided: + -p '--run_without_dbsnp_potentially_ruining_quality' + #end if + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;" > + <options from_data_table="gatk_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options> + <filter type="data_meta" key="dbkey" ref="input_bam" /> + </options> + </param> + </when> + </conditional> + <param name="standard_covs" type="boolean" truevalue="--standard_covs" falsevalue="" label="Use the standard set of covariates in addition to the ones selected" help="-standard,--standard_covs" /> + <param name="covariates" type="select" multiple="True" display="checkboxes" label="Covariates to be used in the recalibration" help="-cov,--covariate &lt;covariate&gt;" > + <!-- might we want to load the available covariates from an external configuration file, since additional ones can be added to local installs? --> + <option value="ReadGroupCovariate" /> + <option value="QualityScoreCovariate" /> + <option value="CycleCovariate" /> + <option value="DinucCovariate" /> + <!-- covariates below were pulled from list option --> + <option value="HomopolymerCovariate" /> + <option value="GCContentCovariate" /> + <option value="MappingQualityCovariate" /> + <option value="MinimumNQSCovariate" /> + <option value="PositionCovariate" /> + <option value="PrimerRoundCovariate" /> + <option value="TileCovariate" /> + </param> + + <repeat name="rod_bind" title="Binding for reference-ordered data" help="-knownSites,--knownSites &lt;knownSites&gt;"> + <conditional name="rod_bind_type"> + <param name="rod_bind_type_selector" type="select" label="Binding Type"> + <option value="dbsnp" selected="True">dbSNP</option> + <option value="snps">SNPs</option> + <option value="indels">INDELs</option> + <option value="mask">Mask</option> + <option value="custom">Custom</option> + </param> + <when value="dbsnp"> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="ROD file" /> + </when> + <when value="snps"> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="ROD file" /> + </when> + <when value="indels"> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="ROD file" /> + </when> + <when value="mask"> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="ROD file" /> + </when> + <when value="custom"> + <param name="custom_rod_name" type="text" value="Unknown" label="ROD Name"/> + <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="ROD file" /> + </when> + </conditional> + </repeat> + + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + <conditional name="default_read_group_type"> + <param name="default_read_group_type_selector" type="select" label="Set default Read Group" help="--default_read_group"> + <option value="default" selected="True">Don't Set</option> + <option value="set">Set</option> + </param> + <when value="default"> + <!-- do nothing here --> + </when> + <when value="set"> + <param name="default_read_group" type="text" value="Unknown" label="If a read has no read group then default to the provided String"/> + </when> + </conditional> + <param name="default_platform" type="select" label="Set default Platform" help="--default_platform"> + <option value="default" selected="True">Don't Set</option> + <option value="illumina">illumina</option> + <option value="454">454</option> + <option value="solid">solid</option> + </param> + <conditional name="force_read_group_type"> + <param name="force_read_group_type_selector" type="select" label="Force Read Group" help="--force_read_group"> + <option value="default" selected="True">Don't Force</option> + <option value="set">Force</option> + </param> + <when value="default"> + <!-- do nothing here --> + </when> + <when value="set"> + <param name="force_read_group" type="text" value="Unknown" label="If provided, the read group ID of EVERY read will be forced to be the provided String."/> + </when> + </conditional> + <param name="force_platform" type="select" label="Force Platform" help="--force_platform"> + <option value="default" selected="True">Don't Force</option> + <option value="illumina">illumina</option> + <option value="454">454</option> + <option value="solid">solid</option> + </param> + <param name="exception_if_no_tile" type="boolean" checked="False" truevalue="--exception_if_no_tile" falsevalue="" label="Throw an exception when no tile can be found" help="--exception_if_no_tile"/> + <conditional name="solid_options_type"> + <param name="solid_options_type_selector" type="select" label="Set SOLiD specific options"> + <option value="default" selected="True">Don't Set</option> + <option value="set">Set</option> + </param> + <when value="default"> + <!-- do nothing here --> + </when> + <when value="set"> + <param name="solid_recal_mode" type="select" label="How should we recalibrate solid bases in which the reference was inserted" help="-sMode,--solid_recal_mode &lt;solid_recal_mode&gt;"> + <option value="default" selected="True">Don't set</option> + <option value="DO_NOTHING">DO_NOTHING</option> + <option value="SET_Q_ZERO">SET_Q_ZERO</option> + <option value="SET_Q_ZERO_BASE_N">SET_Q_ZERO_BASE_N</option> + <option value="REMOVE_REF_BIAS">REMOVE_REF_BIAS</option> + </param> + <param name="solid_nocall_strategy" type="select" label="Behavior of the recalibrator when it encounters no calls" help="-solid_nocall_strategy,--solid_nocall_strategy &lt;solid_nocall_strategy&gt;"> + <option value="default" selected="True">Don't set</option> + <option value="THROW_EXCEPTION">THROW_EXCEPTION</option> + <option value="LEAVE_READ_UNRECALIBRATED">LEAVE_READ_UNRECALIBRATED</option> + <option value="PURGE_READ">PURGE_READ</option> + </param> + </when> + </conditional> + <param