Mercurial > repos > devteam > samtools_stats
changeset 0:0d71d9467847 draft
Uploaded
| author | devteam |
|---|---|
| date | Wed, 22 Apr 2015 10:29:35 -0400 |
| parents | |
| children | 8cfc17e27132 |
| files | macros.xml samtools_stats.xml samtools_stats_tool_test_output.html test-data/phiX.bam test-data/samtools_stats_input.bam test-data/samtools_stats_out1.tab test-data/samtools_stats_out2.tab test-data/samtools_stats_out2/gcc.tab test-data/samtools_stats_out2/mpc.tab test-data/samtools_stats_out2/sn.tab test-data/samtools_stats_ref.fa tool-data/fasta_indexes.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml |
| diffstat | 14 files changed, 3831 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,70 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package" version="1.2">samtools</requirement> + <yield/> + </requirements> + </xml> + <xml name="citations"> + <citations> + <citation type="bibtex"> + @misc{SAM_def, + title={Definition of SAM/BAM format}, + url = {https://samtools.github.io/hts-specs/SAMv1.pdf},} + </citation> + <citation type="doi">10.1093/bioinformatics/btp352</citation> + <citation type="doi">10.1093/bioinformatics/btr076</citation> + <citation type="doi">10.1093/bioinformatics/btr509</citation> + <citation type="bibtex"> + @misc{Danecek_et_al, + Author={Danecek, P., Schiffels, S., Durbin, R.}, + title={Multiallelic calling model in bcftools (-m)}, + url = {http://samtools.github.io/bcftools/call-m.pdf},} + </citation> + <citation type="bibtex"> + @misc{Durbin_VCQC, + Author={Durbin, R.}, + title={Segregation based metric for variant call QC}, + url = {http://samtools.github.io/bcftools/rd-SegBias.pdf},} + </citation> + <citation type="bibtex"> + @misc{Li_SamMath, + Author={Li, H.}, + title={Mathematical Notes on SAMtools Algorithms}, + url = {http://www.broadinstitute.org/gatk/media/docs/Samtools.pdf},} + </citation> + <citation type="bibtex"> + @misc{SamTools_github, + title={SAMTools GitHub page}, + url = {https://github.com/samtools/samtools},} + </citation> + </citations> + </xml> + <xml name="version_command"> + <version_command>samtools --version | head -n 1 | awk '{ print $2 }'</version_command> + </xml> + <xml name="stdio"> + <stdio> + <exit_code range="1:" level="fatal" description="Error" /> + </stdio> + </xml> + <token name="@no-chrom-options@"> +----- + +.. class:: warningmark + +**No options available? How to re-detect metadata** + +If you see a "No options available" within the "**Select references (chromosomes and contigs) you would like to restrict bam to**" drop down, you need to re-detect metadata for the dataset you are trying to process. To do this follow these steps: + +1. Click on the **pencil** icon adjacent to the dataset in the history +2. A new menu will appear in the center pane of the interface +3. Click **Datatype** tab +4. Set **New Type** to **BAM** +5. Click **Save** + +The medatada will be re-detected and you will be able to see the list of reference sequences in the "**Select references (chromosomes and contigs) you would like to restrict bam to**" drop-down. + + </token> + +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_stats.xml Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,296 @@ +<tool id="samtools_stats" name="Stats" version="2.0"> + <description>generate statistics for BAM dataset</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"></expand> + <expand macro="stdio"></expand> + <expand macro="version_command"></expand> + <command><![CDATA[ + #if $use_reference.use_ref_selector == "yes": + #if $use_reference.reference_source.reference_source_selector == "history": + ln -s "${use_reference.reference_source.ref_file}" && samtools faidx `basename "${use_reference.reference_source.ref_file}"` && samtools stats + #else: + samtools stats + #end if + #else: + samtools stats + #end if + "${input_file}" + --coverage ${coverage_min},${coverage_max},${coverage_step} + ${remove_dups} + #if str( $filter_by_flags.filter_flags ) == "filter": + #if $filter_by_flags.require_flags: + --required-flag ${sum([int(flag) for flag in str($filter_by_flags.require_flags).split(',')])} + #end if + #if $filter_by_flags.exclude_flags: + --filtering-flag ${sum([int(flag) for flag in str($filter_by_flags.exclude_flags).split(',')])} + #end if + #end if + --GC-depth ${gc_depth} + --insert-size ${insert_size} + + ## The code below is commented out because using -I/--id options causes the following exception + ## Samtools-htslib: init_group_id() header parsing not yet implemented + + ##if str($read_group) != "": + ## -I "${read_group}" + ##end if + + #if str($read_length) != "0": + --read-length "${read_length}" + #end if + --most-inserts ${most_inserts} + --trim-quality ${trim_quality} + #if $use_reference.use_ref_selector == "yes": + #if $use_reference.reference_source.reference_source_selector != "history": + --ref-seq "${use_reference.reference_source.ref_file.fields.path}" + #else: + --ref-seq "${use_reference.reference_source.ref_file}" + #end if + #end if + > "${output}" + #if $split_output.split_output_selector == "yes": + #set outputs_to_split = str($split_output.generate_tables).split(',') + && mkdir split && echo ${split_output.generate_tables} && + + #if 'sn' in $outputs_to_split: + echo "# Summary Numbers\n" > "split/Summary numbers.tab" && + grep -q ^SN "${output}" ; if [ $? = 0 ] ; then grep ^SN "${output}" | cut -f 2- >> "split/Summary numbers.tab" ; fi && + #end if + + #if 'ffq' in $outputs_to_split: + echo "# Columns correspond to qualities and rows to cycles. First column is the cycle number\n" > "split/First Fragment Qualities.tab" && + grep -q ^FFQ "${output}" ; if [ $? = 0 ] ; then grep ^FFQ "${output}" | cut -f 2- >> "split/First Fragment Qualities.tab" ; fi && + #end if + + #if 'lfq' in $outputs_to_split: + echo "# Columns correspond to qualities and rows to cycles. First column is the cycle number" > "split/Last Fragment Qualities.tab" && + grep -q ^LFQ "${output}" ; if [ $? = 0 ] ; then grep ^LFQ "${output}" | cut -f 2- >> "split/Last Fragment Qualities.tab" ; fi && + #end if + + #if 'mpc' in $outputs_to_split: + echo "# Columns correspond to qualities, rows to cycles. First column is the cycle number, second is the number of N's and the rest is the number of mismatches" > "split/Mismatches per cycle.tab" && + grep -q ^MPC "${output}" ; if [ $? = 0 ] ; then grep ^MPC "${output}" | cut -f 2- >> "split/Mismatches per cycle.tab" ; fi && + #end if + + #if 'gcf' in $outputs_to_split: + echo "# GC Content of first fragments" > "split/GC Content of first fragments.tab" && + grep -q ^GCF "${output}" ; if [ $? = 0 ] ; then grep ^GCF "${output}" | cut -f 2- >> "split/GC Content of first fragments.tab" ; fi && + #end if + + #if 'gcl' in $outputs_to_split: + echo "# GC Content of last fragments" > "split/GC Content of last fragments.tab" && + grep -q ^GCL "${output}" ; if [ $? = 0 ] ; then grep ^GCL "${output}" | cut -f 2- >> "split/GC Content of last fragments.tab" ; fi && + #end if + + #if 'gcc' in $outputs_to_split: + echo "# ACGT content per cycle. The columns are: cycle, and A,C,G,T counts (percent)" > "split/ACGT content per cycle.tab" && + grep -q ^GCC "${output}" ; if [ $? = 0 ] ; then grep ^GCC "${output}" | cut -f 2- >> "split/ACGT content per cycle.tab" ; fi && + #end if + + #if 'is' in $outputs_to_split: + echo "# Insert sizes. The columns are: insert size, pairs total, inward oriented pairs, outward oriented pairs, other pairs" > "split/Insert sizes.tab" && + grep -q ^IS "${output}" ; if [ $? = 0 ] ; then grep ^IS "${output}" | cut -f 2- >> "split/Insert sizes.tab" ; fi && + #end if + + #if 'rl' in $outputs_to_split: + echo "# Read lengths. The columns are: read length, count" > "split/Read lengths.tab" && + grep -q ^RL "${output}" ; if [ $? = 0 ] ; then grep ^RL "${output}" | cut -f 2- >> "split/Read lengths.tab" ; fi && + #end if + + #if 'id' in $outputs_to_split: + echo "# Indel distribution. The columns are: length, number of insertions, number of deletions" > "split/Indel distribution.tab" && + grep -q ^ID "${output}" ; if [ $? = 0 ] ; then grep ^ID "${output}" | cut -f 2- >> "split/Indel distribution.tab" ; fi && + #end if + + #if 'ic' in $outputs_to_split: + echo "# Indels per cycle. The columns are: cycle, number of insertions (fwd), .. (rev) , number of deletions (fwd), .. (rev)" > "split/Indels per cycle.tab" && + grep -q ^IC "${output}" ; if [ $? = 0 ] ; then grep ^IC "${output}" | cut -f 2- >> "split/Indels per cycle.tab" ; fi && + #end if + + #if 'cov' in $outputs_to_split: + echo "# Coverage distribution" > "split/Coverage distribution.tab" && + grep -q ^COV "${output}" ; if [ $? = 0 ] ; then grep ^COV "${output}" | cut -f 2- >> "split/Coverage distribution.tab" ; fi && + #end if + + #if 'gcd' in $outputs_to_split: + echo "# GC-depth. The columns are: GC%, unique sequence percentiles, 10th, 25th, 50th, 75th and 90th depth percentile" > "split/GC depth.tab" && + grep -q ^GCD "${output}" ; if [ $? = 0 ] ; then grep ^GCD "${output}" | cut -f 2- >> "split/GC depth.tab" ; fi && + #end if + + ## Unix true command below + + true + + #end if + ]]></command> + <inputs> + <param name="input_file" type="data" format="sam,bam" label="BAM file" /> + <param name="coverage_min" type="integer" value="1" label="Minimum coverage" help="minimum coverage value for --coverage option"/> + <param name="coverage_max" type="integer" value="1000" label="Maximum coverage" help="maximum coverage value for --coverage option"/> + <param name="coverage_step" type="integer" value="1" label="Coverage step" help="step value for --coverage option"/> + <param name="remove_dups" type="boolean" truevalue="--remove-dups" falsevalue="" checked="False" label="Exclude reads marked as duplicates" help="--remove-dups; default = False"/> + <conditional name="split_output"> + <param name="split_output_selector" type="select" label="Output" help="Select between a single output or separate outputs for each statistics"> + <option value="no" selected="True">a single summary file</option> + <option value="yes">separate datasets for each statistics</option> + </param> + <when value="no" /> + <when value="yes"> + <param name="generate_tables" type="select" display="checkboxes" multiple="True" label="Statistics to extract"> + <option value="sn">Summary numbers</option> + <option value="ffq">First Fragment Qualities</option> + <option value="lfq">Last Fragment Qualities</option> + <option value="mpc">Mismatches per