0
|
1 @FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
|
|
2 TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
|
|
3 +
|
|
4 IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
|
|
5 @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
|
|
6 cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc
|
|
7 +
|
|
8 IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
|
|
9 @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
|
|
10 actgactgactgactgactgactgactgactgactgactga
|
|
11 +
|
|
12 IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
|
|
13 @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled)
|
|
14 NHBVDMKSWRYGATCnhbvdmkswrygatc
|
|
15 +
|
|
16 ?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I
|