Mercurial > repos > devteam > fastq_to_fasta
diff fastq_to_fasta.xml @ 7:191e43b329f6 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastq_to_fasta commit 17bcf78f445b2e515122330caccb591d8de2a5b4
author | iuc |
---|---|
date | Wed, 23 Apr 2025 05:19:58 +0000 |
parents | 77b41c89d856 |
children |
line wrap: on
line diff
--- a/fastq_to_fasta.xml Thu Aug 10 06:53:23 2023 +0000 +++ b/fastq_to_fasta.xml Wed Apr 23 05:19:58 2025 +0000 @@ -116,11 +116,6 @@ >1 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT ------- - -This tool is based on `FASTX-toolkit`__ by Assaf Gordon. - - .. __: http://hannonlab.cshl.edu/fastx_toolkit/ ]]></help> <expand macro="citations" /> <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->