# HG changeset patch
# User devteam
# Date 1506797927 14400
# Node ID 462abc5618ba2000a30134eb46f46cd314713c99
# Parent  f0949bc49926f6fcd591c075301abae4ec5b89ae
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/galaxy_sequence_utils/fastq_paired_end_deinterlacer commit f2582539542b33240234e8ea6093e25d0aee9b6a

diff -r f0949bc49926 -r 462abc5618ba fastq_paired_end_deinterlacer.py
--- a/fastq_paired_end_deinterlacer.py	Mon Jan 27 09:27:16 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,66 +0,0 @@
-#Florent Angly
-import sys
-from galaxy_utils.sequence.fastq import fastqReader, fastqWriter, fastqNamedReader, fastqJoiner
-
-def main():
-    input_filename   = sys.argv[1]
-    input_type       = sys.argv[2] or 'sanger'
-    mate1_filename   = sys.argv[3]
-    mate2_filename   = sys.argv[4]
-    single1_filename = sys.argv[5]
-    single2_filename = sys.argv[6]
-
-    type        = input_type
-    input       = fastqNamedReader( open( input_filename, 'rb' ), format = type  )
-    mate1_out   = fastqWriter( open( mate1_filename, 'wb' ), format = type )
-    mate2_out   = fastqWriter( open( mate2_filename, 'wb' ), format = type )
-    single1_out = fastqWriter( open( single1_filename, 'wb' ), format = type )
-    single2_out = fastqWriter( open( single2_filename, 'wb' ), format = type )
-    joiner      = fastqJoiner( type )
-
-    i = None
-    skip_count = 0
-    found = {}
-    for i, read in enumerate( fastqReader( open( input_filename, 'rb' ), format = type ) ):
-     
-        if read.identifier in found:
-            del found[read.identifier]
-            continue
-
-        mate1 = input.get( read.identifier )
-
-        mate2 = input.get( joiner.get_paired_identifier( mate1 ) )
-
-        if mate2:
-            # This is a mate pair
-            found[mate2.identifier] = None
-            if joiner.is_first_mate( mate1 ):
-                mate1_out.write( mate1 )
-                mate2_out.write( mate2 )
-            else:
-                mate1_out.write( mate2 )
-                mate2_out.write( mate1 )
-        else:
-            # This is a single
-            skip_count += 1
-            if joiner.is_first_mate( mate1 ):
-                single1_out.write( mate1 )
-            else:
-                single2_out.write( mate1 )
-
-    if i is None:
-        print "Your input file contained no valid FASTQ sequences."
-    else:
-        if skip_count:
-            print 'There were %i reads with no mate.' % skip_count
-        print 'De-interlaced %s pairs of sequences.' % ( (i - skip_count + 1)/2 )
-
-    input.close()
-    mate1_out.close()
-    mate2_out.close()
-    single1_out.close()
-    single2_out.close()
-
- 
-if __name__ == "__main__":
-    main()
diff -r f0949bc49926 -r 462abc5618ba fastq_paired_end_deinterlacer.xml
--- a/fastq_paired_end_deinterlacer.xml	Mon Jan 27 09:27:16 2014 -0500
+++ b/fastq_paired_end_deinterlacer.xml	Sat Sep 30 14:58:47 2017 -0400
@@ -1,35 +1,37 @@
-<tool id="fastq_paired_end_deinterlacer" name="FASTQ de-interlacer" version="1.1">
-  <description>on paired end reads</description>
-  <requirements>
-    <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement>
-  </requirements>
-  <command interpreter="python">fastq_paired_end_deinterlacer.py '$input_file' '${input_file.extension[len( 'fastq' ):]}' '$output1_pairs_file' '$output2_pairs_file' '$output1_singles_file' '$output2_singles_file'</command>
-  <inputs>
-    <param name="input_file" type="data" format="fastqsanger,fastqcssanger" label="FASTQ reads" />
-  </inputs>
-  <outputs>
-    <data name="output1_pairs_file" format="input" label="FASTQ de-interlacer left mates from data ${input_file.hid}" />
-    <data name="output2_pairs_file" format="input" label="FASTQ de-interlacer right mates from data ${input_file.hid}"/>
-    <data name="output1_singles_file" format="input" label="FASTQ de-interlacer left singles from data ${input_file.hid}"/>
-    <data name="output2_singles_file" format="input" label="FASTQ de-interlacer right singles from data ${input_file.hid}"/>
-  </outputs>
-  <tests>
-    <test>
-      <param name="input_file" value="paired_end_merged.fastqsanger" ftype="fastqsanger" />