name="window_size_nqs" type="integer" value="5" label="Window size used by MinimumNQSCovariate" help="window_size_nqs"/> + <param name="homopolymer_nback" type="integer" value="7" label="number of previous bases to look at in HomopolymerCovariate" help="-nback,--homopolymer_nback &lt;homopolymer_nback&gt;" /> + </expand> + </inputs> + <outputs> + <data format="csv" name="output_recal" label="${tool.name} on ${on_string} (Covariate File)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" /> + <param name="rod_bind_type_selector" value="dbsnp" /> + <param name="input_rod" value="gatk/fake_phiX_variant_locations.bed" ftype="bed" /> + <param name="standard_covs" value="True" /> + <param name="covariates" value="ReadGroupCovariate,HomopolymerCovariate,MinimumNQSCovariate,PositionCovariate" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_recal" file="gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv" /> + <output name="output_log" file="gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +.. class:: warningmark + +"This calculation is critically dependent on being able to skip over known variant sites. Please provide a dbSNP ROD or a VCF file containing known sites of genetic variation." +However, if you do not provide this file, the '--run_without_dbsnp_potentially_ruining_quality' flag will be automatically used, and the command will be allowed to run. + +**What it does** + +This walker is designed to work as the first pass in a two-pass processing step. It does a by-locus traversal operating only at sites that are not in dbSNP. We assume that all reference mismatches we see are therefore errors and indicative of poor base quality. This walker generates tables based on various user-specified covariates (such as read group, reported quality score, cycle, and dinucleotide) Since there is a large amount of data one can then calculate an empirical probability of error given the particular covariates seen at this site, where p(error) = num mismatches / num observations The output file is a CSV list of (the several covariate values, num observations, num mismatches, empirical quality score) The first non-comment line of the output file gives the name of the covariates that were used for this calculation. Note: ReadGroupCovariate and QualityScoreCovariate are required covariates and will be added for the user regardless of whether or not they were specified Note: This walker is designed to be used in conjunction with TableRecalibrationWalker. + +For more information on base quality score recalibration using the GATK, see this `tool specific page <http://www.broadinstitute.org/gsa/wiki/index.php/Base_quality_score_recalibration>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gsa/wiki/index.php/Best_Practice_Variant_Detection_with_the_GATK_v3>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gsa/wiki/index.php/Frequently_Asked_Questions>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: CountCovariates accepts an aligned BAM input file. + + +**Outputs** + +The output is in CSV format. + + +Go `here <http://www.broadinstitute.org/gsa/wiki/index.php/Input_files_for_the_GATK>`_ for details on GATK file formats. + +------- + +**Settings**:: + + + default_read_group If a read has no read group then default to the provided String. + default_platform If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid. + force_read_group If provided, the read group ID of EVERY read will be forced to be the provided String. This is useful to collapse all data into a single read group. + force_platform If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid. + window_size_nqs The window size used by MinimumNQSCovariate for its calculation + homopolymer_nback The number of previous bases to look at in HomopolymerCovariate + exception_if_no_tile If provided, TileCovariate will throw an exception when no tile can be found. The default behavior is to use tile = -1 + solid_recal_mode How should we recalibrate solid bases in whichthe reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS (DO_NOTHING|SET_Q_ZERO|SET_Q_ZERO_BASE_N|REMOVE_REF_BIAS) + solid_nocall_strategy Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ (THROW_EXCEPTION|LEAVE_READ_UNRECALIBRATED|PURGE_READ) + recal_file Filename for the input covariates table recalibration .csv file + out The output CSV file + recal_file Filename for the outputted covariates table recalibration file + standard_covs Use the standard set of covariates in addition to the ones listed using the -cov argument + run_without_dbsnp_potentially_ruining_quality If specified, allows the recalibrator to be used without a dbsnp rod. Very unsafe and for expert users only. + +@CITATION_SECTION@ + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk_macros.xml Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,305 @@ +<macros> + <template name="standard_gatk_options"> + ##start standard gatk options + #if $gatk_param_type.gatk_param_type_selector == "advanced": + #for $pedigree in $gatk_param_type.pedigree: + -p '--pedigree "${pedigree.pedigree_file}"' + #end for + #for $pedigree_string in $gatk_param_type.pedigree_string_repeat: + -p '--pedigreeString "${pedigree_string.pedigree_string}"' + #end for + -p '--pedigreeValidationType "${gatk_param_type.pedigree_validation_type}"' + #for $read_filter in $gatk_param_type.read_filter: + -p '--read_filter "${read_filter.read_filter_type.read_filter_type_selector}" + ###raise Exception( str( dir( $read_filter ) ) ) + #for $name, $param in $read_filter.read_filter_type.iteritems(): + #if $name not in [ "__current_case__", "read_filter_type_selector" ]: + #if hasattr( $param.input, 'truevalue' ): + ${param} + #else: + --${name} "${param}" + #end if + #end if + #end for + ' + #end for + #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_interval_repeat ): + -d "--intervals" "${input_intervals.input_intervals}" "${input_intervals.input_intervals.ext}" "input_intervals_${interval_count}" + #end for + + #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_exclude_interval_repeat ): + -d "--excludeIntervals" "${input_intervals.input_exclude_intervals}" "${input_intervals.input_exclude_intervals.ext}" "input_exlude_intervals_${interval_count}" + #end for + + -p '--interval_set_rule "${gatk_param_type.interval_set_rule}"' + + -p '--downsampling_type "${gatk_param_type.downsampling_type.downsampling_type_selector}"' + #if str( $gatk_param_type.downsampling_type.downsampling_type_selector ) != "NONE": + -p '--${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_type_selector} "${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_value}"' + #end if + -p ' + --baq "${gatk_param_type.baq}" + --baqGapOpenPenalty "${gatk_param_type.baq_gap_open_penalty}" + ${gatk_param_type.use_original_qualities} + --defaultBaseQualities "${gatk_param_type.default_base_qualities}" + --validation_strictness "${gatk_param_type.validation_strictness}" + --interval_merging "${gatk_param_type.interval_merging}" + ${gatk_param_type.disable_experimental_low_memory_sharding} + ${gatk_param_type.non_deterministic_random_seed} + ' + #for $rg_black_list_count, $rg_black_list in enumerate( $gatk_param_type.read_group_black_list_repeat ): + #if $rg_black_list.read_group_black_list_type.read_group_black_list_type_selector == "file": + -d "--read_group_black_list" "${rg_black_list.read_group_black_list_type.read_group_black_list}" "txt" "input_read_group_black_list_${rg_black_list_count}" + #else + -p '--read_group_black_list "${rg_black_list.read_group_black_list_type.read_group_black_list}"' + #end if + #end for + #end if + + #if str( $reference_source.reference_source_selector ) == "history": + -d "-R" "${reference_source.ref_file}" "${reference_source.ref_file.ext}" "gatk_input" + #end if + ##end standard gatk options + </template> + <xml name="gatk_param_type_conditional"> + <conditional name="gatk_param_type"> + <param name="gatk_param_type_selector" type="select" label="Basic or Advanced GATK options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <repeat name="pedigree" title="Pedigree file" help="-ped,--pedigree &lt;pedigree&gt;"> + <param name="pedigree_file" type="data" format="txt" label="Pedigree files for samples"/> + </repeat> + <repeat name="pedigree_string_repeat" title="Pedigree string" help="-pedString,--pedigreeString &lt;pedigreeString&gt;"> + <param name="pedigree_string" type="text" value="" label="Pedigree string for samples"/> + </repeat> + <param name="pedigree_validation_type" type="select" label="How strict should we be in validating the pedigree information" help="-pedValidationType,--pedigreeValidationType &lt;pedigreeValidationType&gt;"> + <option value="STRICT" selected="True">STRICT</option> + <option value="SILENT">SILENT</option> + </param> + <repeat name="read_filter" title="Read Filter" help="-rf,--read_filter &lt;read_filter&gt;"> + <conditional name="read_filter_type"> + <param name="read_filter_type_selector" type="select" label="Read Filter Type"> + <option value="BadCigar">BadCigar</option> + <option value="BadMate">BadMate</option> + <option value="DuplicateRead">DuplicateRead</option> + <option value="FailsVendorQualityCheck">FailsVendorQualityCheck</option> + <option value="MalformedRead">MalformedRead</option> + <option value="MappingQuality">MappingQuality</option> + <option value="MappingQualityUnavailable">MappingQualityUnavailable</option> + <option value="MappingQualityZero">MappingQualityZero</option> + <option value="MateSameStrand">MateSameStrand</option> + <option value="MaxInsertSize">MaxInsertSize</option> + <option value="MaxReadLength" selected="True">MaxReadLength</option> + <option value="MissingReadGroup">MissingReadGroup</option> + <option value="NoOriginalQualityScores">NoOriginalQualityScores</option> + <option value="NotPrimaryAlignment">NotPrimaryAlignment</option> + <option value="Platform454">Platform454</option> + <option value="Platform">Platform</option> + <option value="PlatformUnit">PlatformUnit</option> + <option value="ReadGroupBlackList">ReadGroupBlackList</option> + <option value="ReadName">ReadName</option> + <option value="ReadStrand">ReadStrand</option> + <option value="ReassignMappingQuality">ReassignMappingQuality</option> + <option value="Sample">Sample</option> + <option value="SingleReadGroup">SingleReadGroup</option> + <option value="UnmappedRead">UnmappedRead</option> + </param> + <when value="BadCigar"> + <!-- no extra options --> + </when> + <when value="BadMate"> + <!-- no extra options --> + </when> + <when value="DuplicateRead"> + <!-- no extra options --> + </when> + <when value="FailsVendorQualityCheck"> + <!-- no extra options --> + </when> + <when value="MalformedRead"> + <!-- no extra options --> + </when> + <when value="MappingQuality"> + <param name="min_mapping_quality_score" type="integer" value="10" label="Minimum read mapping quality required to consider a read for calling"/> + </when> + <when value="MappingQualityUnavailable"> + <!-- no extra options --> + </when> + <when value="MappingQualityZero"> + <!-- no extra options --> + </when> + <when value="MateSameStrand"> + <!