Mercurial > repos > devteam > fastq_paired_end_joiner

comparison fastq_paired_end_joiner.xml @ 1:270a8ed8a300 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded tool version 2.0.0 by Simone Leo.
author devteam
date Mon, 07 Jul 2014 15:37:28 -0400
parents 2793d1d765b9
children 41ab1243e8f9
comparison
equal deleted inserted replaced
0:2793d1d765b9 1:270a8ed8a300
1 <tool id="fastq_paired_end_joiner" name="FASTQ joiner" version="1.0.0"> 1 <tool id="fastq_paired_end_joiner" name="FASTQ joiner" version="2.0.0">
2 <description>on paired end reads</description> 2 <description>on paired end reads</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement> 4 <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement>
5 </requirements> 5 </requirements>
6 <command interpreter="python">fastq_paired_end_joiner.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$input2_file' '${input2_file.extension[len( 'fastq' ):]}' '$output_file'</command> 6 <command interpreter="python">fastq_paired_end_joiner.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$input2_file' '${input2_file.extension[len( 'fastq' ):]}' '$output_file' '$style'</command>
7 <inputs> 7 <inputs>
8 <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="Left-hand Reads" /> 8 <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="Left-hand Reads" />
9 <param name="input2_file" type="data" format="fastqsanger,fastqcssanger" label="Right-hand Reads" /> 9 <param name="input2_file" type="data" format="fastqsanger,fastqcssanger" label="Right-hand Reads" />
10 <param name="style" type="select" label="FASTQ Header Style">
11 <option value="old" selected="true">old</option>
12 <option value="new">new</option>
13 </param>
10 </inputs> 14 </inputs>
11 <outputs> 15 <outputs>
12 <data name="output_file" format="input" /> 16 <data name="output_file" format="input" />
13 </outputs> 17 </outputs>
14 <tests> 18 <tests>
19 </test> 23 </test>
20 </tests> 24 </tests>
21 <help> 25 <help>
22 **What it does** 26 **What it does**
23 27
24 This tool joins paired end FASTQ reads from two separate files into a single read in one file. The join is performed using sequence identifiers, allowing the two files to contain differing ordering. If a sequence identifier does not appear in both files, it is excluded from the output. 28 This tool joins paired end FASTQ reads from two separate files into a
25 29 single read in one file. The join is performed using sequence
26 Sequence identifiers with /1 and /2 appended override the left-hand and right-hand designation; i.e. if the reads end with /1 and /2, the read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read. Sequences without this designation will follow the left-hand and right-hand settings set by the user. 30 identifiers, allowing the two files to contain differing ordering. If
31 a sequence identifier does not appear in both files, it is excluded
32 from the output.
27 33
28 ----- 34 -----
29 35
30 **Input formats** 36 **Input formats**
37
38 Both old and new (from recent Illumina software) style FASTQ headers
39 are supported. The following example uses the "old" style.
31 40
32 Left-hand Read:: 41 Left-hand Read::
33 42
34 @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 43 @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
35 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC 44 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC
54 +HWI-EAS91_1_30788AAXX:7:21:1542:1758 63 +HWI-EAS91_1_30788AAXX:7:21:1542:1758
55 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR 64 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
56 65
57 ------ 66 ------
58 67
59 **Citation** 68 **The "new" style**
60 69
61 If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. &lt;http://www.ncbi.nlm.nih.gov/pubmed/20562416&gt;`_ 70 Recent Illumina FASTQ headers are structured as follows::
62 71
72 @COORDS FLAGS
73 COORDS = INSTRUMENT:RUN_#:FLOWCELL_ID:LANE:TILE:X:Y
74 FLAGS = READ:IS_FILTERED:CONTROL_NUMBER:INDEX_SEQUENCE
63 75
76 where the whitespace character between COORDS and FLAGS can be either
77 a space or a tab.
78
79 ------
80
81 **Credits**
82
83 This is an extended version (adds support for "new" style FASTQ headers)
84 of D. Blankenberg's fastq joiner:
85
86 `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. &lt;http://www.ncbi.nlm.nih.gov/pubmed/20562416&gt;`_
87
88 New style header support added by Simone Leo &lt;simone.leo@crs4.it&gt;
64 </help> 89 </help>
65 </tool> 90 </tool>