# HG changeset patch
# User devteam
# Date 1447263614 18000
# Node ID 377ac2829eac09ae3ff8c85e0cb586eb6d7c4649
# Parent  d77c9c6ecf6878cfdcb851b332103e31859a591a
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7

diff -r d77c9c6ecf68 -r 377ac2829eac fastx_trimmer.xml
--- a/fastx_trimmer.xml	Tue Dec 03 12:36:14 2013 -0500
+++ b/fastx_trimmer.xml	Wed Nov 11 12:40:14 2015 -0500
@@ -1,51 +1,52 @@
 <tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences">
-	<description></description>
+    <description></description>
     <requirements>
         <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
     </requirements>
-	<command>zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output
+    <command>
+<![CDATA[
+zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output'
 #if $input.ext == "fastqsanger":
--Q 33
+    -Q 33
 #end if
-	</command>
-
-	<inputs>
-		<param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" />
+]]>
+    </command>
 
-		<param name="first" size="4" type="integer" value="1">
-			<label>First base to keep</label>
-		</param>
+    <inputs>
+        <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" />
 
-		<param name="last" size="4" type="integer" value="21">
-			<label>Last base to keep</label>
-		</param>
-	</inputs>
+        <param name="first" type="integer" value="1">
+            <label>First base to keep</label>
+        </param>
 
-	<tests>
-		<test>
-			<!-- Trim a FASTA file - remove first four bases (e.g. a barcode) -->
-			<param name="input" value="fastx_trimmer1.fasta" />
-			<param name="first" value="5"/>
-			<param name="last" value="36"/>
-			<param name="output" file="fastx_trimmer1.out" />
-		</test>
-		<test>
-			<!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) -->
-			<param name="input" value="fastx_trimmer2.fastq" ftype="fastqsolexa"/>
-			<param name="first" value="1"/>
-			<param name="last" value="27"/>
-			<param name="output" file="fastx_trimmer2.out" />
-		</test>
-	</tests>
-
-	<outputs>
-		<data format="input" name="output" metadata_source="input" />
-	</outputs>
-	<help>
+        <param name="last" type="integer" value="21">
+            <label>Last base to keep</label>
+        </param>
+    </inputs>
+    <outputs>
+        <data format_source="input" name="output" metadata_source="input" />
+    </outputs>
+    <tests>
+        <test>
+            <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) -->
+            <param name="input" value="fastx_trimmer1.fasta" />
+            <param name="first" value="5"/>
+            <param name="last" value="36"/>
+            <output name="output" ftype="fasta" file="fastx_trimmer1.out" />
+        </test>
+        <test>
+            <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) -->
+            <param name="input" value="fastx_trimmer2.fastq" ftype="fastqsolexa"/>
+            <param name="first" value="1"/>
+            <param name="last" value="27"/>
+            <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" />
+        </test>
+    </tests>
+    <help>
 **What it does**
 
 This tool trims (cut bases from) sequences in a FASTA/Q file.
-  
+
 --------
 
 **Example**
@@ -56,7 +57,7 @@
     TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
     >2-1
     CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
-    
+
 
 Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
 
@@ -71,13 +72,12 @@
     TCAGA
     >2-1
     AGGCT
-    
+
     ------
 
 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
 
  .. __: http://hannonlab.cshl.edu/fastx_toolkit/
-    
-</help>
+    </help>
 <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
 </tool>
diff -r d77c9c6ecf68 -r 377ac2829eac tool_dependencies.xml
--- a/tool_dependencies.xml	Tue Dec 03 12:36:14 2013 -0500
+++ b/tool_dependencies.xml	Wed Nov 11 12:40:14 2015 -0500
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool_dependency>
     <package name="fastx_toolkit" version="0.0.13">
-        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>