Mercurial > repos > devteam > fastx_trimmer
diff fastx_trimmer.xml @ 3:bbb007a39ac2 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
| author | iuc |
|---|---|
| date | Tue, 08 May 2018 13:28:34 -0400 |
| parents | 377ac2829eac |
| children | b98f3fa516a3 |
line wrap: on
line diff
--- a/fastx_trimmer.xml Wed Nov 11 12:40:14 2015 -0500 +++ b/fastx_trimmer.xml Tue May 08 13:28:34 2018 -0400 @@ -1,30 +1,23 @@ -<tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences"> +<tool id="cshl_fastx_trimmer" version="1.0.1" name="Trim sequences"> <description></description> - <requirements> - <requirement type="package" version="0.0.13">fastx_toolkit</requirement> - </requirements> - <command> -<![CDATA[ -zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output' -#if $input.ext == "fastqsanger": - -Q 33 -#end if -]]> - </command> - + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <command detect_errors="exit_code"><![CDATA[ +@CATS@ fastx_trimmer -v +-f $first +-l $last +-o '$output' +@FQQUAL@ + ]]></command> <inputs> - <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" /> - - <param name="first" type="integer" value="1"> - <label>First base to keep</label> - </param> - - <param name="last" type="integer" value="21"> - <label>Last base to keep</label> - </param> + <expand macro="fastx_input" /> + <param name="first" type="integer" value="1" label="First base to keep" /> + <param name="last" type="integer" value="21" label="Last base to keep" /> </inputs> <outputs> - <data format_source="input" name="output" metadata_source="input" /> + <data name="output" format_source="input" metadata_source="input" /> </outputs> <tests> <test> @@ -42,7 +35,7 @@ <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" /> </test> </tests> - <help> + <help><![CDATA[ **What it does** This tool trims (cut bases from) sequences in a FASTA/Q file. @@ -58,7 +51,6 @@ >2-1 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA - Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: >1-1 @@ -78,6 +70,7 @@ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - </help> + ]]></help> + <expand macro="citations" /> <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> </tool>