Mercurial > repos > devteam > realigner_target_creator
changeset 0:b83a853a3156
Imported from capsule None
| author | devteam |
|---|---|
| date | Tue, 01 Apr 2014 10:49:33 -0400 |
| parents | |
| children | 5b8eaae854da |
| files | gatk_macros.xml gatk_wrapper.py realigner_target_creator.xml test-data/1.bam test-data/a.tab test-data/gatk/fake_phiX_reads_1.bam test-data/gatk/fake_phiX_variant_locations.vcf test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.log.contains test-data/phiX.fasta tool-data/gatk_sorted_picard_index.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml |
| diffstat | 13 files changed, 808 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk_macros.xml Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,305 @@ +<macros> + <template name="standard_gatk_options"> + ##start standard gatk options + #if $gatk_param_type.gatk_param_type_selector == "advanced": + #for $pedigree in $gatk_param_type.pedigree: + -p '--pedigree "${pedigree.pedigree_file}"' + #end for + #for $pedigree_string in $gatk_param_type.pedigree_string_repeat: + -p '--pedigreeString "${pedigree_string.pedigree_string}"' + #end for + -p '--pedigreeValidationType "${gatk_param_type.pedigree_validation_type}"' + #for $read_filter in $gatk_param_type.read_filter: + -p '--read_filter "${read_filter.read_filter_type.read_filter_type_selector}" + ###raise Exception( str( dir( $read_filter ) ) ) + #for $name, $param in $read_filter.read_filter_type.iteritems(): + #if $name not in [ "__current_case__", "read_filter_type_selector" ]: + #if hasattr( $param.input, 'truevalue' ): + ${param} + #else: + --${name} "${param}" + #end if + #end if + #end for + ' + #end for + #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_interval_repeat ): + -d "--intervals" "${input_intervals.input_intervals}" "${input_intervals.input_intervals.ext}" "input_intervals_${interval_count}" + #end for + + #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_exclude_interval_repeat ): + -d "--excludeIntervals" "${input_intervals.input_exclude_intervals}" "${input_intervals.input_exclude_intervals.ext}" "input_exlude_intervals_${interval_count}" + #end for + + -p '--interval_set_rule "${gatk_param_type.interval_set_rule}"' + + -p '--downsampling_type "${gatk_param_type.downsampling_type.downsampling_type_selector}"' + #if str( $gatk_param_type.downsampling_type.downsampling_type_selector ) != "NONE": + -p '--${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_type_selector} "${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_value}"' + #end if + -p ' + --baq "${gatk_param_type.baq}" + --baqGapOpenPenalty "${gatk_param_type.baq_gap_open_penalty}" + ${gatk_param_type.use_original_qualities} + --defaultBaseQualities "${gatk_param_type.default_base_qualities}" + --validation_strictness "${gatk_param_type.validation_strictness}" + --interval_merging "${gatk_param_type.interval_merging}" + ${gatk_param_type.disable_experimental_low_memory_sharding} + ${gatk_param_type.non_deterministic_random_seed} + ' + #for $rg_black_list_count, $rg_black_list in enumerate( $gatk_param_type.read_group_black_list_repeat ): + #if $rg_black_list.read_group_black_list_type.read_group_black_list_type_selector == "file": + -d "--read_group_black_list" "${rg_black_list.read_group_black_list_type.read_group_black_list}" "txt" "input_read_group_black_list_${rg_black_list_count}" + #else + -p '--read_group_black_list "${rg_black_list.read_group_black_list_type.read_group_black_list}"' + #end if + #end for + #end if + + #if str( $reference_source.reference_source_selector ) == "history": + -d "-R" "${reference_source.ref_file}" "${reference_source.ref_file.ext}" "gatk_input" + #end if + ##end standard gatk options + </template> + <xml name="gatk_param_type_conditional"> + <conditional name="gatk_param_type"> + <param name="gatk_param_type_selector" type="select" label="Basic or Advanced GATK options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <repeat name="pedigree" title="Pedigree file" help="-ped,--pedigree &lt;pedigree&gt;"> + <param name="pedigree_file" type="data" format="txt" label="Pedigree files for samples"/> + </repeat> + <repeat name="pedigree_string_repeat" title="Pedigree string" help="-pedString,--pedigreeString &lt;pedigreeString&gt;"> + <param name="pedigree_string" type="text" value="" label="Pedigree string for samples"/> + </repeat> + <param