cycle</option> + <option value="gcf">GC Content of first fragments</option> + <option value="gcl">GC Content of last fragments</option> + <option value="gcc">ACGT content per cycle</option> + <option value="is">Insert sizes</option> + <option value="rl">Read lengths</option> + <option value="id">Indel distribution</option> + <option value="ic">Indels per cycle</option> + <option value="cov">Coverage distribution</option> + <option value="gcd">GC depth</option> + </param> + </when> + </conditional> + <conditional name="filter_by_flags"> + <param name="filter_flags" type="select" label="Set filter by flags" help="-f and -F options"> + <option value="nofilter" selected="True">Do not filter</option> + <option value="filter">Filter by flags to exclude or require</option> + </param> + <when value="filter"> + <param name="require_flags" type="select" display="checkboxes" multiple="True" label="Require" help="-f"> + <option value="1">Read is paired</option> + <option value="2">Read is mapped in a proper pair</option> + <option value="4">The read is unmapped</option> + <option value="8">The mate is unmapped</option> + <option value="16">Read strand</option> + <option value="32">Mate strand</option> + <option value="64">Read is the first in a pair</option> + <option value="128">Read is the second in a pair</option> + <option value="256">The alignment or this read is not primary</option> + <option value="512">The read fails platform/vendor quality checks</option> + <option value="1024">The read is a PCR or optical duplicate</option> + </param> + <param name="exclude_flags" type="select" display="checkboxes" multiple="True" label="Exclude" help="-F"> + <option value="1">Read is paired</option> + <option value="2">Read is mapped in a proper pair</option> + <option value="4">The read is unmapped</option> + <option value="8">The mate is unmapped</option> + <option value="16">Read strand</option> + <option value="32">Mate strand</option> + <option value="64">Read is the first in a pair</option> + <option value="128">Read is the second in a pair</option> + <option value="256">The alignment or this read is not primary</option> + <option value="512">The read fails platform/vendor quality checks</option> + <option value="1024">The read is a PCR or optical duplicate</option> + </param> + </when> + <when value="nofilter" /> + + </conditional> + <param name="gc_depth" type="float" value="20000" label="GC-depth bin size" help="--GC-depth; decreasing bin size increases memory requirement; default = 20000.0"/> + <param name="insert_size" type="integer" value="8000" label="Maximum insert size" help="--insert-size; default = 8000"/> + + <!-- + + The -I option of samtools stats returns the following message in version 1.2: + + Samtools-htslib: init_group_id() header parsing not yet implemented + Abort trap: 6 + + Because of this the section below is commented out until this stats bug is fixed + + <param name="read_group" type="select" optional="true" label="Limit to a specific read group name" > + <options> + <filter type="data_meta" ref="input_file" key="read_groups" /> + </options> + </param> + + --> + + <param name="read_length" type="integer" value="0" label="Minimum read length to generate statistics for" help="--read-length; default = no cutoff"/> + <param name="most_inserts" type="float" value="0.99" label="Report only the main part of inserts" help="--most-inserts; default = 0.99"/> + <param name="trim_quality" type="integer" value="0" label="BWA trim parameter" help="--trim-quality; default = 0"/> + + <conditional name="use_reference"> + <param name="use_ref_selector" type="select" label="Use reference sequence" help="--ref-seq; required for GC-depth and mismatches-per-cycle calculation"> + <option value="yes">Use reference</option> + <option selected="True" value="no">Do not use reference</option> + </param> + <when value="yes"> + <conditional name="reference_source"> + <param name="reference_source_selector" type="select" label="Choose a reference sequence for GC depth"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + <when value="cached"> + <param name="ref_file" type="select" label="Using genome"> + <options from_data_table="fasta_indexes" /> + <filter type="data_meta" ref="input_file" key="dbkey" column="1" /> + </param> + </when> + <when value="history"> + <param name="ref_file" type="data" format="fasta" label="Using file" /> + </when> + </conditional> + </when> + <when value="no" /> + </conditional> + + </inputs> + + <outputs> + <data format="tabular" name="output" label="${tool.name} on ${on_string}"> + <discover_datasets pattern="(?P<designation>.