Mercurial > repos > devteam > fastq_manipulation
view test-data/misc_rna_original_sanger.fastqsanger @ 1:bb07615a5b6a draft
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/galaxy_sequence_utils/fastq_manipulation commit a1517c9d22029095120643bbe2c8fa53754dd2b7
author | devteam |
---|---|
date | Wed, 11 Nov 2015 12:41:10 -0500 |
parents | 5d1e9e13e8db |
children |
line wrap: on
line source
@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) ACGUACGUACGUACGUACGUACGUACGUACGUACGUACGUA + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI @FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) gUcauAGcgUcauAGcgUcauAGcgUcauAGcgUcauAGcg + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI @FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) ucagucagucagucagucagucagucagucagucagucagu + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI @FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled) gaucrywsmkhbvdnGAUCRYWSMKHBVDN + DEFGHIDEFGHIDEFGHIDEFGHIDEFGHI