Mercurial > repos > devteam > fastx_reverse_complement

changeset 0:c58871138668

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded tool tarball.
author devteam
date Wed, 25 Sep 2013 11:20:25 -0400
parents
children 5bd826723d61
files fastx_reverse_complement.xml test-data/fastx_rev_comp1.fasta test-data/fastx_rev_comp2.fastq test-data/fastx_reverse_complement1.out test-data/fastx_reverse_complement2.out tool_dependencies.xml
diffstat 6 files changed, 95 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_reverse_complement.xml	Wed Sep 25 11:20:25 2013 -0400
@@ -0,0 +1,65 @@
+<tool id="cshl_fastx_reverse_complement" version="1.0.0" name="Reverse-Complement">
+	<description></description>
+    <requirements>
+        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
+    </requirements>
+	<command>zcat -f '$input' | fastx_reverse_complement -v -o $output
+#if $input.ext == "fastqsanger":
+-Q 33
+#end if
+	</command>
+	<inputs>
+		<param format="fasta,fastqsolexa,fastqsanger" version="1.0.0" name="input" type="data" label="Library to reverse-complement" />
+	</inputs>
+
+	<tests>
+		<test>
+			<!-- Reverse-complement a FASTA file -->
+			<param version="1.0.0" name="input" value="fastx_rev_comp1.fasta" /> 
+			<output version="1.0.0" name="output" file="fastx_reverse_complement1.out" />
+		</test>
+		<test>
+			<!-- Reverse-complement a FASTQ file -->
+			<param version="1.0.0" name="input" value="fastx_rev_comp2.fastq" ftype="fastqsolexa"/>
+			<output version="1.0.0" name="output" file="fastx_reverse_complement2.out" />
+		</test>
+	</tests>
+
+  
+	<outputs>
+		<data format="input" version="1.0.0" name="output" metadata_source="input" />
+	</outputs>
+
+<help>
+**What it does**
+
+This tool reverse-complements each sequence in a library.
+If the library is a FASTQ, the quality-scores are also reversed.
+  
+--------
+
+**Example**
+
+Input FASTQ file::
+
+    @CSHL_1_FC42AGWWWXX:8:1:3:740
+    TGTCTGTAGCCTCNTCCTTGTAATTCAAAGNNGGTA
+    +CSHL_1_FC42AGWWWXX:8:1:3:740
+    33 33 33 34 33 33 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 27 21 27 33 32 31 29 26 24 5 5 15 17 27 26
+
+
+Output FASTQ file::
+
+    @CSHL_1_FC42AGWWWXX:8:1:3:740
+    TACCNNCTTTGAATTACAAGGANGAGGCTACAGACA
+    +CSHL_1_FC42AGWWWXX:8:1:3:740
+    26 27 17 15 5 5 24 26 29 31 32 33 27 21 27 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 33 33 34 33 33 33
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
+</help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastx_rev_comp1.fasta	Wed Sep 25 11:20:25 2013 -0400
@@ -0,0 +1,4 @@
+>CSHL__2_FC042NGABCD:8:1:120:202
+ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
+>CSHL__2_FC042NGABCD:8:1:103:1185
+ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastx_rev_comp2.fastq	Wed Sep 25 11:20:25 2013 -0400
@@ -0,0 +1,8 @@
+@CSHL__2_FC042NGABCD:8:1:120:202
+ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
++CSHL__2_FC042NGABCD:8:1:120:202
+40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1 3 7 -1 11 10 -1 21 10 8
+@CSHL__2_FC042NGABCD:8:1:103:1185
+ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC
++CSHL__2_FC042NGABCD:8:1:103:1185
+40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 -0 9 22 17 14 8 36 15 34 22 12 23 3 10 -0 8 2 4 25 30 2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastx_reverse_complement1.out	Wed Sep 25 11:20:25 2013 -0400
@@ -0,0 +1,4 @@
+>CSHL__2_FC042NGABCD:8:1:120:202
+GCAGAAAACGGCATACTAGCTCTTCCGATCTATCGT
+>CSHL__2_FC042NGABCD:8:1:103:1185
+GAAGACGGTAAACGAGCTCTGCCGATCTATCGTGAT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastx_reverse_complement2.out	Wed Sep 25 11:20:25 2013 -0400
@@ -0,0 +1,8 @@
+@CSHL__2_FC042NGABCD:8:1:120:202
+GCAGAAAACGGCATACTAGCTCTTCCGATCTATCGT
++CSHL__2_FC042NGABCD:8:1:120:202
+8 10 21 -1 10 11 -1 7 3 1 8 40 27 14 40 30 -1 40 20 40 25 40 40 28 40 40 6 40 40 40 40 20 40 40 40 40
+@CSHL__2_FC042NGABCD:8:1:103:1185
+GAAGACGGTAAACGAGCTCTGCCGATCTATCGTGAT
++CSHL__2_FC042NGABCD:8:1:103:1185
+2 30 25 4 2 8 0 10 3 23 12 22 34 15 36 8 14 17 22 9 0 40 22 30 32 40 40 40 31 33 35 40 40 40 40 40
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Wed Sep 25 11:20:25 2013 -0400
@@ -0,0 +1,6 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="fastx_toolkit" version="0.0.13">
+        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" />
+    </package>
+</tool_dependency>