# HG changeset patch
# User iuc
# Date 1646813491 0
# Node ID e39cc71d3ed6f44702ef9b3824bf08ea48d4499d
# Parent  249c8393f2d4250293361f8370294e84e612d1e5
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/galaxy_sequence_utils/fastq_paired_end_splitter commit a1525904286610e94e833a648d9b20aebb0967e7"

diff -r 249c8393f2d4 -r e39cc71d3ed6 fastq_paired_end_splitter.xml
--- a/fastq_paired_end_splitter.xml	Wed Feb 19 12:34:16 2020 -0500
+++ b/fastq_paired_end_splitter.xml	Wed Mar 09 08:11:31 2022 +0000
@@ -1,4 +1,4 @@
-<tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="@TOOL_VERSION@">
+<tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="@TOOL_VERSION@+galaxy1">
     <description>on joined paired end reads</description>
     <macros>
         <import>macros.xml</import>
@@ -17,8 +17,8 @@
         <param name="input1_file" type="data" format="fastqsanger,fastqcssanger,fastqsanger.gz,fastqcssanger.gz,fastqsanger.bz2,fastqcssanger.bz2" label="FASTQ reads" />
     </inputs>
     <outputs>
-        <data name="output1_file" format_source="input1_file" />
-        <data name="output2_file" format_source="input1_file" />
+        <data name="output1_file" format_source="input1_file" label="${tool.name} on ${on_string}: Forward"/>
+        <data name="output2_file" format_source="input1_file" label="${tool.name} on ${on_string}: Reverse"/>
     </outputs>
     <tests>
         <test>
@@ -32,7 +32,7 @@
 
 Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.
 
-Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively.
+Sequence identifiers will have /1 or /2 appended for the split forward and reverse reads, respectively.
 
 -----
 
@@ -49,14 +49,14 @@
 
 **Outputs**
 
-Left-hand Read::
+Forward Read::
 
     @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
     GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC
     +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
     hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
 
-Right-hand Read::
+Reverse Read::
 
     @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
     GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA