--- a/rgFastQC.py	Mon Apr 11 10:27:34 2016 -0400
+++ b/rgFastQC.py	Mon Oct 31 10:40:12 2016 -0400
@@ -30,12 +30,12 @@
 import zipfile
 
 class FastQCRunner(object):
-    
+
     def __init__(self,opts=None):
         '''
         Initializes an object to run FastQC in Galaxy. To start the process, use the function run_fastqc()
         '''
-        
+
         # Check whether the options are specified and saves them into the object
         assert opts != None
         self.opts = opts
@@ -44,7 +44,7 @@
         '''
         Develops the Commandline to run FastQC in Galaxy
         '''
-        
+
         # Check whether a given file compression format is valid
         # This prevents uncompression of already uncompressed files
         infname = self.opts.inputfilename
@@ -52,7 +52,7 @@
         trimext = False
         # decompression at upload currently does NOT remove this now bogus ending - fastqc will barf
         # patched may 29 2013 until this is fixed properly
-        if ( linf.endswith('.gz') or linf.endswith('.gzip') ): 
+        if ( linf.endswith('.gz') or linf.endswith('.gzip') ):
             f = gzip.open(self.opts.input)
             try:
                 f.readline()
@@ -76,12 +76,12 @@
 	   except:
 	       raise Exception("Input file corruption, could not identify the filetype")
            infname = os.path.splitext(infname)[0]
-        
+
         # Replace unwanted or problematic charaters in the input file name
         self.fastqinfilename = re.sub(ur'[^a-zA-Z0-9_\-\.]', '_', os.path.basename(infname))
         # check that the symbolic link gets a proper ending, fastqc seems to ignore the given format otherwise
         if 'fastq' in opts.informat:
-            # with fastq the .ext is ignored, but when a format is actually passed it must comply with fastqc's 
+            # with fastq the .ext is ignored, but when a format is actually passed it must comply with fastqc's
             # accepted formats..
             opts.informat = 'fastq'
         elif not self.fastqinfilename.endswith(opts.informat):
@@ -103,13 +103,13 @@
         '''
         Retrieves the output html and text files from the output directory and copies them to the Galaxy output files
         '''
-        
+
         # retrieve html file
         result_file = glob.glob(opts.outputdir + '/*html')
         with open(result_file[0], 'rb') as fsrc:
             with open(self.opts.htmloutput, 'wb') as fdest:
                 shutil.copyfileobj(fsrc, fdest)
-        
+
         # retrieve text file
         text_file = glob.glob(opts.outputdir + '/*/fastqc_data.txt')
         with open(text_file[0], 'rb') as fsrc:
@@ -120,11 +120,11 @@
         '''
         Executes FastQC. Make sure the mandatory import parameters input, inputfilename, outputdir and htmloutput have been specified in the options (opts)
         '''
-        
+
         # Create a log file
         dummy,tlog = tempfile.mkstemp(prefix='rgFastQC',suffix=".log",dir=self.opts.outputdir)
         sout = open(tlog, 'w')
-        
+
         self.prepare_command_line()
         sout.write(self.command_line)
         sout.write('\n')
@@ -150,12 +150,12 @@
     op.add_option('-l', '--limits', default=None)
     op.add_option('-e', '--executable', default='fastqc')
     opts, args = op.parse_args()
-    
+
     assert opts.input != None
     assert opts.inputfilename != None
     assert opts.htmloutput != None
-    if not os.path.exists(opts.outputdir): 
+    if not os.path.exists(opts.outputdir):
         os.makedirs(opts.outputdir)
-    
+
     fastqc_runner = FastQCRunner(opts)
     fastqc_runner.run_fastqc()

--- a/rgFastQC.xml	Mon Apr 11 10:27:34 2016 -0400
+++ b/rgFastQC.xml	Mon Oct 31 10:40:12 2016 -0400
@@ -1,7 +1,7 @@
-<tool id="fastqc" name="FastQC" version="0.65">
+<tool id="fastqc" name="FastQC" version="0.66">
     <description>Read Quality reports</description>
     <requirements>
-        <requirement type="package" version="0.11.4">FastQC</requirement>
+        <requirement type="package" version="0.11.5">fastqc</requirement>
     </requirements>
     <stdio>
         <exit_code range="1:" />
@@ -9,8 +9,8 @@
         <regex match="Error:" />
         <regex match="Exception:" />
     </stdio>
-    <command interpreter="python">
-    rgFastQC.py
+    <command><![CDATA[
+        python '$__tool_directory__'/rgFastQC.py
         -i "$input_file"
         -d "$html_file.files_path"
         -o "$html_file"
@@ -23,10 +23,10 @@
         #if $limits.dataset and str($limits) > ''
             -l "$limits"
         #end if
-    </command>
+    ]]></command>
     <inputs>
         <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
-        <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
+        <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
             help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
         <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
             help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
@@ -45,8 +45,8 @@
         <test>
             <param name="input_file" value="1000gsample.fastq" />
             <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
-            <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/>
-            <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/>
+            <output name="html_file" file="fastqc_report2.html" ftype="html" compare="sim_size" delta="4096"/>
+            <output name="text_file" file="fastqc_data2.txt" ftype="txt" compare="sim_size"/>
         </test>
     </tests>
     <help>
@@ -56,9 +56,9 @@
 **Purpose**
 
 FastQC aims to provide a simple way to do some quality control checks on raw
-sequence data coming from high throughput sequencing pipelines. 
+sequence data coming from high throughput sequencing pipelines.
 It provides a modular set of analyses which you can use to give a quick
-impression of whether your data has any problems of 
+impression of whether your data has any problems of
 which you should be aware before doing any further analysis.
 
 The main functions of FastQC are:
@@ -91,7 +91,7 @@
 
 **Inputs and outputs**
 
-FastQC_ is the best place to look for documentation - it's very good. 
+FastQC_ is the best place to look for documentation - it's very good.
 A summary follows below for those in a tearing hurry.
 
 This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.

--- a/tool_dependencies.xml	Mon Apr 11 10:27:34 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-  <package name="FastQC" version="0.11.4">
-      <repository changeset_revision="a8f485b2efd9" name="package_fastqc_0_11_4" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
-    </package>
-</tool_dependency>