-      <output name="output1_pairs_file" file="paired_end_1.fastqsanger" />
-      <output name="output2_pairs_file" file="paired_end_2.fastqsanger" />
-      <output name="output1_singles_file" file="paired_end_1_singles.fastqsanger" />
-      <output name="output2_singles_file" file="paired_end_2_singles.fastqsanger" />
-    </test>
-    <test>
-      <param name="input_file" value="paired_end_merged_errors.fastqsanger" ftype="fastqsanger" />
-      <output name="output1_pairs_file" file="paired_end_1_cleaned.fastqsanger" />
-      <output name="output2_pairs_file" file="paired_end_2_cleaned.fastqsanger" />
-      <output name="output1_singles_file" file="paired_end_1_cleaned_singles.fastqsanger" />
-      <output name="output2_singles_file" file="paired_end_2_cleaned_singles.fastqsanger" />
-    </test>
-  </tests>
-  <help>
+<tool id="fastq_paired_end_deinterlacer" name="FASTQ de-interlacer" version="1.1.1">
+    <description>on paired end reads</description>
+    <requirements>
+        <requirement type="package" version="1.1.1">galaxy_sequence_utils</requirement>
+    </requirements>
+    <command><![CDATA[
+gx-fastq-paired-end-deinterlacer '$input_file' '${input_file.extension[len('fastq'):]}' '$output1_pairs_file' '$output2_pairs_file' '$output1_singles_file' '$output2_singles_file'
+    ]]></command>
+    <inputs>
+        <param name="input_file" type="data" format="fastqsanger,fastqcssanger,fastqsanger.gz,fastqcssanger.gz,fastqsanger.bz2,fastqcssanger.bz2" label="FASTQ reads" />
+    </inputs>
+    <outputs>
+        <data name="output1_pairs_file" format_source="input_file" label="FASTQ de-interlacer left mates from data ${input_file.hid}" />
+        <data name="output2_pairs_file" format_source="input_file" label="FASTQ de-interlacer right mates from data ${input_file.hid}"/>
+        <data name="output1_singles_file" format_source="input_file" label="FASTQ de-interlacer left singles from data ${input_file.hid}"/>
+        <data name="output2_singles_file" format_source="input_file" label="FASTQ de-interlacer right singles from data ${input_file.hid}"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input_file" value="paired_end_merged.fastqsanger" ftype="fastqsanger" />
+            <output name="output1_pairs_file" file="paired_end_1.fastqsanger" ftype="fastqsanger" />
+            <output name="output2_pairs_file" file="paired_end_2.fastqsanger" ftype="fastqsanger" />
+            <output name="output1_singles_file" file="paired_end_1_singles.fastqsanger" ftype="fastqsanger" />
+            <output name="output2_singles_file" file="paired_end_2_singles.fastqsanger" ftype="fastqsanger" />
+        </test>
+        <test>
+            <param name="input_file" value="paired_end_merged_errors.fastqsanger" ftype="fastqsanger" />
+            <output name="output1_pairs_file" file="paired_end_1_cleaned.fastqsanger" ftype="fastqsanger" />
+            <output name="output2_pairs_file" file="paired_end_2_cleaned.fastqsanger" ftype="fastqsanger" />
+            <output name="output1_singles_file" file="paired_end_1_cleaned_singles.fastqsanger" ftype="fastqsanger" />
+            <output name="output2_singles_file" file="paired_end_2_cleaned_singles.fastqsanger" ftype="fastqsanger" />
+        </test>
+    </tests>
+    <help><![CDATA[
 **What it does**
 
 De-interlaces a single fastq dataset representing paired-end run into two fastq datasets containing only the first or second mate read. Reads without mate are saved in separate output files.
@@ -68,6 +70,8 @@
     CGCCATTCCGAATCGTAGTTGTCGGCGTCTTCCAGTGCGGCAAGGCATCGT
     +1539:931/2
     WNUUZ\P^`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-
-  </help>
+    ]]></help>
+    <citations>
+        <citation type="doi">10.1093/bioinformatics/btq281</citation>
+    </citations>
 </tool>
diff -r f0949bc49926 -r 462abc5618ba tool_dependencies.xml
--- a/tool_dependencies.xml	Mon Jan 27 09:27:16 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-  <package name="galaxy_sequence_utils" version="1.0.0">
-      <repository changeset_revision="0643676ad5f7" name="package_galaxy_utils_1_0" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" />
-    </package>
-</tool_dependency>