changeset 7:191e43b329f6 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastq_to_fasta commit 17bcf78f445b2e515122330caccb591d8de2a5b4
author iuc
date Wed, 23 Apr 2025 05:19:58 +0000 (2 months ago)
parents 77b41c89d856
children
files fastq_to_fasta.xml macros.xml
diffstat 2 files changed, 2 insertions(+), 7 deletions(-) [+]
line wrap: on
line diff
--- a/fastq_to_fasta.xml	Thu Aug 10 06:53:23 2023 +0000
+++ b/fastq_to_fasta.xml	Wed Apr 23 05:19:58 2025 +0000
@@ -116,11 +116,6 @@
     >1
     GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
 
-------
-
-This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
-
- .. __: http://hannonlab.cshl.edu/fastx_toolkit/
     ]]></help>
     <expand macro="citations" />
 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
--- a/macros.xml	Thu Aug 10 06:53:23 2023 +0000
+++ b/macros.xml	Wed Apr 23 05:19:58 2025 +0000
@@ -47,8 +47,8 @@
                     author = "Assaf Gordon",
                     title = "FASTQ/A short-reads pre-processing tools",
                     year = "2010",
-                    note = "http://hannonlab.cshl.edu/fastx_toolkit/",
-                    url = "http://hannonlab.cshl.edu/fastx_toolkit/"}
+                    note = "https://github.com/agordon/fastx_toolkit",
+                    url = "https://github.com/agordon/fastx_toolkit"}
             </citation>
         </citations>
     </xml>