diff fastq_to_fasta.xml @ 7:191e43b329f6 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastq_to_fasta commit 17bcf78f445b2e515122330caccb591d8de2a5b4
author iuc
date Wed, 23 Apr 2025 05:19:58 +0000
parents 77b41c89d856
children
line wrap: on
line diff
--- a/fastq_to_fasta.xml	Thu Aug 10 06:53:23 2023 +0000
+++ b/fastq_to_fasta.xml	Wed Apr 23 05:19:58 2025 +0000
@@ -116,11 +116,6 @@
     >1
     GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
 
-------
-
-This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
-
- .. __: http://hannonlab.cshl.edu/fastx_toolkit/
     ]]></help>
     <expand macro="citations" />
 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->