name="pedigree_validation_type" type="select" label="How strict should we be in validating the pedigree information" help="-pedValidationType,--pedigreeValidationType &lt;pedigreeValidationType&gt;"> + <option value="STRICT" selected="True">STRICT</option> + <option value="SILENT">SILENT</option> + </param> + <repeat name="read_filter" title="Read Filter" help="-rf,--read_filter &lt;read_filter&gt;"> + <conditional name="read_filter_type"> + <param name="read_filter_type_selector" type="select" label="Read Filter Type"> + <option value="BadCigar">BadCigar</option> + <option value="BadMate">BadMate</option> + <option value="DuplicateRead">DuplicateRead</option> + <option value="FailsVendorQualityCheck">FailsVendorQualityCheck</option> + <option value="MalformedRead">MalformedRead</option> + <option value="MappingQuality">MappingQuality</option> + <option value="MappingQualityUnavailable">MappingQualityUnavailable</option> + <option value="MappingQualityZero">MappingQualityZero</option> + <option value="MateSameStrand">MateSameStrand</option> + <option value="MaxInsertSize">MaxInsertSize</option> + <option value="MaxReadLength" selected="True">MaxReadLength</option> + <option value="MissingReadGroup">MissingReadGroup</option> + <option value="NoOriginalQualityScores">NoOriginalQualityScores</option> + <option value="NotPrimaryAlignment">NotPrimaryAlignment</option> + <option value="Platform454">Platform454</option> + <option value="Platform">Platform</option> + <option value="PlatformUnit">PlatformUnit</option> + <option value="ReadGroupBlackList">ReadGroupBlackList</option> + <option value="ReadName">ReadName</option> + <option value="ReadStrand">ReadStrand</option> + <option value="ReassignMappingQuality">ReassignMappingQuality</option> + <option value="Sample">Sample</option> + <option value="SingleReadGroup">SingleReadGroup</option> + <option value="UnmappedRead">UnmappedRead</option> + </param> + <when value="BadCigar"> + <!-- no extra options --> + </when> + <when value="BadMate"> + <!-- no extra options --> + </when> + <when value="DuplicateRead"> + <!-- no extra options --> + </when> + <when value="FailsVendorQualityCheck"> + <!-- no extra options --> + </when> + <when value="MalformedRead"> + <!-- no extra options --> + </when> + <when value="MappingQuality"> + <param name="min_mapping_quality_score" type="integer" value="10" label="Minimum read mapping quality required to consider a read for calling"/> + </when> + <when value="MappingQualityUnavailable"> + <!-- no extra options --> + </when> + <when value="MappingQualityZero"> + <!-- no extra options --> + </when> + <when value="MateSameStrand"> + <!-- no extra options --> + </when> + <when value="MaxInsertSize"> + <param name="maxInsertSize" type="integer" value="1000000" label="Discard reads with insert size greater than the specified value"/> + </when> + <when value="MaxReadLength"> + <param name="maxReadLength" type="integer" value="76" label="Max Read Length"/> + </when> + <when value="MissingReadGroup"> + <!-- no extra options --> + </when> + <when value="NoOriginalQualityScores"> + <!-- no extra options --> + </when> + <when value="NotPrimaryAlignment"> + <!-- no extra options --> + </when> + <when value="Platform454"> + <!-- no extra options --> + </when> + <when value="Platform"> + <param name="PLFilterName" type="text" value="" label="Discard reads with RG:PL attribute containing this string"/> + </when> + <when value="PlatformUnit"> + <!-- no extra options --> + </when> + <when value="ReadGroupBlackList"> + <!-- no extra options --> + </when> + <when value="ReadName"> + <param name="readName" type="text" value="" label="Filter out all reads except those with this read name"/> + </when> + <when value="ReadStrand"> + <param name="filterPositive" type="boolean" truevalue="--filterPositive" falsevalue="" label="Discard reads on the forward strand"/> + </when> + <when value="ReassignMappingQuality"> + <param name="default_mapping_quality" type="integer" value="60" label="Default read mapping quality to assign to all reads"/> + </when> + <when value="Sample"> + <param name="sample_to_keep" type="text" value="" label="The name of the sample(s) to keep, filtering out all others"/> + </when> + <when value="SingleReadGroup"> + <param name="read_group_to_keep" type="integer" value="76" label="The name of the read group to keep, filtering out all others"/> + </when> + <when value="UnmappedRead"> + <!