Mercurial > repos > devteam > fastq_manipulation
view test-data/misc_rna_as_sanger_rev_comp_1.fastqsanger @ 3:7861f3b10c68 draft
"planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/galaxy_sequence_utils/fastq_manipulation commit 31edb920789fbd080260f853bc856be72fa7cfa8"
author | devteam |
---|---|
date | Fri, 01 Nov 2019 13:24:05 -0400 |
parents | 5d1e9e13e8db |
children |
line wrap: on
line source
@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) UACGUACGUACGUACGUACGUACGUACGUACGUACGUACGU + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) cgCUaugAcgCUaugAcgCUaugAcgCUaugAcgCUaugAc + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) acugacugacugacugacugacugacugacugacugacuga + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled) NHBVDMKSWRYGAUCnhbvdmkswrygauc + IHGFEDIHGFEDIHGFEDIHGFEDIHGFED