+)\.tab" ext="tabular" visible="true" directory="split" /> + </data> + </outputs> + <tests> + <test> + <param name="input_file" value="samtools_stats_input.bam" ftype="bam" /> + <param name="use_ref_selector" value="yes" /> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="samtools_stats_ref.fa" ftype="fasta" /> + <output name="output" file="samtools_stats_out1.tab" ftype="tabular" lines_diff="4" /> + </test> + <test> + <param name="input_file" value="samtools_stats_input.bam" ftype="bam" /> + <param name="use_ref_selector" value="yes" /> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="samtools_stats_ref.fa" ftype="fasta" /> + <param name="split_output_selector" value="yes" /> + <param name="generate_tables" value="sn,mpc,gcc" /> + <output name="output" file="samtools_stats_out2.tab" lines_diff="4"> + <discovered_dataset designation="Summary numbers" ftype="tabular" file="samtools_stats_out2/sn.tab" /> + <discovered_dataset designation="ACGT content per cycle" ftype="tabular" file="samtools_stats_out2/gcc.tab" /> + <discovered_dataset designation="Mismatches per cycle" ftype="tabular" file="samtools_stats_out2/mpc.tab" /> + </output> + </test> + </tests> + <help><![CDATA[ +**What it does** + +This tool runs the ``samtools stats`` command. It has the following options:: + + -c, --coverage <int>,<int>,<int> Coverage distribution min,max,step [1,1000,1] + -d, --remove-dups Exclude from statistics reads marked as duplicates + -f, --required-flag <str|int> Required flag, 0 for unset. See also `samtools flags` [0] + -F, --filtering-flag <str|int> Filtering flag, 0 for unset. See also `samtools flags` [0] + --GC-depth <float> the size of GC-depth bins (decreasing bin size increases memory requirement) [2e4] + -h, --help This help message + -i, --insert-size <int> Maximum insert size [8000] + -I, --id <string> Include only listed read group or sample name + -l, --read-length <int> Include in the statistics only reads with the given read length [] + -m, --most-inserts <float> Report only the main part of inserts [0.99] + -q, --trim-quality <int> The BWA trimming parameter [0] + -r, --ref-seq <file> Reference sequence (required for GC-depth and mismatches-per-cycle calculation). Galaxy + will provide options for selecting a reference cached as this Galaxy instance or choosing + one from history. + + + ]]></help> + <expand macro="citations"></expand> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_stats_tool_test_output.html Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,372 @@ +<!DOCTYPE html> +<html lang="en"> + <head> + <meta charset="utf-8"> + <meta http-equiv="X-UA-Compatible" content="IE=edge"> + <meta name="viewport" content="width=device-width, initial-scale=1"> + <title>Tool Test Results (powered by Planemo)</title> + + <!-- Bootstrap --> + <style>/*! + * Bootstrap v3.3.1 (http://getbootstrap.com) + * Copyright 2011-2014 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + *//*! normalize.css v3.0.2 | MIT License | git.io/normalize */html{font-family:sans-serif;-webkit-text-size-adjust:100%;-ms-text-size-adjust:100%}body{margin:0}article,aside,details,figcaption,figure,footer,header,hgroup,main,menu,nav,section,summary{display:block}audio,canvas,progress,video{display:inline-block;vertical-align:baseline}audio:not([controls]){display:none;height:0}[hidden],template{display:none}a{background-color:transparent}a:active,a:hover{outline:0}abbr[title]{border-bottom:1px dotted}b,strong{font-weight:700}dfn{font-style:italic}h1{margin:.67em 0;font-size:2em}mark{color:#000;background:#ff0}small{font-size:80%}sub,sup{position:relative;font-size:75%;line-height:0;vertical-align:baseline}sup{top:-.5em}sub{bottom:-.25em}img{border:0}svg:not(:root){overflow:hidden}figure{margin:1em 40px}hr{height:0;-webkit-box-sizing:content-box;-moz-box-sizing:content-box;box-sizing:content-box}pre{overflow:auto}code,kbd,pre,samp{font-family:monospace,monospace;font-size:1em}button,input,optgroup,select,textarea{margin:0;font:inherit;color:inherit}button{overflow:visible}button,select{text-transform:none}button,html input[type=button],input[type=reset],input[type=submit]{-webkit-appearance:button;cursor:pointer}button[disabled],html input[disabled]{cursor:default}button::-moz-focus-inner,input::-moz-focus-inner{padding:0;border:0}input{line-height:normal}input[type=checkbox],input[type=radio]{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box;padding:0}input[type=number]::-webkit-inner-spin-button,input[type=number]::-webkit-outer-spin-button{height:auto}input[type=search]{-webkit-box-sizing:content-box;-moz-box-sizing:content-box;box-sizing:content-box;-webkit-appearance:textfield}input[type=search]::-webkit-search-cancel-button,input[type=search]::-webkit-search-decoration{-webkit-appearance:none}fieldset{padding:.35em .625em .75em;margin:0 2px;border:1px solid silver}legend{padding:0;border:0}textarea{overflow:auto}optgroup{font-weight:700}table{border-spacing:0;border-collapse:collapse}td,th{padding:0}/*! Source: https://github.com/h5bp/html5-boilerplate/blob/master/src/css/main.css */@media print{*,:before,:after{color:#000!important;text-shadow:none!important;background:transparent!important;-webkit-box-shadow:none!important;box-shadow:none!important}a,a:visited{text-decoration:underline}a[href]:after{content:" (" attr(href) ")"}abbr[title]:after{content:" (" attr(title) ")"}a[href^="#"]:after,a[href^="javascript:"]:after{content:""}pre,blockquote{border:1px solid #999;page-break-inside:avoid}thead{display:table-header-group}tr,img{page-break-inside:avoid}img{max-width:100%!important}p,h2,h3{orphans:3;widows:3}h2,h3{page-break-after:avoid}select{background:#fff!important}.navbar{display:none}.btn>.caret,.dropup>.btn>.caret{border-top-color:#000!important}.label{border:1px solid #000}.table{border-collapse:collapse!important}.table td,.table th{background-color:#fff!important}.table-bordered th,.table-bordered td{border:1px solid #ddd!important}}@font-face{font-family:'Glyphicons Halflings';src:url(../fonts/glyphicons-halflings-regular.eot);src:url(../fonts/glyphicons-halflings-regular.eot?