-- no extra options --> + </when> + </conditional> + </repeat> + <repeat name="input_interval_repeat" title="Operate on Genomic intervals" help="-L,--intervals &lt;intervals&gt;"> + <param name="input_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" /> + </repeat> + <repeat name="input_exclude_interval_repeat" title="Exclude Genomic intervals" help="-XL,--excludeIntervals &lt;excludeIntervals&gt;"> + <param name="input_exclude_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" /> + </repeat> + + <param name="interval_set_rule" type="select" label="Interval set rule" help="-isr,--interval_set_rule &lt;interval_set_rule&gt;"> + <option value="UNION" selected="True">UNION</option> + <option value="INTERSECTION">INTERSECTION</option> + </param> + + <conditional name="downsampling_type"> + <param name="downsampling_type_selector" type="select" label="Type of reads downsampling to employ at a given locus" help="-dt,--downsampling_type &lt;downsampling_type&gt;"> + <option value="NONE" selected="True">NONE</option> + <option value="ALL_READS">ALL_READS</option> + <option value="BY_SAMPLE">BY_SAMPLE</option> + </param> + <when value="NONE"> + <!-- no more options here --> + </when> + <when value="ALL_READS"> + <conditional name="downsample_to_type"> + <param name="downsample_to_type_selector" type="select" label="Downsample method"> + <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option> + <option value="downsample_to_coverage">Downsample by Coverage</option> + </param> + <when value="downsample_to_fraction"> + <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &lt;downsample_to_fraction&gt;"/> + </when> + <when value="downsample_to_coverage"> + <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &lt;downsample_to_coverage&gt;"/> + </when> + </conditional> + </when> + <when value="BY_SAMPLE"> + <conditional name="downsample_to_type"> + <param name="downsample_to_type_selector" type="select" label="Downsample method"> + <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option> + <option value="downsample_to_coverage">Downsample by Coverage</option> + </param> + <when value="downsample_to_fraction"> + <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &lt;downsample_to_fraction&gt;"/> + </when> + <when value="downsample_to_coverage"> + <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &lt;downsample_to_coverage&gt;"/> + </when> + </conditional> + </when> + </conditional> + <param name="baq" type="select" label="Type of BAQ calculation to apply in the engine" help="-baq,--baq &lt;baq&gt;"> + <option value="OFF" selected="True">OFF</option> + <option value="CALCULATE_AS_NECESSARY">CALCULATE_AS_NECESSARY</option> + <option value="RECALCULATE">RECALCULATE</option> + </param> + <param name="baq_gap_open_penalty" type="float" label="BAQ gap open penalty (Phred Scaled)" value="40" help="Default value is 40. 30 is perhaps better for whole genome call sets. -baqGOP,--baqGapOpenPenalty &lt;baqGapOpenPenalty&gt;" /> + <param name="use_original_qualities" type="boolean" truevalue="--useOriginalQualities" falsevalue="" label="Use the original base quality scores from the OQ tag" help="-OQ,--useOriginalQualities" /> + <param name="default_base_qualities" type="integer" label="Value to be used for all base quality scores, when some are missing" value="-1" help="-DBQ,--defaultBaseQualities &lt;defaultBaseQualities&gt;"/> + <param name="validation_strictness" type="select" label="How strict should we be with validation" help="-S,--validation_strictness &lt;validation_strictness&gt;"> + <option value="STRICT" selected="True">STRICT</option> + <option value="LENIENT">LENIENT</option> + <option value="SILENT">SILENT</option> + <!-- <option value="DEFAULT_STRINGENCY">DEFAULT_STRINGENCY</option> listed in docs, but not valid value...