-- no extra options --> + </when> + <when value="MaxInsertSize"> + <param name="maxInsertSize" type="integer" value="1000000" label="Discard reads with insert size greater than the specified value"/> + </when> + <when value="MaxReadLength"> + <param name="maxReadLength" type="integer" value="76" label="Max Read Length"/> + </when> + <when value="MissingReadGroup"> + <!-- no extra options --> + </when> + <when value="NoOriginalQualityScores"> + <!-- no extra options --> + </when> + <when value="NotPrimaryAlignment"> + <!-- no extra options --> + </when> + <when value="Platform454"> + <!-- no extra options --> + </when> + <when value="Platform"> + <param name="PLFilterName" type="text" value="" label="Discard reads with RG:PL attribute containing this string"/> + </when> + <when value="PlatformUnit"> + <!-- no extra options --> + </when> + <when value="ReadGroupBlackList"> + <!-- no extra options --> + </when> + <when value="ReadName"> + <param name="readName" type="text" value="" label="Filter out all reads except those with this read name"/> + </when> + <when value="ReadStrand"> + <param name="filterPositive" type="boolean" truevalue="--filterPositive" falsevalue="" label="Discard reads on the forward strand"/> + </when> + <when value="ReassignMappingQuality"> + <param name="default_mapping_quality" type="integer" value="60" label="Default read mapping quality to assign to all reads"/> + </when> + <when value="Sample"> + <param name="sample_to_keep" type="text" value="" label="The name of the sample(s) to keep, filtering out all others"/> + </when> + <when value="SingleReadGroup"> + <param name="read_group_to_keep" type="integer" value="76" label="The name of the read group to keep, filtering out all others"/> + </when> + <when value="UnmappedRead"> + <!-- no extra options --> + </when> + </conditional> + </repeat> + <repeat name="input_interval_repeat" title="Operate on Genomic intervals" help="-L,--intervals &lt;intervals&gt;"> + <param name="input_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" /> + </repeat> + <repeat name="input_exclude_interval_repeat" title="Exclude Genomic intervals" help="-XL,--excludeIntervals &lt;excludeIntervals&gt;"> + <param name="input_exclude_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" /> + </repeat> + + <param name="interval_set_rule" type="select" label="Interval set rule" help="-isr,--interval_set_rule &lt;interval_set_rule&gt;"> + <option value="UNION" selected="True">UNION</option> + <option value="INTERSECTION">INTERSECTION</option> + </param> + + <conditional name="downsampling_type"> + <param name="downsampling_type_selector" type="select" label="Type of reads downsampling to employ at a given locus" help="-dt,--downsampling_type &lt;downsampling_type&gt;"> + <option value="NONE" selected="True">NONE</option> + <option value="ALL_READS">ALL_READS</option> + <option value="BY_SAMPLE">BY_SAMPLE</option> + </param> + <when value="NONE"> + <!-- no more options here --> + </when> + <when value="ALL_READS"> + <conditional name="downsample_to_type"> + <param name="downsample_to_type_selector" type="select" label="Downsample method"> + <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option> + <option value="downsample_to_coverage">Downsample by Coverage</option> + </param> + <when value="downsample_to_fraction"> + <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &lt;downsample_to_fraction&gt;"/> + </when> + <when value="downsample_to_coverage"> + <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &lt;downsample_to_coverage&gt;"/> + </when> + </conditional> + </when> + <when value="BY_SAMPLE"> + <conditional name="downsample_to_type"> + <param name="downsample_to_type_selector" type="select" label="Downsample method"> + <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option> + <option value="downsample_to_coverage">Downsample by Coverage</option> + </param> + <when value="downsample_to_fraction"> + <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &lt;downsample_to_fraction&gt;"/> + </when> + <when value="downsample_to_coverage"> + <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &lt;downsample_to_coverage&gt;"/> + </when> + </conditional> + </when> + </conditional> + <param name="baq" type="select" label="Type of BAQ calculation to apply in the engine" help="-baq,--baq &lt;baq&gt;"> + <option value="OFF" selected="True">OFF</option> + <option value="CALCULATE_AS_NECESSARY">CALCULATE_AS_NECESSARY</option> + <option value="RECALCULATE">RECALCULATE</option> + </param> + <param name="baq_gap_open_penalty" type="float" label="BAQ gap open penalty (Phred Scaled)" value="40" help="Default value is 40. 30 is perhaps better for whole genome call sets. -baqGOP,--baqGapOpenPenalty &lt;baqGapOpenPenalty&gt;" /> + <param name="use_original_qualities" type="boolean" truevalue="--useOriginalQualities" falsevalue="" label="Use the original base quality scores from the OQ tag" help="-OQ,--useOriginalQualities" /> + <param name="default_base_qualities" type="integer" label="Value to be used for all base quality scores, when some are missing" value="-1" help="-DBQ,--defaultBaseQualities &lt;defaultBaseQualities&gt;"/> + <param name="validation_strictness" type="select" label="How strict should we be with validation" help="-S,--validation_strictness &lt;validation_strictness&gt;"> + <option value="STRICT" selected="True">STRICT</option> + <option value="LENIENT">LENIENT</option> + <option value="SILENT">SILENT</option> + <!-- <option value="DEFAULT_STRINGENCY">DEFAULT_STRINGENCY</option> listed in docs, but not valid value...