Mercurial > repos > devteam > fastqc

comparison rgFastQC.xml @ 10:a00a6402d09a draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 2bfbb5ae6b801e43355fdc3f964a5111fe3fe3a1
author iuc
date Wed, 08 Feb 2017 12:43:43 -0500
parents 3a458e268066
children db2dc6bc8f05
comparison
equal deleted inserted replaced
9:3a458e268066 10:a00a6402d09a
8 <exit_code range=":-1" /> 8 <exit_code range=":-1" />
9 <regex match="Error:" /> 9 <regex match="Error:" />
10 <regex match="Exception:" /> 10 <regex match="Exception:" />
11 </stdio> 11 </stdio>
12 <command><![CDATA[ 12 <command><![CDATA[
13 python '$__tool_directory__'/rgFastQC.py 13 python '${__tool_directory__}/rgFastQC.py'
14 -i "$input_file" 14 -i '$input_file'
15 -d "$html_file.files_path" 15 -d '${html_file.files_path}'
16 -o "$html_file" 16 -o '$html_file'
17 -t "$text_file" 17 -t '$text_file'
18 -f "$input_file.ext" 18 -f '${input_file.ext}'
19 -j "$input_file.name" 19 -j '${input_file.name}'
20 #if $contaminants.dataset and str($contaminants) > '' 20 #if $contaminants.dataset and str($contaminants) > ''
21 -c "$contaminants" 21 -c '$contaminants'
22 #end if 22 #end if
23 #if $limits.dataset and str($limits) > '' 23 #if $limits.dataset and str($limits) > ''
24 -l "$limits" 24 -l '$limits'
25 #end if 25 #end if
26 ]]></command> 26 ]]></command>
27 <inputs> 27 <inputs>
28 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> 28 <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
29 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 29 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
30 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> 30 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
31 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" 31 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
32 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> 32 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
33 </inputs> 33 </inputs>
34 <outputs> 34 <outputs>
35 <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" /> 35 <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" />
36 <data format="txt" name="text_file" label="${tool.name} on ${on_string}: RawData" /> 36 <data format="txt" name="text_file" label="${tool.name} on ${on_string}: RawData" />
37 </outputs> 37 </outputs>
47 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" /> 47 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
48 <output name="html_file" file="fastqc_report2.html" ftype="html" compare="sim_size" delta="4096"/> 48 <output name="html_file" file="fastqc_report2.html" ftype="html" compare="sim_size" delta="4096"/>
49 <output name="text_file" file="fastqc_data2.txt" ftype="txt" compare="sim_size"/> 49 <output name="text_file" file="fastqc_data2.txt" ftype="txt" compare="sim_size"/>
50 </test> 50 </test>
51 <test> 51 <test>
52 <param name="input_file" value="1000gsample.fastq.gz" /> 52 <param name="input_file" value="1000gsample.fastq.gz" ftype="fastq.gz" />
53 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
54 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
55 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
56 </test>
57 <test>
58 <param name="input_file" value="1000gsample.fastq.bz2" ftype="fastq.bz2" />
53 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> 59 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
54 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> 60 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
55 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> 61 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
56 </test> 62 </test>
57 </tests> 63 </tests>
58 <help> 64 <help>
59
60 .. class:: infomark 65 .. class:: infomark
61 66
62 **Purpose** 67 **Purpose**
63 68
64 FastQC aims to provide a simple way to do some quality control checks on raw 69 FastQC aims to provide a simple way to do some quality control checks on raw
67 impression of whether your data has any problems of 72 impression of whether your data has any problems of
68 which you should be aware before doing any further analysis. 73 which you should be aware before doing any further analysis.
69 74
70 The main functions of FastQC are: 75 The main functions of FastQC are:
71 76
72 - Import of data from BAM, SAM or FastQ/FastQ.gz files (any variant), 77 - Import of data from BAM, SAM or FastQ/FastQ.gz files (any variant),
73 - Providing a quick overview to tell you in which areas there may be problems 78 - Providing a quick overview to tell you in which areas there may be problems
74 - Summary graphs and tables to quickly assess your data 79 - Summary graphs and tables to quickly assess your data
75 - Export of results to an HTML based permanent report 80 - Export of results to an HTML based permanent report
76 - Offline operation to allow automated generation of reports without running the interactive application 81 - Offline operation to allow automated generation of reports without running the interactive application
77 82
78
79 ----- 83 -----
80
81 84
82 .. class:: infomark 85 .. class:: infomark
83 86
84 **FastQC** 87 **FastQC**
85 88
121 - Kmer Content 124 - Kmer Content
122 125
123 All except Basic Statistics and Overrepresented sequences are plots. 126 All except Basic Statistics and Overrepresented sequences are plots.
124 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ 127 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
125 .. _Picard-tools: http://picard.sourceforge.net/index.shtml 128 .. _Picard-tools: http://picard.sourceforge.net/index.shtml
126
127 </help> 129 </help>
128 <citations> 130 <citations>
129 <citation type="bibtex"> 131 <citation type="bibtex">
130 @ARTICLE{andrews_s, 132 @unpublished{andrews_s,
131 author = {Andrews, S.}, 133 author = {Andrews, S.},
132 keywords = {bioinformatics, ngs, qc}, 134 keywords = {bioinformatics, ngs, qc},
133 priority = {2}, 135 priority = {2},
134 title = {{FastQC A Quality Control tool for High Throughput Sequence Data}}, 136 title = {{FastQC A Quality Control tool for High Throughput Sequence Data}},
135 url = {http://www.bioinformatics.babraham.ac.uk/projects/fastqc/} 137 url = {http://www.bioinformatics.babraham.ac.uk/projects/fastqc/}