Mercurial > repos > devteam > fastq_manipulation
view test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger @ 1:bb07615a5b6a draft
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/galaxy_sequence_utils/fastq_manipulation commit a1517c9d22029095120643bbe2c8fa53754dd2b7
author | devteam |
---|---|
date | Wed, 11 Nov 2015 12:41:10 -0500 |
parents | 5d1e9e13e8db |
children |
line wrap: on
line source
@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) actgactgactgactgactgactgactgactgactgactga + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) NHBVDMKSWRYGATCnhbvdmkswrygatc + ?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I