Mercurial > repos > devteam > fastqc

comparison rgFastQC.xml @ 3:0b201de108b9 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author devteam
date Fri, 12 Dec 2014 10:55:57 -0500
parents d2cf2c0c8a11
children 28d39af2dd06
comparison
equal deleted inserted replaced
2:d2cf2c0c8a11 3:0b201de108b9
1 <tool name="FastQC:Read QC" id="fastqc" version="0.62"> 1 <tool id="fastqc" name="FastQC" version="0.63">
2 <description>reports using FastQC</description> 2 <description>Read Quality reports</description>
3 <command interpreter="python"> 3 <requirements>
4 rgFastQC.py 4 <requirement type="package" version="0.11.2">FastQC</requirement>
5 </requirements>
6 <stdio>
7 <exit_code range="1:" />
8 <exit_code range=":-1" />
9 <regex match="Error:" />
10 <regex match="Exception:" />
11 </stdio>
12 <command interpreter="python">
13 rgFastQC.py
5 -i "$input_file" 14 -i "$input_file"
6 -d "$html_file.files_path" 15 -d "$html_file.files_path"
7 -o "$html_file" 16 -o "$html_file"
8 -t "$text_file" 17 -t "$text_file"
9 -n "$out_prefix"
10 -f "$input_file.ext" 18 -f "$input_file.ext"
11 -j "$input_file.name" 19 -j "$input_file.name"
12 -e "\$FASTQC_JAR_PATH/fastqc" 20 -e "\$FASTQC_JAR_PATH/fastqc"
13 #if $contaminants.dataset and str($contaminants) > '' 21 #if $contaminants.dataset and str($contaminants) > ''
14 -c "$contaminants" 22 -c "$contaminants"
15 #end if 23 #end if
16 #if $limits.dataset and str($limits) > '' 24 #if $limits.dataset and str($limits) > ''
17 -l "$limits" 25 -l "$limits"
18 #end if 26 #end if
19 </command> 27 </command>
20 <requirements> 28 <inputs>
21 <requirement type="package" version="0.11.2">FastQC</requirement> 29 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
22 </requirements> 30 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
23 <inputs> 31 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
24 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> 32 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
25 <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" 33 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
26 help="Letters and numbers only please - other characters will be removed"> 34 </inputs>
27 <sanitizer invalid_char=""> 35 <outputs>
28 <valid initial="string.letters,string.digits"/> 36 <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" />
29 </sanitizer> 37 <data format="txt" name="text_file" label="${tool.name} on ${on_string}: RawData" />
30 </param> 38 </outputs>
31 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 39 <tests>
32 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> 40 <test>
33 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" 41 <param name="input_file" value="1000gsample.fastq" />
34 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> 42 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
35 </inputs> 43 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
36 <outputs> 44 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
37 <data format="html" name="html_file" label="${out_prefix}_${input_file.name}_Webpage.html" /> 45 </test>
38 <data format="txt" name="text_file" label="${out_prefix}_${input_file.name}_RawData.txt" /> 46 <test>
39 </outputs> 47 <param name="input_file" value="1000gsample.fastq" />
40 <tests> 48 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
41 <test> 49 <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/>
42 <param name="input_file" value="1000gsample.fastq" /> 50 <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/>
43 <param name="out_prefix" value="fastqc_out" /> 51 </test>
44 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> 52 </tests>
45 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> 53 <help>
46 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
47 </test>
48 <test>
49 <param name="input_file" value="1000gsample.fastq" />
50 <param name="out_prefix" value="fastqc_out" />
51 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
52 <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/>
53 <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/>
54 </test>
55 </tests>
56 <help>
57 54
58 .. class:: infomark 55 .. class:: infomark
59 56
60 **Purpose** 57 **Purpose**
61 58