--> + </param> + <param name="interval_merging" type="select" label="Interval merging rule" help="-im,--interval_merging &lt;interval_merging&gt;"> + <option value="ALL" selected="True">ALL</option> + <option value="OVERLAPPING_ONLY">OVERLAPPING_ONLY</option> + </param> + + <repeat name="read_group_black_list_repeat" title="Read group black list" help="-rgbl,--read_group_black_list &lt;read_group_black_list&gt;"> + <conditional name="read_group_black_list_type"> + <param name="read_group_black_list_type_selector" type="select" label="Type of reads read group black list"> + <option value="file" selected="True">Filters in file</option> + <option value="text">Specify filters as a string</option> + </param> + <when value="file"> + <param name="read_group_black_list" type="data" format="txt" label="Read group black list file" /> + </when> + <when value="text"> + <param name="read_group_black_list" type="text" value="tag:string" label="Read group black list tag:string" /> + </when> + </conditional> + </repeat> + + <param name="disable_experimental_low_memory_sharding" type="boolean" truevalue="--disable_experimental_low_memory_sharding" falsevalue="" label="Disable experimental low-memory sharding functionality." checked="False" help="--disable_experimental_low_memory_sharding"/> + <param name="non_deterministic_random_seed" type="boolean" truevalue="--nonDeterministicRandomSeed" falsevalue="" label="Makes the GATK behave non deterministically, that is, the random numbers generated will be different in every run" checked="False" help="-ndrs,--nonDeterministicRandomSeed"/> + + </when> + </conditional> + </xml> + <xml name="analysis_type_conditional"> + <conditional name="analysis_param_type"> + <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <yield /> + </when> + </conditional> + </xml> + <xml name="reference_source_selector_param"> + <param name="reference_source_selector" type="select" label="Choose the source for the reference list"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + </xml> + <token name="@CITATION_SECTION@">------ + +**Citation** + +For the underlying tool, please cite `DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May;43(5):491-8. <http://www.ncbi.nlm.nih.gov/pubmed/21478889>`_ + +If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.* + + </token> +</macros> \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk_wrapper.py Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,126 @@ +#!/usr/bin/env python +#Dan Blankenberg + +""" +A wrapper script for running the GenomeAnalysisTK.jar commands. +""" + +import sys, optparse, os, tempfile, subprocess, shutil +from binascii import unhexlify +from string import Template + +GALAXY_EXT_TO_GATK_EXT = { 'gatk_interval':'intervals', 'bam_index':'bam.bai', 'gatk_dbsnp':'dbSNP', 'picard_interval_list':'interval_list' } #items not listed here will use the galaxy extension as-is +GALAXY_EXT_TO_GATK_FILE_TYPE = GALAXY_EXT_TO_GATK_EXT #for now, these are the same, but could be different if needed +DEFAULT_GATK_PREFIX = "gatk_file" +CHUNK_SIZE = 2**20 #1mb + + +def cleanup_before_exit( tmp_dir ): + if tmp_dir and os.path.exists( tmp_dir ): + shutil.rmtree( tmp_dir ) + +def gatk_filename_from_galaxy( galaxy_filename, galaxy_ext, target_dir = None, prefix = None ): + suffix = GALAXY_EXT_TO_GATK_EXT.get( galaxy_ext, galaxy_ext ) + if prefix is None: + prefix = DEFAULT_GATK_PREFIX + if target_dir is None: + target_dir = os.getcwd() + gatk_filename = os.path.join( target_dir, "%s.%s" % ( prefix, suffix ) ) + os.symlink( galaxy_filename, gatk_filename ) + return gatk_filename + +def gatk_filetype_argument_substitution( argument, galaxy_ext ): + return argument % dict( file_type = GALAXY_EXT_TO_GATK_FILE_TYPE.get( galaxy_ext, galaxy_ext ) ) + +def open_file_from_option( filename, mode = 'rb' ): + if filename: + return open( filename, mode = mode ) + return None + +def html_report_from_directory( html_out, dir ): + html_out.write( '<html>\n<head>\n<title>Galaxy - GATK Output</title>\n</head>\n<body>\n<p/>\n<ul>\n' ) + for fname in sorted( os.listdir( dir ) ): + html_out.write( '<li><a href="%s">%s</a></li>\n' % ( fname, fname ) ) + html_out.write( '</ul>\n</body>\n</html>\n' ) + +def index_bam_files( bam_filenames, tmp_dir ): + for bam_filename in bam_filenames: + bam_index_filename = "%s.bai" % bam_filename + if not os.path.exists( bam_index_filename ): + #need to index this bam file + stderr_name = tempfile.NamedTemporaryFile( prefix = "bam_index_stderr" ).name + command = 'samtools index %s %s' % ( bam_filename, bam_index_filename ) + proc = subprocess.Popen( args=command, shell=True, stderr=open( stderr_name, 'wb' ) ) + return_code = proc.wait() + if return_code: + for line in open( stderr_name ): + print >> sys.stderr, line + os.unlink( stderr_name ) #clean up + cleanup_before_exit( tmp_dir ) + raise Exception( "Error indexing BAM file" ) + os.unlink( stderr_name ) #clean up + +def __main__(): + #Parse Command Line + parser = optparse.OptionParser() + parser.add_option( '-p', '--pass_through', dest='pass_through_options', action='append', type="string", help='These options are passed through directly to GATK, without any modification.' ) + parser.add_option( '-o', '--pass_through_options', dest='pass_through_options_encoded', action='append', type="string", help='These options are passed through directly to GATK, with decoding from binascii.unhexlify.' ) + parser.add_option( '-d', '--dataset', dest='datasets', action='append', type="string", nargs=4, help='"-argument" "original_filename" "galaxy_filetype" "name_prefix"' ) + parser.add_option( '', '--max_jvm_heap', dest='max_jvm_heap', action='store', type="string", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value.' ) + parser.add_option( '', '--max_jvm_heap_fraction', dest='max_jvm_heap_fraction', action='store', type="int", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value