--> + </param> + <param name="interval_merging" type="select" label="Interval merging rule" help="-im,--interval_merging &lt;interval_merging&gt;"> + <option value="ALL" selected="True">ALL</option> + <option value="OVERLAPPING_ONLY">OVERLAPPING_ONLY</option> + </param> + + <repeat name="read_group_black_list_repeat" title="Read group black list" help="-rgbl,--read_group_black_list &lt;read_group_black_list&gt;"> + <conditional name="read_group_black_list_type"> + <param name="read_group_black_list_type_selector" type="select" label="Type of reads read group black list"> + <option value="file" selected="True">Filters in file</option> + <option value="text">Specify filters as a string</option> + </param> + <when value="file"> + <param name="read_group_black_list" type="data" format="txt" label="Read group black list file" /> + </when> + <when value="text"> + <param name="read_group_black_list" type="text" value="tag:string" label="Read group black list tag:string" /> + </when> + </conditional> + </repeat> + + <param name="disable_experimental_low_memory_sharding" type="boolean" truevalue="--disable_experimental_low_memory_sharding" falsevalue="" label="Disable experimental low-memory sharding functionality." checked="False" help="--disable_experimental_low_memory_sharding"/> + <param name="non_deterministic_random_seed" type="boolean" truevalue="--nonDeterministicRandomSeed" falsevalue="" label="Makes the GATK behave non deterministically, that is, the random numbers generated will be different in every run" checked="False" help="-ndrs,--nonDeterministicRandomSeed"/> + + </when> + </conditional> + </xml> + <xml name="analysis_type_conditional"> + <conditional name="analysis_param_type"> + <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <yield /> + </when> + </conditional> + </xml> + <xml name="reference_source_selector_param"> + <param name="reference_source_selector" type="select" label="Choose the source for the reference list"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + </xml> + <token name="@CITATION_SECTION@">------ + +**Citation** + +For the underlying tool, please cite `DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May;43(5):491-8. <http://www.ncbi.nlm.nih.gov/pubmed/21478889>`_ + +If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.* + + </token> +</macros> \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk_wrapper.py Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,126 @@ +#!/usr/bin/env python +#Dan Blankenberg + +""" +A wrapper script for running the GenomeAnalysisTK.jar commands. +""" + +import sys, optparse, os, tempfile, subprocess, shutil +from binascii import unhexlify +from string import Template + +GALAXY_EXT_TO_GATK_EXT = { 'gatk_interval':'intervals', 'bam_index':'bam.bai', 'gatk_dbsnp':'dbSNP', 'picard_interval_list':'interval_list' } #items not listed here will use the galaxy extension as-is +GALAXY_EXT_TO_GATK_FILE_TYPE = GALAXY_EXT_TO_GATK_EXT #for now, these are the same, but could be different if needed +DEFAULT_GATK_PREFIX = "gatk_file" +CHUNK_SIZE = 2**20 #1mb + + +def cleanup_before_exit( tmp_dir ): + if tmp_dir and os.path.exists( tmp_dir ): + shutil.rmtree( tmp_dir ) + +def gatk_filename_from_galaxy( galaxy_filename, galaxy_ext, target_dir = None, prefix = None ): + suffix = GALAXY_EXT_TO_GATK_EXT.get( galaxy_ext, galaxy_ext ) + if prefix is None: + prefix = DEFAULT_GATK_PREFIX + if target_dir is None: + target_dir = os.getcwd() + gatk_filename = os.path.join( target_dir, "%s.%s" % ( prefix, suffix ) ) + os.symlink( galaxy_filename, gatk_filename ) + return gatk_filename + +def gatk_filetype_argument_substitution( argument, galaxy_ext ): + return argument % dict( file_type = GALAXY_EXT_TO_GATK_FILE_TYPE.get( galaxy_ext, galaxy_ext ) ) + +def open_file_from_option( filename, mode = 'rb' ): + if filename: + return open( filename, mode = mode ) + return None + +def html_report_from_directory( html_out, dir ): + html_out.write( '<html>\n<head>\n<title>Galaxy - GATK Output</title>\n</head>\n<body>\n<p/>\n<ul>\n' ) + for fname in sorted( os.listdir( dir ) ): + html_out.write( '<li><a href="%s">%s</a></li>\n' % ( fname, fname ) ) + html_out.write( '</ul>\n</body>\n</html>\n' ) + +def index_bam_files( bam_filenames, tmp_dir ): + for bam_filename in bam_filenames: + bam_index_filename = "%s.bai" % bam_filename + if not os.path.exists( bam_index_filename ): + #need to index this bam file + stderr_name = tempfile.NamedTemporaryFile( prefix = "bam_index_stderr" ).name + command = 'samtools index %s %s' % ( bam_filename, bam_index_filename ) + proc = subprocess.Popen( args=command, shell=True, stderr=open( stderr_name, 'wb' ) ) + return_code = proc.wait() + if return_code: + for line in open( stderr_name ): + print >> sys.stderr, line + os.unlink( stderr_name ) #clean up + cleanup_before_exit( tmp_dir ) + raise Exception( "Error indexing BAM file" ) + os.unlink( stderr_name ) #clean up + +def __main__(): + #Parse Command Line + parser = optparse.OptionParser() + parser.add_option( '-p', '--pass_through', dest='pass_through_options', action='append', type="string", help='These options are passed through directly to GATK, without any modification.' ) + parser.add_option( '-o', '--pass_through_options', dest='pass_through_options_encoded', action='append', type="string", help='These options are passed through directly to GATK, with decoding from binascii.unhexlify.' ) + parser.add_option( '-d', '--dataset', dest='datasets', action='append', type="string", nargs=4, help='"-argument" "original_filename" "galaxy_filetype" "name_prefix"' ) + parser.add_option( '', '--max_jvm_heap', dest='max_jvm_heap', action='store', type="string", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value.' ) + parser.add_option( '', '--max_jvm_heap_fraction', dest='max_jvm_heap_fraction', action='store', type="int", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value as a fraction of total physical memory.' ) + parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' ) + parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' ) + parser.add_option( '', '--html_report_from_directory', dest='html_report_from_directory', action='append', type="string", nargs=2, help='"Target HTML File" "Directory"') + (options, args) = parser.parse_args() + + tmp_dir = tempfile.mkdtemp( prefix='tmp-gatk-' ) + if options.pass_through_options: + cmd = ' '.join( options.pass_through_options ) + else: + cmd = '' + if options.pass_through_options_encoded: + cmd = '%s %s' % ( cmd, ' '.join( map( unhexlify, options.pass_through_options_encoded ) ) ) + if options.max_jvm_heap is not None: + cmd = cmd.replace( 'java ', 'java -Xmx%s ' % ( options.max_jvm_heap ), 1 ) + elif options.max_jvm_heap_fraction is not None: + cmd = cmd.replace( 'java ', 'java -XX:DefaultMaxRAMFraction=%s -XX:+UseParallelGC ' % ( options.max_jvm_heap_fraction ), 1 ) + bam_filenames = [] + if options.datasets: + for ( dataset_arg, filename, galaxy_ext, prefix ) in options.datasets: + gatk_filename = gatk_filename_from_galaxy( filename, galaxy_ext, target_dir = tmp_dir, prefix = prefix ) + if dataset_arg: + cmd = '%s %s "%s"' % ( cmd, gatk_filetype_argument_substitution( dataset_arg, galaxy_ext ), gatk_filename ) + if galaxy_ext == "bam": + bam_filenames.append( gatk_filename ) + index_bam_files( bam_filenames, tmp_dir ) + #set up stdout and stderr output options + stdout = open_file_from_option( options.stdout, mode = 'wb' ) + stderr = open_file_from_option( options.stderr, mode = 'wb' ) + #if no stderr file is specified, we'll use our own + if stderr is None: + stderr = tempfile.NamedTemporaryFile( prefix="gatk-stderr-", dir=tmp_dir ) + + proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir ) + return_code = proc.wait() + + if return_code: + stderr_target = sys.stderr + else: + stderr_target = sys.stdout + stderr.flush() + stderr.seek(0) + while True: + chunk = stderr.read( CHUNK_SIZE ) + if chunk: + stderr_target.write( chunk ) + else: + break + stderr.close() + #generate html reports + if options.html_report_from_directory: + for ( html_filename, html_dir ) in options.html_report_from_directory: + html_report_from_directory( open( html_filename, 'wb' ), html_dir ) + + cleanup_before_exit( tmp_dir ) + +if __name__=="__main__": __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/realigner_target_creator.xml Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,165 @@ +<tool id="gatk_realigner_target_creator" name="Realigner Target Creator" version="0.0.4"> + <description>for use in local realignment</description> + <requirements> + <requirement type="package" version="1.4">gatk</requirement> + <requirement type="package" version="0.1.18">samtools</requirement> + </requirements> + <macros> + <import>gatk_macros.xml</import> + </macros> + <command interpreter="python">gatk_wrapper.py + --max_jvm_heap_fraction "1" + --stdout "${output_log}" + -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input" + #if str( $reference_source.input_bam.metadata.bam_index ) != "None": + -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index + #end if + -p 'java + -jar "${JAVA_JAR_PATH}/GenomeAnalysisTK.jar" + -T "RealignerTargetCreator" + -o "${output_interval}" + -et "NO_ET" ##ET no phone home + --num_threads \${GALAXY_SLOTS:-4} + ##-log "${output_log}" ##don't use this to log to file, instead directly capture stdout + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + ' + #set $rod_binding_names = dict() + #for $rod_binding in $rod_bind: + #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom': + #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name + #else + #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector + #end if + #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1 + -d "-known:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}" + #end for + + #include source=$standard_gatk_options# + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + --minReadsAtLocus "${analysis_param_type.minReadsAtLocus}" + --windowSize "${analysis_param_type.windowSize}" + --mismatchFraction "${analysis_param_type.mismatchFraction}" + --maxIntervalSize "${analysis_param_type.maxIntervalSize}" + ' + #end if + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;" > + <options from_data_table="gatk_picard_indexes"> + <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> + <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &lt;input_file&gt;" /> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options> + <filter type="data_meta" key="dbkey" ref="input_bam" /> + </options> + </param> + </when> + </conditional> + + <repeat name="rod_bind" title="Binding for reference-ordered data" help="-known,--known &lt;known&gt;"> + <conditional name="rod_bind_type"> + <param name="rod_bind_type_selector" type="select" label="Binding Type"> + <option value="dbsnp" selected="True">dbSNP</option> + <option value="snps">SNPs</option> + <option value="indels">INDELs</option> + <option value="custom">Custom</option> + </param> + <when value="dbsnp"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + </when> + <when value="snps"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + </when> + <when value="indels"> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + </when> + <when value="custom"> + <param name="custom_rod_name" type="text" value="Unknown" label="ROD Name"/> + <param name="input_rod" type="data" format="vcf" label="ROD file" /> + </when> + </conditional> + </repeat> + + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + <param name="windowSize" type="integer" value="10" label="Window size for calculating entropy or SNP clusters (windowSize)" help="-window,--windowSize &lt;windowSize&gt;" /> + <param name="mismatchFraction" type="float" value="0.15" label="Fraction of base qualities needing to mismatch for a position to have high entropy (mismatchFraction)" help="to disable set to <= 0 or > 1 (-mismatch,--mismatchFraction &lt;mismatchFraction&gt;)"/> + <param name="minReadsAtLocus" type="integer" value="4" label="Minimum reads at a locus to enable using the entropy calculation (minReadsAtLocus)" help="-minReads,--minReadsAtLocus &lt;minReadsAtLocus&gt;" /> + <param name="maxIntervalSize" type="integer" value="500" label="Maximum interval size" help="-maxInterval,--maxIntervalSize &lt;maxIntervalSize&gt;" /> + </expand> + </inputs> + <outputs> + <data format="gatk_interval" name="output_interval" label="${tool.name} on ${on_string} (GATK intervals)" /> + <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/fake_phiX_reads_1.bam" ftype="bam" /> + <param name="rod_bind_type_selector" value="dbsnp" /> + <param name="input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="advanced" /> + <param name="windowSize" value="10" /> + <param name="mismatchFraction" value="0.15" /> + <param name="minReadsAtLocus" value="4" /> + <param name="maxIntervalSize" value="500" /> + <output name="output_interval" file="gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval" /> + <output name="output_log" file="gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.log.contains" compare="contains"/> + </test> + </tests> + <help> +**What it does** + +Emits intervals for the Local Indel Realigner to target for cleaning. Ignores 454 reads, MQ0 reads, and reads with consecutive indel operators in the CIGAR string. + +For more information on local realignment around indels using the GATK, see this `tool specific page <http://www.broadinstitute.org/gsa/wiki/index.php/Local_realignment_around_indels>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gsa/wiki/index.php/Best_Practice_Variant_Detection_with_the_GATK_v3>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gsa/wiki/index.php/Frequently_Asked_Questions>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: