diff fastqsolexa_to_fasta_qual.xml @ 0:ef23c03d7497 draft default tip

Imported from capsule None
author devteam
date Mon, 19 May 2014 12:33:24 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fastqsolexa_to_fasta_qual.xml	Mon May 19 12:33:24 2014 -0400
@@ -0,0 +1,93 @@
+<tool id="fastqsolexa_to_fasta_qual" name="FASTQSOLEXA-to-FASTA-QUAL" version="1.0.0">
+  <description>extracts sequences and quality scores from FASTQSOLEXA data</description>
+  <command interpreter="python">fastqsolexa_to_fasta_qual.py $input1 $output1 $output2 $input1.extension</command>
+  <inputs>
+    <param name="input1" type="data" format="fastqsolexa" label="Fastqsolexa file"/>
+  </inputs>
+  <outputs>
+    <data name="output1" format="fasta"/>
+    <data name="output2" format="qualsolexa"/>
+  </outputs>
+  <tests>
+    <!-- NOTE: this tool generates 2 output files, but our functional tests currently only handle the last one generated -->
+    <test>
+      <param name="input1" value="1.fastqsolexa" ftype="fastqsolexa" />
+      <output name="output1" file="fastqsolexa_to_fasta_qual_out4.fasta" />
+      <output name="output2" file="fastqsolexa_to_fasta_qual_out4.qualsolexa" />
+    </test>
+    <test>
+      <param name="input1" value="2.fastqsolexa" ftype="fastqsolexa" />
+      <output name="output1" file="fastqsolexa_to_fasta_qual_out2.fasta" />
+      <output name="output2" file="fastqsolexa_to_fasta_qual_out2.qualsolexa" />
+    </test>
+  </tests>
+  <help>
+
+.. class:: warningmark
+
+IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64.  
+
+-----
+
+**What it does**
+
+This tool extracts sequences and quality scores from FASTQ data ( Solexa variant ), producing a FASTA dataset and a QUAL dataset.
+
+-----
+
+**Example1**
+
+- Converting the following Solexa fastq data::
+
+    @seq1  
+    GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT  
+    +seq1  
+    hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh  
+    @seq2  
+    GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG  
+    +seq2  
+    hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO
+
+- will extract the following sequences::
+
+    >seq1
+    GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
+    >seq2
+    GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG
+    
+- and quality scores::
+
+    >seq1
+    40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 0 40 40 40 40 40 40 
+    >seq2
+    40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 33 40 40 40 40 23 40 1 40 6 40 19 9 10 7 3 40 15 
+
+**Example2**
+
+- Converting the following Solexa fastq data::
+
+    @HANNIBAL_1_FC302VTAAXX:2:1:228:167
+    GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
+    +HANNIBAL_1_FC302VTAAXX:2:1:228:167
+    40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4
+    @HANNIBAL_1_FC302VTAAXX:2:1:156:340
+    GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG
+    +HANNIBAL_1_FC302VTAAXX:2:1:156:340
+    40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9
+
+- will extract the following sequences::
+
+    >HANNIBAL_1_FC302VTAAXX:2:1:228:167
+    GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
+    >HANNIBAL_1_FC302VTAAXX:2:1:156:340
+    GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG
+
+- and quality scores::
+
+    >HANNIBAL_1_FC302VTAAXX:2:1:228:167
+    40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4
+    >HANNIBAL_1_FC302VTAAXX:2:1:156:340
+    40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9
+
+    </help>
+</tool>