as a fraction of total physical memory.' ) + parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' ) + parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' ) + parser.add_option( '', '--html_report_from_directory', dest='html_report_from_directory', action='append', type="string", nargs=2, help='"Target HTML File" "Directory"') + (options, args) = parser.parse_args() + + tmp_dir = tempfile.mkdtemp( prefix='tmp-gatk-' ) + if options.pass_through_options: + cmd = ' '.join( options.pass_through_options ) + else: + cmd = '' + if options.pass_through_options_encoded: + cmd = '%s %s' % ( cmd, ' '.join( map( unhexlify, options.pass_through_options_encoded ) ) ) + if options.max_jvm_heap is not None: + cmd = cmd.replace( 'java ', 'java -Xmx%s ' % ( options.max_jvm_heap ), 1 ) + elif options.max_jvm_heap_fraction is not None: + cmd = cmd.replace( 'java ', 'java -XX:DefaultMaxRAMFraction=%s -XX:+UseParallelGC ' % ( options.max_jvm_heap_fraction ), 1 ) + bam_filenames = [] + if options.datasets: + for ( dataset_arg, filename, galaxy_ext, prefix ) in options.datasets: + gatk_filename = gatk_filename_from_galaxy( filename, galaxy_ext, target_dir = tmp_dir, prefix = prefix ) + if dataset_arg: + cmd = '%s %s "%s"' % ( cmd, gatk_filetype_argument_substitution( dataset_arg, galaxy_ext ), gatk_filename ) + if galaxy_ext == "bam": + bam_filenames.append( gatk_filename ) + index_bam_files( bam_filenames, tmp_dir ) + #set up stdout and stderr output options + stdout = open_file_from_option( options.stdout, mode = 'wb' ) + stderr = open_file_from_option( options.stderr, mode = 'wb' ) + #if no stderr file is specified, we'll use our own + if stderr is None: + stderr = tempfile.NamedTemporaryFile( prefix="gatk-stderr-", dir=tmp_dir ) + + proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir ) + return_code = proc.wait() + + if return_code: + stderr_target = sys.stderr + else: + stderr_target = sys.stdout + stderr.flush() + stderr.seek(0) + while True: + chunk = stderr.read( CHUNK_SIZE ) + if chunk: + stderr_target.write( chunk ) + else: + break + stderr.close() + #generate html reports + if options.html_report_from_directory: + for ( html_filename, html_dir ) in options.html_report_from_directory: + html_report_from_directory( open( html_filename, 'wb' ), html_dir ) + + cleanup_before_exit( tmp_dir ) + +if __name__=="__main__": __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/a.tab Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,15 @@ +CHR SNP BP A1 TEST NMISS BETA STAT P +1 rs1181876 3671541 T DOMDEV 958 -1.415 -3.326 0.0009161 +1 rs10492923 5092886 C ADD 1007 5.105 4.368 1.382e-05 +1 rs10492923 5092886 C DOMDEV 1007 -5.612 -4.249 2.35e-05 +1 rs10492923 5092886 C GENO_2DF 1007 NA 19.9 4.775e-05 +1 rs1801133 11778965 T ADD 1022 1.23 3.97 7.682e-05 +1 rs1801133 11778965 T GENO_2DF 1022 NA 16.07 0.0003233 +1 rs1361912 12663121 A ADD 1021 12.69 4.093 4.596e-05 +1 rs1361912 12663121 A DOMDEV 1021 -12.37 -3.945 8.533e-05 +1 rs1361912 12663121 A GENO_2DF 1021 NA 17.05 0.0001982 +1 rs1009806 19373138 G ADD 1021 -1.334 -3.756 0.0001826 +1 rs1009806 19373138 G GENO_2DF 1021 NA 19.36 6.244e-05 +1 rs873654 29550948 A DOMDEV 1012 1.526 3.6 0.0003339 +1 rs10489527 36800027 C ADD 1016 12.67 4.114 4.211e-05 +1 rs10489527 36800027 C DOMDEV 1016 -13.05 -4.02 6.249e-05
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/fake_phiX_variant_locations.bed Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,2 @@ +phiX174 1442 1443 +phiX174 1445 1446
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,246 @@ +# Counted Sites 41 +# Counted Bases 340 +# Skipped Sites 2 +# Fraction Skipped 1 / 21 bp +ReadGroup,QualityScore,Cycle,Dinuc,Homopolymer,MinimumNQS,Position,nObservations,nMismatches,Qempirical +A Fake phiX Sample,26,1,NN,0,26,0,9,0,40 +A Fake phiX Sample,26,1,NN,1,26,0,1,0,40 +A Fake phiX Sample,26,2,AG,0,26,1,1,0,40 +A Fake phiX Sample,26,2,CC,0,26,1,1,0,40 +A Fake phiX Sample,26,2,CG,0,26,1,3,0,40 +A Fake phiX Sample,26,2,GC,0,26,1,2,0,40 +A Fake phiX Sample,26,2,GC,1,26,1,1,0,40 +A Fake phiX Sample,26,2,GT,0,26,1,1,0,40 +A Fake phiX Sample,26,2,TG,1,26,1,1,0,40 +A Fake phiX Sample,26,3,CC,0,26,2,1,0,40 +A Fake phiX Sample,26,3,CG,0,26,2,3,0,40 +A Fake phiX Sample,26,3,GC,0,26,2,1,0,40 +A Fake phiX Sample,26,3,GC,1,26,2,2,0,40 +A Fake phiX Sample,26,3,GG,0,26,2,1,0,40 +A Fake phiX Sample,26,3,GT,0,26,2,1,0,40 +A Fake phiX Sample,26,3,TG,1,26,2,1,0,40 +A Fake phiX Sample,26,4,CC,0,26,3,2,0,40 +A Fake phiX Sample,26,4,CG,0,26,3,2,0,40 +A Fake phiX Sample,26,4,GA,0,26,3,1,0,40 +A Fake phiX Sample,26,4,GC,1,26,3,2,0,40 +A Fake phiX Sample,26,4,GG,0,26,3,1,0,40 +A Fake phiX Sample,26,4,GT,0,26,3,1,0,40 +A Fake phiX Sample,26,4,TG,1,26,3,1,0,40 +A Fake phiX Sample,26,5,AT,0,26,4,1,0,40 +A Fake phiX Sample,26,5,CC,0,26,4,2,0,40 +A Fake phiX Sample,26,5,CG,0,26,4,2,0,40 +A Fake phiX Sample,26,5,GA,0,26,4,1,0,40 +A Fake phiX Sample,26,5,GC,1,26,4,1,0,40 +A Fake phiX Sample,26,5,GG,0,26,4,1,0,40 +A Fake phiX Sample,26,5,GT,0,26,4,1,0,40 +A Fake phiX Sample,26,5,TG,1,26,4,1,0,40 +A Fake phiX Sample,26,6,AT,0,26,5,1,0,40 +A Fake phiX Sample,26,6,CC,0,26,5,1,0,40 +A Fake phiX Sample,26,6,CG,0,26,5,2,0,40 +A Fake phiX Sample,26,6,GA,0,26,5,1,0,40 +A Fake phiX Sample,26,6,GG,0,26,5,1,0,40 +A Fake phiX Sample,26,6,GT,0,26,5,2,0,40 +A Fake phiX Sample,26,6,TG,0,26,5,1,0,40 +A Fake phiX Sample,26,6,TG,1,26,5,1,0,40 +A Fake phiX Sample,26,7,AT,0,26,6,1,0,40 +A Fake phiX