Mercurial > repos > devteam > fastq_manipulation
view test-data/misc_dna_original_sanger.fastqsanger @ 0:5d1e9e13e8db draft
Imported from capsule None
author | devteam |
---|---|
date | Mon, 27 Jan 2014 09:26:01 -0500 |
parents | |
children |
line wrap: on
line source
@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTA + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) gTcatAGcgTcatAGcgTcatAGcgTcatAGcgTcatAGcg + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) tcagtcagtcagtcagtcagtcagtcagtcagtcagtcagt + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) gatcrywsmkhbvdnGATCRYWSMKHBVDN + I?5+I?5+I?5+I?5+I?5+I?5+I?5+I?