Mercurial > repos > devteam > fastq_manipulation

comparison test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger @ 0:5d1e9e13e8db draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Imported from capsule None
author devteam
date Mon, 27 Jan 2014 09:26:01 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:5d1e9e13e8db
1 @FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
2 TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
3 +
4 IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
5 @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
6 cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc
7 +
8 IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
9 @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order)
10 actgactgactgactgactgactgactgactgactgactga
11 +
12 IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
13 @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled)
14 NHBVDMKSWRYGATCnhbvdmkswrygatc
15 +
16 ?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I