Sample,26,7,CG,0,26,6,1,0,40 +A Fake phiX Sample,26,7,GA,0,26,6,2,1,3 +A Fake phiX Sample,26,7,GG,0,26,6,1,0,40 +A Fake phiX Sample,26,7,GT,0,26,6,2,0,40 +A Fake phiX Sample,26,7,TG,0,26,6,1,0,40 +A Fake phiX Sample,26,7,TG,1,26,6,2,0,40 +A Fake phiX Sample,26,8,AC,0,26,7,1,0,40 +A Fake phiX Sample,26,8,AT,0,26,7,1,0,40 +A Fake phiX Sample,26,8,GA,0,26,7,2,1,3 +A Fake phiX Sample,26,8,GG,0,26,7,2,0,40 +A Fake phiX Sample,26,8,GT,0,26,7,1,0,40 +A Fake phiX Sample,26,8,TG,0,26,7,1,0,40 +A Fake phiX Sample,26,8,TG,1,26,7,2,0,40 +A Fake phiX Sample,26,9,AC,0,26,8,1,0,40 +A Fake phiX Sample,26,9,AT,0,26,8,1,0,40 +A Fake phiX Sample,26,9,CT,0,26,8,1,0,40 +A Fake phiX Sample,26,9,GA,0,26,8,3,1,5 +A Fake phiX Sample,26,9,GG,0,26,8,2,0,40 +A Fake phiX Sample,26,9,TG,0,26,8,1,0,40 +A Fake phiX Sample,26,9,TG,1,26,8,1,0,40 +A Fake phiX Sample,26,10,AC,0,26,9,1,0,40 +A Fake phiX Sample,26,10,AT,0,26,9,2,0,40 +A Fake phiX Sample,26,10,CT,0,26,9,1,0,40 +A Fake phiX Sample,26,10,GA,0,26,9,3,1,5 +A Fake phiX Sample,26,10,GG,0,26,9,1,0,40 +A Fake phiX Sample,26,10,TG,0,26,9,2,0,40 +A Fake phiX Sample,26,11,AC,0,26,10,1,0,40 +A Fake phiX Sample,26,11,AT,0,26,10,2,0,40 +A Fake phiX Sample,26,11,CT,0,26,10,1,0,40 +A Fake phiX Sample,26,11,GA,0,26,10,3,1,5 +A Fake phiX Sample,26,11,TG,0,26,10,3,0,40 +A Fake phiX Sample,26,12,AC,0,26,11,1,0,40 +A Fake phiX Sample,26,12,AC,1,26,11,1,0,40 +A Fake phiX Sample,26,12,AT,0,26,11,1,0,40 +A Fake phiX Sample,26,12,CT,0,26,11,1,0,40 +A Fake phiX Sample,26,12,GA,0,26,11,2,1,3 +A Fake phiX Sample,26,12,GC,1,26,11,1,0,40 +A Fake phiX Sample,26,12,TG,0,26,11,3,0,40 +A Fake phiX Sample,26,13,AC,0,26,12,1,0,40 +A Fake phiX Sample,26,13,AC,1,26,12,1,0,40 +A Fake phiX Sample,26,13,CC,0,26,12,2,0,40 +A Fake phiX Sample,26,13,CT,0,26,12,1,0,40 +A Fake phiX Sample,26,13,GA,0,26,12,2,1,3 +A Fake phiX Sample,26,13,GC,1,26,12,1,0,40 +A Fake phiX Sample,26,13,TG,0,26,12,2,0,40 +A Fake phiX Sample,26,14,AC,0,26,13,1,0,40 +A Fake phiX Sample,26,14,AC,1,26,13,1,0,40 +A Fake phiX Sample,26,14,CC,0,26,13,2,0,40 +A Fake phiX Sample,26,14,CG,0,26,13,1,0,40 +A Fake phiX Sample,26,14,CT,0,26,13,2,0,40 +A Fake phiX Sample,26,14,GA,0,26,13,1,0,40 +A Fake phiX Sample,26,14,GC,1,26,13,1,0,40 +A Fake phiX Sample,26,14,TG,0,26,13,1,0,40 +A Fake phiX Sample,26,15,AC,1,26,14,1,0,40 +A Fake phiX Sample,26,15,CC,0,26,14,2,0,40 +A Fake phiX Sample,26,15,CG,0,26,14,1,0,40 +A Fake phiX Sample,26,15,CT,0,26,14,2,0,40 +A Fake phiX Sample,26,15,GA,0,26,14,1,0,40 +A Fake phiX Sample,26,15,GT,0,26,14,1,0,40 +A Fake phiX Sample,26,15,TG,0,26,14,2,0,40 +A Fake phiX Sample,26,16,AC,1,26,15,1,0,40 +A Fake phiX Sample,26,16,CC,0,26,15,1,0,40 +A Fake phiX Sample,26,16,CG,0,26,15,1,0,40 +A Fake phiX Sample,26,16,CT,0,26,15,1,0,40 +A Fake phiX Sample,26,16,GA,0,26,15,2,0,40 +A Fake phiX Sample,26,16,GT,0,26,15,1,0,40 +A Fake phiX Sample,26,16,TA,0,26,15,1,0,40 +A Fake phiX Sample,26,16,TG,0,26,15,2,0,40 +A Fake phiX Sample,26,17,AC,1,26,16,3,0,40 +A Fake phiX Sample,26,17,CC,0,26,16,1,0,40 +A Fake phiX Sample,26,17,CG,0,26,16,1,0,40 +A Fake phiX Sample,26,17,GA,0,26,16,2,0,40 +A Fake phiX Sample,26,17,GT,0,26,16,1,0,40 +A Fake phiX Sample,26,17,TA,0,26,16,1,0,40 +A Fake phiX Sample,26,17,TG,0,26,16,1,0,40 +A Fake phiX Sample,26,18,AC,1,26,17,3,0,40 +A Fake phiX Sample,26,18,CC,0,26,17,3,0,40 +A Fake phiX Sample,26,18,CG,0,26,17,1,0,40 +A Fake phiX Sample,26,18,GA,0,26,17,1,0,40 +A Fake phiX Sample,26,18,GT,0,26,17,1,0,40 +A Fake phiX Sample,26,18,TA,0,26,17,1,0,40 +A Fake phiX Sample,26,19,AC,1,26,18,2,0,40 +A Fake phiX Sample,26,19,CC,0,26,18,3,0,40 +A Fake phiX Sample,26,19,CG,0,26,18,3,0,40 +A Fake phiX Sample,26,19,GT,0,26,18,1,0,40 +A Fake phiX Sample,26,19,TA,0,26,18,1,0,40 +A Fake phiX Sample,26,20,AC,1,26,19,1,0,40 +A Fake phiX Sample,26,20,CC,0,26,19,2,0,40 +A Fake phiX Sample,26,20,CG,0,26,19,3,0,40 +A Fake phiX Sample,26,20,GA,0,26,19,1,0,40 +A Fake phiX Sample,26,20,GT,0,26,19,2,0,40 +A Fake phiX Sample,26,20,TA,0,26,19,1,0,40 +A Fake phiX Sample,26,21,AC,1,26,20,1,0,40 +A Fake phiX Sample,26,21,AG,1,26,20,1,0,40 +A Fake phiX Sample,26,21,CC,0,26,20,1,0,40 +A Fake phiX Sample,26,21,CG,0,26,20,2,0,40 +A Fake phiX Sample,26,21,GA,0,26,20,1,0,40 +A Fake phiX Sample,26,21,GT,0,26,20,2,0,40 +A Fake phiX Sample,26,21,TA,0,26,20,2,0,40 +A Fake phiX Sample,26,22,AC,1,26,21,2,0,40 +A Fake phiX Sample,26,22,AG,1,26,21,1,0,40 +A Fake phiX Sample,26,22,CC,0,26,21,1,0,40 +A Fake phiX Sample,26,22,CG,0,26,21,1,0,40 +A Fake phiX Sample,26,22,GA,0,26,21,1,0,40 +A Fake phiX Sample,26,22,GG,0,26,21,1,0,40 +A Fake phiX Sample,26,22,GT,0,26,21,1,0,40 +A Fake phiX Sample,26,22,TA,0,26,21,2,0,40 +A Fake phiX Sample,26,23,AC,1,26,22,2,0,40 +A Fake phiX Sample,26,23,AG,1,26,22,1,0,40 +A Fake phiX Sample,26,23,CC,0,26,22,2,0,40 +A Fake phiX Sample,26,23,CG,0,26,22,1,0,40 +A Fake phiX Sample,26,23,GA,0,26,22,1,0,40 +A Fake phiX Sample,26,23,GC,0,26,22,1,0,40 +A Fake phiX Sample,26,23,GG,0,26,22,1,0,40 +A Fake phiX Sample,26,23,TA,0,26,22,1,0,40 +A Fake phiX Sample,26,24,AC,1,26,23,1,0,40 +A Fake phiX Sample,26,24,AG,1,26,23,1,0,40 +A Fake phiX Sample,26,24,CC,0,26,23,2,0,40 +A Fake phiX Sample,26,24,CG,0,26,23,2,0,40 +A Fake phiX Sample,26,24,CT,0,26,23,1,0,40 +A Fake phiX Sample,26,24,GA,0,26,23,1,0,40 +A Fake phiX Sample,26,24,GC,0,26,23,1,0,40 +A Fake phiX Sample,26,24,GG,0,26,23,1,0,40 +A Fake phiX Sample,26,25,AG,1,26,24,1,0,40 +A Fake phiX Sample,26,25,CC,0,26,24,1,0,40 +A Fake phiX Sample,26,25,CG,0,26,24,2,0,40 +A Fake phiX Sample,26,25,CT,0,26,24,1,0,40 +A Fake phiX Sample,26,25,GA,0,26,24,2,0,40 +A Fake phiX Sample,26,25,GC,0,26,24,1,0,40 +A Fake phiX