Mercurial > repos > devteam > fasta_clipping_histogram

diff test-data/input.fasta @ 2:9db07fd39f85 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fasta_clipping_histogram commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
author iuc
date Tue, 08 May 2018 12:53:35 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/input.fasta	Tue May 08 12:53:35 2018 -0400
@@ -0,0 +1,6 @@
+>sequence1
+AGTAGTAGGTGATGTAGAGAGAGAGAGAGTAG
+>sequence2
+GTGTGTGTGGGAAGTTGACACAGTA
+>sequence3
+CCTTGAGATTAACGCTAATCAAGTAAAC
\ No newline at end of file