#iefix) format('embedded-opentype'),url(../fonts/glyphicons-halflings-regular.woff) format('woff'),url(../fonts/glyphicons-halflings-regular.ttf) format('truetype'),url(../fonts/glyphicons-halflings-regular.svg#glyphicons_halflingsregular) format('svg')}.glyphicon{position:relative;top:1px;display:inline-block;font-family:'Glyphicons Halflings';font-style:normal;font-weight:400;line-height:1;-webkit-font-smoothing:antialiased;-moz-osx-font-smoothing:grayscale}.glyphicon-asterisk:before{content:"\2a"}.glyphicon-plus:before{content:"\2b"}.glyphicon-euro:before,.glyphicon-eur:before{content:"\20ac"}.glyphicon-minus:before{content:"\2212"}.glyphicon-cloud:before{content:"\2601"}.glyphicon-envelope:before{content:"\2709"}.glyphicon-pencil:before{content:"\270f"}.glyphicon-glass:before{content:"\e001"}.glyphicon-music:before{content:"\e002"}.glyphicon-search:before{content:"\e003"}.glyphicon-heart:before{content:"\e005"}.glyphicon-star:before{content:"\e006"}.glyphicon-star-empty:before{content:"\e007"}.glyphicon-user:before{content:"\e008"}.glyphicon-film:before{content:"\e009"}.glyphicon-th-large:before{content:"\e010"}.glyphicon-th:before{content:"\e011"}.glyphicon-th-list:before{content:"\e012"}.glyphicon-ok:before{content:"\e013"}.glyphicon-remove:before{content:"\e014"}.glyphicon-zoom-in:before{content:"\e015"}.glyphicon-zoom-out:before{content:"\e016"}.glyphicon-off:before{content:"\e017"}.glyphicon-signal:before{content:"\e018"}.glyphicon-cog:before{content:"\e019"}.glyphicon-trash:before{content:"\e020"}.glyphicon-home:before{content:"\e021"}.glyphicon-file:before{content:"\e022"}.glyphicon-time:before{content:"\e023"}.glyphicon-road:before{content:"\e024"}.glyphicon-download-alt:before{content:"\e025"}.glyphicon-download:before{content:"\e026"}.glyphicon-upload:before{content:"\e027"}.glyphicon-inbox:before{content:"\e028"}.glyphicon-play-circle:before{content:"\e029"}.glyphicon-repeat:before{content:"\e030"}.glyphicon-refresh:before{content:"\e031"}.glyphicon-list-alt:before{content:"\e032"}.glyphicon-lock:before{content:"\e033"}.glyphicon-flag:before{content:"\e034"}.glyphicon-headphones:before{content:"\e035"}.glyphicon-volume-off:before{content:"\e036"}.glyphicon-volume-down:before{content:"\e037"}.glyphicon-volume-up:before{content:"\e038"}.glyphicon-qrcode:before{content:"\e039"}.glyphicon-barcode:before{content:"\e040"}.glyphicon-tag:before{content:"\e041"}.glyphicon-tags:before{content:"\e042"}.glyphicon-book:before{content:"\e043"}.glyphicon-bookmark:before{content:"\e044"}.glyphicon-print:before{content:"\e045"}.glyphicon-camera:before{content:"\e046"}.glyphicon-font:before{content:"\e047"}.glyphicon-bold:before{content:"\e048"}.glyphicon-italic:before{content:"\e049"}.glyphicon-text-height:before{content:"\e050"}.glyphicon-text-width:before{content:"\e051"}.glyphicon-align-left:before{content:"\e052"}.glyphicon-align-center:before{content:"\e053"}.glyphicon-align-right:before{content:"\e054"}.glyphicon-align-justify:before{content:"\e055"}.glyphicon-list:before{content:"\e056"}.glyphicon-indent-left:before{content:"\e057"}.glyphicon-indent-right:before{content:"\e058"}.glyphicon-facetime-video:before{content:"\e059"}.glyphicon-picture:before{content:"\e060"}.glyphicon-map-marker:before{content:"\e062"}.glyphicon-adjust:before{content:"\e063"}.glyphicon-tint:before{content:"\e064"}.glyphicon-edit:before{content:"\e065"}.glyphicon-share:before{content:"\e066"}.glyphicon-check:before{content:"\e067"}.glyphicon-move:before{content:"\e068"}.glyphicon-step-backward:before{content:"\e069"}.glyphicon-fast-backward:before{content:"\e070"}.glyphicon-backward:before{content:"\e071"}.glyphicon-play:before{content:"\e072"}.glyphicon-pause:before{content:"\e073"}.glyphicon-stop:before{content:"\e074"}.glyphicon-forward:before{content:"\e075"}.glyphicon-fast-forward:before{content:"\e076"}.glyphicon-step-forward:before{content:"\e077"}.glyphicon-eject:before{content:"\e078"}.glyphicon-chevron-left:before{content:"\e079"}.glyphicon-chevron-right:before{content:"\e080"}.glyphicon-plus-sign:before{content:"\e081"}.glyphicon-minus-sign:before{content:"\e082"}.glyphicon-remove-sign:before{content:"\e083"}.glyphicon-ok-sign:before{content:"\e084"}.glyphicon-question-sign:before{content:"\e085"}.glyphicon-info-sign:before{content:"\e086"}.glyphicon-screenshot:before{content:"\e087"}.glyphicon-remove-circle:before{content:"\e088"}.glyphicon-ok-circle:before{content:"\e089"}.glyphicon-ban-circle:before{content:"\e090"}.glyphicon-arrow-left:before{content:"\e091"}.glyphicon-arrow-right:before{content:"\e092"}.glyphicon-arrow-up:before{content:"\e093"}.glyphicon-arrow-down:before{content:"\e094"}.glyphicon-share-alt:before{content:"\e095"}.glyphicon-resize-full:before{content:"\e096"}.glyphicon-resize-small:before{content:"\e097"}.glyphicon-exclamation-sign:before{content:"\e101"}.glyphicon-gift:before{content:"\e102"}.glyphicon-leaf:before{content:"\e103"}.glyphicon-fire