Mercurial > repos > devteam > fastx_renamer
view fastx_renamer.xml @ 6:0ffae348abae draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit 17bcf78f445b2e515122330caccb591d8de2a5b4
author | iuc |
---|---|
date | Wed, 23 Apr 2025 05:20:45 +0000 |
parents | f984bb114520 |
children |
line wrap: on
line source
<tool id="cshl_fastx_renamer" name="Rename sequences" version="@VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05" > <description></description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements"> <requirement type="package" version="1.0.8">bzip2</requirement> </expand> <command detect_errors="exit_code"><![CDATA[ @CATS@ fastx_renamer -n $TYPE -v @FQQUAL@ @GZIP@ > '$output' ]]></command> <inputs> <expand macro="fastx_input" /> <param name="TYPE" type="select" label="Rename sequence identifiers to"> <option value="SEQ">Nucleotides sequence</option> <option value="COUNT">Numeric Counter</option> </param> </inputs> <outputs> <data name="output" format_source="input" metadata_source="input" /> </outputs> <tests> <test> <param name="input" value="fastx_renamer-in1.fastq" /> <param name="TYPE" value="SEQ" /> <output name="output" file="fastx_renamer-out1.fastq" /> </test> </tests> <help><![CDATA[ **What it does** This tool renames the sequence identifiers in a FASTQ/A file. .. class:: infomark Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc). -------- **Example** The following Solexa-FASTQ file:: @CSHL_4_FC042GAMMII_2_1_517_596 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +CSHL_4_FC042GAMMII_2_1_517_596 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 Renamed to **nucleotides sequence**:: @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 Renamed to **numeric counter**:: @1 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +1 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 ]]></help> <expand macro="citations" /> </tool>