--- a/rgFastQC.xml	Fri May 24 13:14:52 2019 -0400
+++ b/rgFastQC.xml	Sun Sep 12 11:20:27 2021 +0000
@@ -1,7 +1,10 @@
-<tool id="fastqc" name="FastQC" version="0.72+galaxy1">
+<tool id="fastqc" name="FastQC" version="0.73+galaxy0">
     <description>Read Quality reports</description>
+    <xrefs>
+        <xref type="bio.tools">fastqc</xref>
+    </xrefs>
     <requirements>
-        <requirement type="package" version="0.11.8">fastqc</requirement>
+        <requirement type="package" version="0.11.9">fastqc</requirement>
     </requirements>
     <stdio>
         <exit_code range="1:" level="fatal" description="FastQC returned non zero exit code" />
@@ -46,7 +49,7 @@
             #if $limits.dataset and str($limits) > ''
                 --limits '${limits}'
             #end if
-
+            --threads \${GALAXY_SLOTS:-2}
             --quiet
             --extract
             #if $min_length:
@@ -63,11 +66,11 @@
     ]]></command>
     <inputs>
         <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data"
-               label="Short read data from your current history" />
+               label="Raw read data from your current history" />
         <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
                help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
         <param argument="--adapters" type="data" format="tabular" optional="true" label="Adapter list"
-               help="list of adapters adapter sequences which will be explicity searched against the library. tab delimited file with 2 columns: name and sequence." />
+               help="List of adapters adapter sequences which will be explicity searched against the library. It should be a tab-delimited file with 2 columns: name and sequence." />
         <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
                help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
         <param argument="--nogroup" type="boolean" truevalue="--nogroup" falsevalue="" checked="False"
@@ -76,7 +79,7 @@
                label="Lower limit on the length of the sequence to be shown in the report"
                help=" As long as you set this to a value greater or equal to your longest read length then this will be the sequence length used to create your read groups.  This can be useful for making directly comaparable statistics from datasets with somewhat variable read lengths."/>
         <param argument="--kmers" type="integer" value="7" min="2" max="10"
-               label="length of Kmer to look for" help="note: the Kmer test is disabled and needs to be enabled using a custom Submodule and limits file"/>
+               label="Length of Kmer to look for" help="Note: the Kmer test is disabled and needs to be enabled using a custom Submodule and limits file"/>
     </inputs>
     <outputs>
         <data format="html" name="html_file" from_work_dir="output.html" label="${tool.name} on ${on_string}: Webpage" />