# HG changeset patch
# User iuc
# Date 1494851697 14400
# Node ID 484e86282f4be64e82a8fc4514376df772afa239
# Parent  db2dc6bc8f052e784b87a8072277f8f1f1fbd7f5
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 4b383d48868d7f3f6d35f242a0ee35953adcb037

diff -r db2dc6bc8f05 -r 484e86282f4b rgFastQC.xml
--- a/rgFastQC.xml	Thu Apr 20 11:06:17 2017 -0400
+++ b/rgFastQC.xml	Mon May 15 08:34:57 2017 -0400
@@ -25,7 +25,8 @@
             #end if
     ]]></command>
     <inputs>
-        <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
+        <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data"
+               label="Short read data from your current history" />
         <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
                help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
         <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
@@ -88,7 +89,7 @@
 
 This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_
 Kindly acknowledge it as well as this tool if you use it.
-FastQC incorporates the Picard-tools_ libraries for sam/bam processing.
+FastQC incorporates the Picard-tools_ libraries for SAM/BAM processing.
 
 The contaminants file parameter was borrowed from the independently developed
 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
@@ -125,7 +126,7 @@
 
 All except Basic Statistics and Overrepresented sequences are plots.
  .. _FastQC: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
- .. _Picard-tools: http://picard.sourceforge.net/index.shtml
+ .. _Picard-tools: https://broadinstitute.github.io/picard/
     </help>
     <citations>
         <citation type="bibtex">