Sample,26,25,GG,0,26,24,1,0,40 +A Fake phiX Sample,26,25,TA,1,26,24,1,0,40 +A Fake phiX Sample,26,26,AG,1,26,25,2,0,40 +A Fake phiX Sample,26,26,CG,0,26,25,1,0,40 +A Fake phiX Sample,26,26,CT,0,26,25,1,0,40 +A Fake phiX Sample,26,26,GA,0,26,25,2,0,40 +A Fake phiX Sample,26,26,GC,0,26,25,1,0,40 +A Fake phiX Sample,26,26,GG,0,26,25,1,0,40 +A Fake phiX Sample,26,26,TA,1,26,25,1,0,40 +A Fake phiX Sample,26,27,AC,2,26,26,1,0,40 +A Fake phiX Sample,26,27,AG,1,26,26,2,0,40 +A Fake phiX Sample,26,27,CT,0,26,26,1,0,40 +A Fake phiX Sample,26,27,GA,0,26,26,1,0,40 +A Fake phiX Sample,26,27,GC,0,26,26,1,0,40 +A Fake phiX Sample,26,27,GG,0,26,26,2,0,40 +A Fake phiX Sample,26,27,TA,1,26,26,1,0,40 +A Fake phiX Sample,26,28,AC,2,26,27,1,0,40 +A Fake phiX Sample,26,28,AG,1,26,27,1,0,40 +A Fake phiX Sample,26,28,CC,1,26,27,1,0,40 +A Fake phiX Sample,26,28,CT,0,26,27,1,0,40 +A Fake phiX Sample,26,28,GC,0,26,27,2,0,40 +A Fake phiX Sample,26,28,GG,0,26,27,2,0,40 +A Fake phiX Sample,26,28,TA,1,26,27,1,0,40 +A Fake phiX Sample,26,29,AC,2,26,28,1,0,40 +A Fake phiX Sample,26,29,CC,1,26,28,1,0,40 +A Fake phiX Sample,26,29,CT,0,26,28,2,0,40 +A Fake phiX Sample,26,29,GC,0,26,28,2,0,40 +A Fake phiX Sample,26,29,GG,0,26,28,1,0,40 +A Fake phiX Sample,26,29,TA,1,26,28,1,0,40 +A Fake phiX Sample,26,30,AC,2,26,29,1,0,40 +A Fake phiX Sample,26,30,CC,1,26,29,1,0,40 +A Fake phiX Sample,26,30,CT,0,26,29,3,0,40 +A Fake phiX Sample,26,30,GC,0,26,29,1,0,40 +A Fake phiX Sample,26,30,TA,1,26,29,2,0,40 +A Fake phiX Sample,26,31,AC,2,26,30,1,0,40 +A Fake phiX Sample,26,31,CC,1,26,30,1,0,40 +A Fake phiX Sample,26,31,CT,0,26,30,2,0,40 +A Fake phiX Sample,26,31,TA,1,26,30,3,0,40 +A Fake phiX Sample,26,32,AA,0,26,31,1,0,40 +A Fake phiX Sample,26,32,AC,1,26,31,1,0,40 +A Fake phiX Sample,26,32,AC,2,26,31,1,0,40 +A Fake phiX Sample,26,32,CC,1,26,31,1,0,40 +A Fake phiX Sample,26,32,CT,0,26,31,1,0,40 +A Fake phiX Sample,26,32,TA,1,26,31,2,0,40 +A Fake phiX Sample,26,33,AA,0,26,32,1,0,40 +A Fake phiX Sample,26,33,AC,1,26,32,1,0,40 +A Fake phiX Sample,26,33,AC,2,26,32,1,0,40 +A Fake phiX Sample,26,33,AT,0,26,32,1,0,40 +A Fake phiX Sample,26,33,CC,1,26,32,1,0,40 +A Fake phiX Sample,26,33,CT,0,26,32,1,0,40 +A Fake phiX Sample,26,33,TA,1,26,32,1,0,40 +A Fake phiX Sample,26,34,AA,0,26,33,1,0,40 +A Fake phiX Sample,26,34,AC,1,26,33,1,0,40 +A Fake phiX Sample,26,34,AT,0,26,33,1,0,40 +A Fake phiX Sample,26,34,CC,1,26,33,1,0,40 +A Fake phiX Sample,26,34,CT,0,26,33,2,0,40 +A Fake phiX Sample,26,34,TA,1,26,33,1,0,40 +A Fake phiX Sample,26,34,TG,0,26,33,1,0,40 +A Fake phiX Sample,26,35,AA,0,26,34,1,0,40 +A Fake phiX Sample,26,35,AT,0,26,34,1,0,40 +A Fake phiX Sample,26,35,CT,0,26,34,2,0,40 +A Fake phiX Sample,26,35,GA,0,26,34,1,0,40 +A Fake phiX Sample,26,35,TA,1,26,34,2,0,40 +A Fake phiX Sample,26,35,TG,0,26,34,1,0,40 +A Fake phiX Sample,26,36,AA,0,26,35,2,0,40 +A Fake phiX Sample,26,36,AG,0,26,35,1,0,40 +A Fake phiX Sample,26,36,AT,0,26,35,1,0,40 +A Fake phiX Sample,26,36,CT,0,26,35,2,0,40 +A Fake phiX Sample,26,36,GA,0,26,35,1,0,40 +A Fake phiX Sample,26,36,TA,0,26,35,2,0,40 +A Fake phiX Sample,26,36,TG,0,26,35,1,0,40 +EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,13 @@ +GenomeAnalysisEngine - Strictness is SILENT +CountCovariatesWalker - The covariates being used here: +CountCovariatesWalker - ReadGroupCovariate +CountCovariatesWalker - QualityScoreCovariate +CountCovariatesWalker - CycleCovariate +CountCovariatesWalker - DinucCovariate +CountCovariatesWalker - HomopolymerCovariate +CountCovariatesWalker - MinimumNQSCovariate +CountCovariatesWalker - PositionCovariate +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +CountCovariatesWalker - Writing raw recalibration data... +CountCovariatesWalker - ...done! +TraversalEngine - Total runtime
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX.fasta Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/gatk_sorted_picard_index.loc.sample Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,26 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Picard dict and associated files. You will need +#to create these data files and then create a picard_index.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The picard_index.loc +#file has this format (longer white space is the TAB character): +# +#<unique_build_id> <dbkey> <display_name> <fasta_file_path> +# +#So, for example, if you had hg18 indexed and stored in +#/depot/data2/galaxy/srma/hg18/, +#then the srma_index.loc entry would look like this: +# +#hg18 hg18 hg18 Pretty /depot/data2/galaxy/picard/hg18/hg18.fa +# +#and your /depot/data2/galaxy/srma/hg18/ directory +#would contain the following three files: +#hg18.fa +#hg18.dict +#hg18.fa.fai +# +#The dictionary file for each reference (ex. hg18.dict) must be +#created via Picard (http://picard.sourceforge.net). Note that +#the dict file does not have the .fa extension although the +#path list in the loc file does include it. +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Location of Picard dict files valid for GATK --> + <table name="gatk_picard_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/gatk_sorted_picard_index.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Tue Apr 01 10:51:01 2014 -0400 @@ -0,0 +1,9 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="gatk" version="1.4"> + <repository changeset_revision="ec95ec570854" name="package_gatk_1_4" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" /> + </package> + <package name="samtools" version="0.1.18"> + <repository changeset_revision="171cd8bc208d" name="package_samtools_0_1_18" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>