RealignerTargetCreator accepts an aligned BAM input file. + + +**Outputs** + +The output is in GATK Interval format. + + +Go `here <http://www.broadinstitute.org/gsa/wiki/index.php/Input_files_for_the_GATK>`_ for details on GATK file formats. + +------- + +**Settings**:: + + windowSize window size for calculating entropy or SNP clusters + mismatchFraction fraction of base qualities needing to mismatch for a position to have high entropy; to disable set to <= 0 or > 1 + minReadsAtLocus minimum reads at a locus to enable using the entropy calculation + maxIntervalSize maximum interval size + +@CITATION_SECTION@ + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/a.tab Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,15 @@ +CHR SNP BP A1 TEST NMISS BETA STAT P +1 rs1181876 3671541 T DOMDEV 958 -1.415 -3.326 0.0009161 +1 rs10492923 5092886 C ADD 1007 5.105 4.368 1.382e-05 +1 rs10492923 5092886 C DOMDEV 1007 -5.612 -4.249 2.35e-05 +1 rs10492923 5092886 C GENO_2DF 1007 NA 19.9 4.775e-05 +1 rs1801133 11778965 T ADD 1022 1.23 3.97 7.682e-05 +1 rs1801133 11778965 T GENO_2DF 1022 NA 16.07 0.0003233 +1 rs1361912 12663121 A ADD 1021 12.69 4.093 4.596e-05 +1 rs1361912 12663121 A DOMDEV 1021 -12.37 -3.945 8.533e-05 +1 rs1361912 12663121 A GENO_2DF 1021 NA 17.05 0.0001982 +1 rs1009806 19373138 G ADD 1021 -1.334 -3.756 0.0001826 +1 rs1009806 19373138 G GENO_2DF 1021 NA 19.36 6.244e-05 +1 rs873654 29550948 A DOMDEV 1012 1.526 3.6 0.0003339 +1 rs10489527 36800027 C ADD 1016 12.67 4.114 4.211e-05 +1 rs10489527 36800027 C DOMDEV 1016 -13.05 -4.02 6.249e-05
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/fake_phiX_variant_locations.vcf Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,70 @@ +##fileformat=VCFv4.1 +##samtoolsVersion=0.1.18 (r982:295) +##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw read depth"> +##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases"> +##INFO=<ID=MQ,Number=1,Type=Integer,Description="Root-mean-square mapping quality of covering reads"> +##INFO=<ID=FQ,Number=1,Type=Float,Description="Phred probability of all samples being the same"> +##INFO=<ID=AF1,Number=1,Type=Float,Description="Max-likelihood estimate of the first ALT allele frequency (assuming HWE)"> +##INFO=<ID=AC1,Number=1,Type=Float,Description="Max-likelihood estimate of the first ALT allele count (no HWE assumption)"> +##INFO=<ID=G3,Number=3,Type=Float,Description="ML estimate of genotype frequencies"> +##INFO=<ID=HWE,Number=1,Type=Float,Description="Chi^2 based HWE test P-value based on G3"> +##INFO=<ID=CLR,Number=1,Type=Integer,Description="Log ratio of genotype likelihoods with and without the constraint"> +##INFO=<ID=UGT,Number=1,Type=String,Description="The most probable unconstrained genotype configuration in the trio"> +##INFO=<ID=CGT,Number=1,Type=String,Description="The most probable constrained genotype configuration in the trio"> +##INFO=<ID=PV4,Number=4,Type=Float,Description="P-values for strand bias, baseQ bias, mapQ bias and tail distance bias"> +##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL."> +##INFO=<ID=PC2,Number=2,Type=Integer,Description="Phred probability of the nonRef allele frequency in group1 samples being larger (,smaller) than in group2."> +##INFO=<ID=PCHI2,Number=1,Type=Float,Description="Posterior weighted chi^2 P-value for testing the association between group1 and group2 samples."> +##INFO=<ID=QCHI2,Number=1,Type=Integer,Description="Phred scaled PCHI2."> +##INFO=<ID=PR,Number=1,Type=Integer,Description="# permutations yielding a smaller PCHI2."> +##INFO=<ID=VDB,Number=1,Type=Float,Description="Variant Distance Bias"> +##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> +##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality"> +##FORMAT=<ID=GL,Number=3,Type=Float,Description="Likelihoods for RR,RA,AA genotypes (R=ref,A=alt)"> +##FORMAT=<ID=DP,Number=1,Type=Integer,Description="# high-quality bases"> +##FORMAT=<ID=SP,Number=1,Type=Integer,Description="Phred-scaled strand bias P-value"> +##FORMAT=<ID=PL,Number=G,Type=Integer,Description="List of Phred-scaled genotype likelihoods"> +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A Fake phiX Sample +phiX174 1411 . A . 28.2 . DP=1;;AC1=2;FQ=-30 PL 0 +phiX174 1412 . G . 28.2 . DP=3;;AC1=2;FQ=-30 PL 0 +phiX174 1413 . C . 28.2 . DP=5;;AC1=2;FQ=-30 PL 0 +phiX174 1414 . G . 28.2 . DP=6;;AC1=2;FQ=-30 PL 0 +phiX174 1415 . C . 