# HG changeset patch # User devteam # Date 1380121658 14400 # Node ID 2fe2d2b9e8e4f8d87d1a301bf775aa0b3e9adf86 Uploaded tool tarball. diff -r 000000000000 -r 2fe2d2b9e8e4 fastx_clipper.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_clipper.xml Wed Sep 25 11:07:38 2013 -0400 @@ -0,0 +1,117 @@ + + adapter sequences + + fastx_toolkit + + + zcat -f $input | fastx_clipper -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS +#if $input.ext == "fastqsanger": + -Q 33 +#end if + + + + + + + Minimum sequence length (after clipping, sequences shorter than this length will be discarded) + + + + + + + + + + + + + + + + + + + + + + + + enter non-zero value to keep the adapter sequence and x bases that follow it + use this for hairpin barcoding. keep at 0 unless you know what you're doing. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. + +-------- + + +**Clipping Illustration:** + +.. image:: ${static_path}/fastx_icons/fastx_clipper_illustration.png + + + + + + + + +**Clipping Example:** + +.. image:: ${static_path}/fastx_icons/fastx_clipper_example.png + + + +**In the above example:** + +* Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter). +* Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter). + + + + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + + + diff -r 000000000000 -r 2fe2d2b9e8e4 test-data/fastx_clipper1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastx_clipper1.fastq Wed Sep 25 11:07:38 2013 -0400 @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaabbXEZabaaaaaaaa]]` +@CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCCAATTGGTTAATCCCCCTATATATACT ++CSHL_3_FC042AGLLWW:1:2:7:33 +Waaa^aZaaW^U_XaWaa\WMEP^KEZXRPEEEGaa +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUUR +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[ +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACAATTGGTTAATCCCCCTATATA ++CSHL_3_FC042AGLLWW:1:2:7:292 +babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACAA ++CSHL_3_FC042AGLLWW:1:2:7:1819 +a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG ++CSHL_3_FC042AGLLWW:1:2:8:624 +aa[S^`X`aa_]]OOXMU^_[MU_aaaaaaaaaaaa +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA ++CSHL_3_FC042AGLLWW:1:2:8:250 +aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE diff -r 000000000000 -r 2fe2d2b9e8e4 test-data/fastx_clipper1a.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastx_clipper1a.out Wed Sep 25 11:07:38 2013 -0400 @@ -0,0 +1,20 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaabbXEZabaa +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUU +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATA ++CSHL_3_FC042AGLLWW:1:2:7:1819 +a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULI +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEX +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATG ++CSHL_3_FC042AGLLWW:1:2:8:250 +aaaaaaaa^aaaaaabb diff -r 000000000000 -r 2fe2d2b9e8e4 tool-data/fastx_clipper_sequences.txt.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/fastx_clipper_sequences.txt.sample Wed Sep 25 11:07:38 2013 -0400 @@ -0,0 +1,13 @@ +# +# Adapter/Linker sequences for FASTX-Clipper tool. +# +# Format: +# Adapter Sequence Descriptive name +# +# Example: +# AAATTTGATAAGATA Our-Adapter +# +# Some adapters can be found here: +# http://seqanswers.com/forums/showthread.php?t=198 +# +#TGTAGGCC Dummy-Adapter (don't use me) diff -r 000000000000 -r 2fe2d2b9e8e4 tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Wed Sep 25 11:07:38 2013 -0400 @@ -0,0 +1,6 @@ + + + + + +