Mercurial > repos > devteam > fastq_to_fasta
changeset 7:191e43b329f6 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastq_to_fasta commit 17bcf78f445b2e515122330caccb591d8de2a5b4
| author | iuc | 
|---|---|
| date | Wed, 23 Apr 2025 05:19:58 +0000 | 
| parents | 77b41c89d856 | 
| children | |
| files | fastq_to_fasta.xml macros.xml | 
| diffstat | 2 files changed, 2 insertions(+), 7 deletions(-) [+] | 
line wrap: on
 line diff
--- a/fastq_to_fasta.xml Thu Aug 10 06:53:23 2023 +0000 +++ b/fastq_to_fasta.xml Wed Apr 23 05:19:58 2025 +0000 @@ -116,11 +116,6 @@ >1 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT ------- - -This tool is based on `FASTX-toolkit`__ by Assaf Gordon. - - .. __: http://hannonlab.cshl.edu/fastx_toolkit/ ]]></help> <expand macro="citations" /> <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
--- a/macros.xml Thu Aug 10 06:53:23 2023 +0000 +++ b/macros.xml Wed Apr 23 05:19:58 2025 +0000 @@ -47,8 +47,8 @@ author = "Assaf Gordon", title = "FASTQ/A short-reads pre-processing tools", year = "2010", - note = "http://hannonlab.cshl.edu/fastx_toolkit/", - url = "http://hannonlab.cshl.edu/fastx_toolkit/"} + note = "https://github.com/agordon/fastx_toolkit", + url = "https://github.com/agordon/fastx_toolkit"} </citation> </citations> </xml>