28.2 . DP=7;;AC1=2;FQ=-30 PL 0 +phiX174 1416 . C . 28.2 . DP=8;;AC1=2;FQ=-30 PL 0 +phiX174 1417 . G . 28.2 . DP=9;;AC1=2;FQ=-30 PL 0 +phiX174 1418 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1419 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1420 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1421 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1422 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1423 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1424 . C . 28.2 . DP=10;VDB=0.0005;;AC1=2;FQ=-30 PL 0 +phiX174 1425 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1426 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1427 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1428 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1429 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1430 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1431 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1432 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1433 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1434 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1435 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1436 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1437 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1438 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1439 . G . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1440 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1441 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1442 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1443 . A . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1444 . C . 28.2 . DP=7;;AC1=2;FQ=-30 PL 0 +phiX174 1445 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1446 . C . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1447 . T . 28.2 . DP=10;;AC1=2;FQ=-30 PL 0 +phiX174 1448 . A . 28.2 . DP=8;;AC1=2;FQ=-30 PL 0 +phiX174 1449 . A . 28.2 . DP=6;;AC1=2;FQ=-30 PL 0 +phiX174 1450 . T . 28.2 . DP=4;;AC1=2;FQ=-30 PL 0 +phiX174 1451 . G . 28.2 . DP=3;;AC1=2;FQ=-30 PL 0 +phiX174 1452 . A . 28.2 . DP=2;;AC1=2;FQ=-30 PL 0 +phiX174 1453 . G . 28.2 . DP=1;;AC1=2;FQ=-30 PL 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,1 @@ +phiX174:1446-1447
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.log.contains Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,4 @@ +GenomeAnalysisEngine - Strictness is SILENT +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Total runtime +TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%) \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX.fasta Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/gatk_sorted_picard_index.loc.sample Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,26 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Picard dict and associated files. You will need +#to create these data files and then create a picard_index.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The picard_index.loc +#file has this format (longer white space is the TAB character): +# +#<unique_build_id> <dbkey> <display_name> <fasta_file_path> +# +#So, for example, if you had hg18 indexed and stored in +#/depot/data2/galaxy/srma/hg18/, +#then the srma_index.loc entry would look like this: +# +#hg18 hg18 hg18 Pretty /depot/data2/galaxy/picard/hg18/hg18.fa +# +#and your /depot/data2/galaxy/srma/hg18/ directory +#would contain the following three files: +#hg18.fa +#hg18.dict +#hg18.fa.fai +# +#The dictionary file for each reference (ex. hg18.dict) must be +#created via Picard (http://picard.sourceforge.net). Note that +#the dict file does not have the .fa extension although the +#path list in the loc file does include it. +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Location of Picard dict files valid for GATK --> + <table name="gatk_picard_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/gatk_sorted_picard_index.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Tue Apr 01 10:49:33 2014 -0400 @@ -0,0 +1,9 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="gatk" version="1.4"> + <repository changeset_revision="ec95ec570854" name="package_gatk_1_4" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" /> + </package> + <package name="samtools" version="0.1.18"> + <repository changeset_revision="171cd8bc208d" name="package_samtools_0_1_18" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>