:before{content:"\e104"}.glyphicon-eye-open:before{content:"\e105"}.glyphicon-eye-close:before{content:"\e106"}.glyphicon-warning-sign:before{content:"\e107"}.glyphicon-plane:before{content:"\e108"}.glyphicon-calendar:before{content:"\e109"}.glyphicon-random:before{content:"\e110"}.glyphicon-comment:before{content:"\e111"}.glyphicon-magnet:before{content:"\e112"}.glyphicon-chevron-up:before{content:"\e113"}.glyphicon-chevron-down:before{content:"\e114"}.glyphicon-retweet:before{content:"\e115"}.glyphicon-shopping-cart:before{content:"\e116"}.glyphicon-folder-close:before{content:"\e117"}.glyphicon-folder-open:before{content:"\e118"}.glyphicon-resize-vertical:before{content:"\e119"}.glyphicon-resize-horizontal:before{content:"\e120"}.glyphicon-hdd:before{content:"\e121"}.glyphicon-bullhorn:before{content:"\e122"}.glyphicon-bell:before{content:"\e123"}.glyphicon-certificate:before{content:"\e124"}.glyphicon-thumbs-up:before{content:"\e125"}.glyphicon-thumbs-down:before{content:"\e126"}.glyphicon-hand-right:before{content:"\e127"}.glyphicon-hand-left:before{content:"\e128"}.glyphicon-hand-up:before{content:"\e129"}.glyphicon-hand-down:before{content:"\e130"}.glyphicon-circle-arrow-right:before{content:"\e131"}.glyphicon-circle-arrow-left:before{content:"\e132"}.glyphicon-circle-arrow-up:before{content:"\e133"}.glyphicon-circle-arrow-down:before{content:"\e134"}.glyphicon-globe:before{content:"\e135"}.glyphicon-wrench:before{content:"\e136"}.glyphicon-tasks:before{content:"\e137"}.glyphicon-filter:before{content:"\e138"}.glyphicon-briefcase:before{content:"\e139"}.glyphicon-fullscreen:before{content:"\e140"}.glyphicon-dashboard:before{content:"\e141"}.glyphicon-paperclip:before{content:"\e142"}.glyphicon-heart-empty:before{content:"\e143"}.glyphicon-link:before{content:"\e144"}.glyphicon-phone:before{content:"\e145"}.glyphicon-pushpin:before{content:"\e146"}.glyphicon-usd:before{content:"\e148"}.glyphicon-gbp:before{content:"\e149"}.glyphicon-sort:before{content:"\e150"}.glyphicon-sort-by-alphabet:before{content:"\e151"}.glyphicon-sort-by-alphabet-alt:before{content:"\e152"}.glyphicon-sort-by-order:before{content:"\e153"}.glyphicon-sort-by-order-alt:before{content:"\e154"}.glyphicon-sort-by-attributes:before{content:"\e155"}.glyphicon-sort-by-attributes-alt:before{content:"\e156"}.glyphicon-unchecked:before{content:"\e157"}.glyphicon-expand:before{content:"\e158"}.glyphicon-collapse-down:before{content:"\e159"}.glyphicon-collapse-up:before{content:"\e160"}.glyphicon-log-in:before{content:"\e161"}.glyphicon-flash:before{content:"\e162"}.glyphicon-log-out:before{content:"\e163"}.glyphicon-new-window:before{content:"\e164"}.glyphicon-record:before{content:"\e165"}.glyphicon-save:before{content:"\e166"}.glyphicon-open:before{content:"\e167"}.glyphicon-saved:before{content:"\e168"}.glyphicon-import:before{content:"\e169"}.glyphicon-export:before{content:"\e170"}.glyphicon-send:before{content:"\e171"}.glyphicon-floppy-disk:before{content:"\e172"}.glyphicon-floppy-saved:before{content:"\e173"}.glyphicon-floppy-remove:before{content:"\e174"}.glyphicon-floppy-save:before{content:"\e175"}.glyphicon-floppy-open:before{content:"\e176"}.glyphicon-credit-card:before{content:"\e177"}.glyphicon-transfer:before{content:"\e178"}.glyphicon-cutlery:before{content:"\e179"}.glyphicon-header:before{content:"\e180"}.glyphicon-compressed:before{content:"\e181"}.glyphicon-earphone:before{content:"\e182"}.glyphicon-phone-alt:before{content:"\e183"}.glyphicon-tower:before{content:"\e184"}.glyphicon-stats:before{content:"\e185"}.glyphicon-sd-video:before{content:"\e186"}.glyphicon-hd-video:before{content:"\e187"}.glyphicon-subtitles:before{content:"\e188"}.glyphicon-sound-stereo:before{content:"\e189"}.glyphicon-sound-dolby:before{content:"\e190"}.glyphicon-sound-5-1:before{content:"\e191"}.glyphicon-sound-6-1:before{content:"\e192"}.glyphicon-sound-7-1:before{content:"\e193"}.glyphicon-copyright-mark:before{content:"\e194"}.glyphicon-registration-mark:before{content:"\e195"}.glyphicon-cloud-download:before{content:"\e197"}.glyphicon-cloud-upload:before{content:"\e198"}.glyphicon-tree-conifer:before{content:"\e199"}.glyphicon-tree-deciduous:before{content:"\e200"}*{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}:before,:after{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}html{font-size:10px;-webkit-tap-highlight-color:rgba(0,0,0,0)}body{font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;font-size:14px;line-height:1.42857143;color:#333;background-color:#fff}input,button,select,textarea{font-family:inherit;font-size:inherit;line-height:inherit}a{color:#337ab7;text-decoration:none}a:hover,a:focus{color:#23527c;text-decoration:underline}a:focus{outline:thin dotted;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}figure{margin:0}img{vertical-align:middle}.img-responsive,.thumbnail>img,.thumbnail a>img,.carousel-inner>.item>img,.carousel-inner>.item>a>img{display:block;max-width:100%;height:auto}.img-rounded{border-radius:6px}.img-thumbnail{display:inline-block;max-width:100%;height:auto;padding:4px;line-height:1.42857143;background-color:#fff;border:1px solid #ddd;border-radius:4px;-webkit-transition:all .2s ease-in-out;-o-transition:all .2s ease-in-out;transition:all .2s ease-in-out}.img-circle{border-radius:50%}hr{margin-top:20px;margin-bottom:20px;border:0;border-top:1px solid #eee}.sr-only{position:absolute;width:1px;height:1px;padding:0;margin:-1px;overflow:hidden;clip:rect(0,0,0,0);border:0}.sr-only-focusable:active,.sr-only-focusable:focus{position:static;width:auto;height:auto;margin:0;overflow:visible;clip:auto}h1,h2,h3,h4,h5,h6,.h1,.h2,.h3,.h4,.h5,.h6{font-family:inherit;font-weight:500;line-height:1.1;color:inherit}h1 small,h2 small,h3 small,h4 small,h5 small,h6 small,.h1 small,.h2 small,.h3 small,.h4 small,.h5 small,.h6 small,h1 .small,h2 .small,h3 .small,h4 .small,h5 .small,h6 .small,.h1 .small,.h2 .small,.h3 .small,.h4 .small,.h5 .small,.h6 .small{font-weight:400;line-height:1;color:#777}h1,.h1,h2,.h2,h3,.h3{margin-top:20px;margin-bottom:10px}h1 small,.h1 small,h2 small,.h2 small,h3 small,.h3 small,h1 .small,.h1 .small,h2 .small,.h2 .small,h3 .small,.h3 .small{font-size:65%}h4,.h4,h5,.h5,h6,.h6{margin-top:10px;margin-bottom:10px}h4 small,.h4 small,h5 small,.h5 small,h6 small,.h6 small,h4 .small,.h4 .small,h5 .small,.h5 .small,h6 .small,.h6 .small{font-size:75%}h1,.h1{font-size:36px}h2,.h2{font-size:30px}h3,.h3{font-size:24px}h4,.h4{font-size:18px}h5,.h5{font-size:14px}h6,.h6{font-size:12px}p{margin:0 0 10px}.lead{margin-bottom:20px;font-size:16px;font-weight:300;line-height:1.4}@media (min-width:768px){.lead{font-size:21px}}small,.small{font-size:85%}mark,.mark{padding:.2em;background-color:#fcf8e3}.text-left{text-align:left}.text-right{text-align:right}.text-center{text-align:center}.text-justify{text-align:justify}.text-nowrap{white-space:nowrap}.text-lowercase{text-transform:lowercase}.text-uppercase{text-transform:uppercase}.text-capitalize{text-transform:capitalize}.text-muted{color:#777}.text-primary{color:#337ab7}a.text-primary:hover{color:#286090}.text-success{color:#3c763d}a.text-success:hover{color:#2b542c}.text-info{color:#31708f}a.text-info:hover{color:#245269}.text-warning{color:#8a6d3b}a.text-warning:hover{color:#66512c}.text-danger{color:#a94442}a.text-danger:hover{color:#843534}.bg-primary{color:#fff;background-color:#337ab7}a.bg-primary:hover{background-color:#286090}.bg-success{background-color:#dff0d8}a.bg-success:hover{background-color:#c1e2b3}.bg-info{background-color:#d9edf7}a.bg-info:hover{background-color:#afd9ee}.bg-warning{background-color:#fcf8e3}a.bg-warning:hover{background-color:#f7ecb5}.bg-danger{background-color:#f2dede}a.bg-danger:hover{background-color:#e4b9b9}.page-header{padding-bottom:9px;margin:40px 0 20px;border-bottom:1px solid #eee}ul,ol{margin-top:0;margin-bottom:10px}ul ul,ol ul,ul ol,ol ol{margin-bottom:0}.list-unstyled{padding-left:0;list-style:none}.list-inline{padding-left:0;margin-left:-5px;list-style:none}.list-inline>li{display:inline-block;padding-right:5px;padding-left:5px}dl{margin-top:0;margin-bottom:20px}dt,dd{line-height:1.42857143}dt{font-weight:700}dd{margin-left:0}@media (min-width:768px){.dl-horizontal dt{float:left;width:160px;overflow:hidden;clear:left;text-align:right;text-overflow:ellipsis;white-space:nowrap}.dl-horizontal dd{margin-left:180px}}abbr[title],abbr[data-original-title]{cursor:help;border-bottom:1px dotted #777}.initialism{font-size:90%;text-transform:uppercase}blockquote{padding:10px 20px;margin:0 0 20px;font-size:17.5px;border-left:5px solid #eee}blockquote p:last-child,blockquote ul:last-child,blockquote ol:last-child{margin-bottom:0}blockquote footer,blockquote small,blockquote .small{display:block;font-size:80%;line-height:1.42857143;color:#777}blockquote footer:before,blockquote small:before,blockquote .small:before{content:'\2014 \00A0'}.blockquote-reverse,blockquote.pull-right{padding-right:15px;padding-left:0;text-align:right;border-right:5px solid #eee;border-left:0}.blockquote-reverse footer:before,blockquote.pull-right footer:before,.blockquote-reverse small:before,blockquote.pull-right small:before,.blockquote-reverse .small:before,blockquote.pull-right .small:before{content:''}.blockquote-reverse footer:after,blockquote.pull-right footer:after,.blockquote-reverse small:after,blockquote.pull-right small:after,.blockquote-reverse .small:after,blockquote.pull-right .small:after{content:'\00A0 \2014'}address{margin-bottom:20px;font-style:normal;line-height:1.42857143}code,kbd,pre,samp{font-family:Menlo,Monaco,Consolas,"Courier New",monospace}code{padding:2px 4px;font-size:90%;color:#c7254e;background-color:#f9f2f4;border-radius:4px}kbd{padding:2px 4px;font-size:90%;color:#fff;background-color:#333;border-radius:3px;-webkit-box-shadow:inset 0 -1px 0 rgba(0,0,0,.25);box-shadow:inset 0 -1px 0 rgba(0,0,0,.25)}kbd kbd{padding:0;font-size:100%;font-weight:700;-webkit-box-shadow:none;box-shadow:none}pre{display:block;padding:9.5px;margin:0 0 10px;font-size:13px;line-height:1.42857143;color:#333;word-break:break-all;word-wrap:break-word;background-color:#f5f5f5;border:1px solid #ccc;border-radius:4px}pre code{padding:0;font-size:inherit;color:inherit;white-space:pre-wrap;background-color:transparent;border-radius:0}.pre-scrollable{max-height:340px;overflow-y:scroll}.container{padding-right:15px;padding-left:15px;margin-right:auto;margin-left:auto}@media (min-width:768px){.container{width:750px}}@media (min-width:992px){.container{width:970px}}@media (min-width:1200px){.container{width:1170px}}.container-fluid{padding-right:15px;padding-left:15px;margin-right:auto;margin-left:auto}.row{margin-right:-15px;margin-left:-15px}.col-xs-1,.col-sm-1,.col-md-1,.col-lg-1,.col-xs-2,.col-sm-2,.col-md-2,.col-lg-2,.col-xs-3,.col-sm-3,.col-md-3,.col-lg-3,.col-xs-4,.col-sm-4,.col-md-4,.col-lg-4,.col-xs-5,.col-sm-5,.col-md-5,.col-lg-5,.col-xs-6,.col-sm-6,.col-md-6,.col-lg-6,.col-xs-7,.col-sm-7,.col-md-7,.col-lg-7,.col-xs-8,.col-sm-8,.col-md-8,.col-lg-8,.col-xs-9,.col-sm-9,.col-md-9,.col-lg-9,.col-xs-10,.col-sm-10,.col-md-10,.col-lg-10,.col-xs-11,.col-sm-11,.col-md-11,.col-lg-11,.col-xs-12,.col-sm-12,.col-md-12,.col-lg-12{position:relative;min-height:1px;padding-right:15px;padding-left:15px}.col-xs-1,.col-xs-2,.col-xs-3,.col-xs-4,.col-xs-5,.col-xs-6,.col-xs-7,.col-xs-8,.col-xs-9,.col-xs-10,.col-xs-11,.col-xs-12{float:left}.col-xs-12{width:100%}.col-xs-11{width:91.66666667%}.col-xs-10{width:83.33333333%}.col-xs-9{width:75%}.col-xs-8{width:66.66666667%}.col-xs-7{width:58.33333333%}.col-xs-6{width:50%}.col-xs-5{width:41.66666667%}.col-xs-4{width:33.33333333%}.col-xs-3{width:25%}.col-xs-2{width:16.66666667%}.col-xs-1{width:8.33333333%}.col-xs-pull-12{right:100%}.col-xs-pull-11{right:91.66666667%}.col-xs-pull-10{right:83.33333333%}.col-xs-pull-9{right:75%}.col-xs-pull-8{right:66.66666667%}.col-xs-pull-7{right:58.33333333%}.col-xs-pull-6{right:50%}.col-xs-pull-5{right:41.66666667%}.col-xs-pull-4{right:33.33333333%}.col-xs-pull-3{right:25%}.col-xs-pull-2{right:16.66666667%}.col-xs-pull-1{right:8.33333333%}.col-xs-pull-0{right:auto}.col-xs-push-12{left:100%}.col-xs-push-11{left:91.66666667%}.col-xs-push-10{left:83.33333333%}.col-xs-push-9{left:75%}.col-xs-push-8{left:66.66666667%}.col-xs-push-7{left:58.33333333%}.col-xs-push-6{left:50%}.col-xs-push-5{left:41.66666667%}.col-xs-push-4{left:33.33333333%}.col-xs-push-3{left:25%}.col-xs-push-2{left:16.66666667%}.col-xs-push-1{left:8.33333333%}.col-xs-push-0{left:auto}.col-xs-offset-12{margin-left:100%}.col-xs-offset-11{margin-left:91.66666667%}.col-xs-offset-10{margin-left:83.33333333%}.col-xs-offset-9{margin-left:75%}.col-xs-offset-8{margin-left:66.66666667%}.col-xs-offset-7{margin-left:58.33333333%}.col-xs-offset-6{margin-left:50%}.col-xs-offset-5{margin-left:41.66666667%}.col-xs-offset-4{margin-left:33.33333333%}.col-xs-offset-3{margin-left:25%}.col-xs-offset-2{margin-left:16.66666667%}.col-xs-offset-1{margin-left:8.33333333%}.col-xs-offset-0{margin-left:0}@media (min-width:768px){.col-sm-1,.col-sm-2,.col-sm-3,.col-sm-4,.col-sm-5,.col-sm-6,.col-sm-7,.col-sm-8,.col-sm-9,.col-sm-10,.col-sm-11,.col-sm-12{float:left}.col-sm-12{width:100%}.col-sm-11{width:91.66666667%}.col-sm-10{width:83.33333333%}.col-sm-9{width:75%}.col-sm-8{width:66.66666667%}.col-sm-7{width:58.33333333%}.col-sm-6{width:50%}.col-sm-5{width:41.66666667%}.col-sm-4{width:33.33333333%}.col-sm-3{width:25%}.col-sm-2{width:16.66666667%}.col-sm-1{width:8.33333333%}.col-sm-pull-12{right:100%}.col-sm-pull-11{right:91.66666667%}.col-sm-pull-10{right:83.33333333%}.col-sm-pull-9{right:75%}.col-sm-pull-8{right:66.66666667%}.col-sm-pull-7{right:58.33333333%}.col-sm-pull-6{right:50%}.col-sm-pull-5{right:41.66666667%}.col-sm-pull-4{right:33.33333333%}.col-sm-pull-3{right:25%}.col-sm-pull-2{right:16.66666667%}.col-sm-pull-1{right:8.33333333%}.col-sm-pull-0{right:auto}.col-sm-push-12{left:100%}.col-sm-push-11{left:91.66666667%}.col-sm-push-10{left:83.33333333%}.col-sm-push-9{left:75%}.col-sm-push-8{left:66.66666667%}.col-sm-push-7{left:58.33333333%}.col-sm-push-6{left:50%}.col-sm-push-5{left:41.66666667%}.col-sm-push-4{left:33.33333333%}.col-sm-push-3{left:25%}.col-sm-push-2{left:16.66666667%}.col-sm-push-1{left:8.33333333%}.col-sm-push-0{left:auto}.col-sm-offset-12{margin-left:100%}.col-sm-offset-11{margin-left:91.66666667%}.col-sm-offset-10{margin-left:83.33333333%}.col-sm-offset-9{margin-left:75%}.col-sm-offset-8{margin-left:66.66666667%}.col-sm-offset-7{margin-left:58.33333333%}.col-sm-offset-6{margin-left:50%}.col-sm-offset-5{margin-left:41.66666667%}.col-sm-offset-4{margin-left:33.33333333%}.col-sm-offset-3{margin-left:25%}.col-sm-offset-2{margin-left:16.66666667%}.col-sm-offset-1{margin-left:8.33333333%}.col-sm-offset-0{margin-left:0}}@media (min-width:992px){.col-md-1,.col-md-2,.col-md-3,.col-md-4,.col-md-5,.col-md-6,.col-md-7,.col-md-8,.col-md-9,.col-md-10,.col-md-11,.col-md-12{float:left}.col-md-12{width:100%}.col-md-11{width:91.66666667%}.col-md-10{width:83.33333333%}.col-md-9{width:75%}.col-md-8{width:66.66666667%}.col-md-7{width:58.33333333%}.col-md-6{width:50%}.col-md-5{width:41.66666667%}.col-md-4{width:33.33333333%}.col-md-3{width:25%}.col-md-2{width:16.66666667%}.col-md-1{width:8.33333333%}.col-md-pull-12{right:100%}.col-md-pull-11{right:91.66666667%}.col-md-pull-10{right:83.33333333%}.col-md-pull-9{right:75%}.col-md-pull-8{right:66.66666667%}.col-md-pull-7{right:58.33333333%}.col-md-pull-6{right:50%}.col-md-pull-5{right:41.66666667%}.col-md-pull-4{right:33.33333333%}.col-md-pull-3{right:25%}.col-md-pull-2{right:16.66666667%}.col-md-pull-1{right:8.33333333%}.col-md-pull-0{right:auto}.col-md-push-12{left:100%}.col-md-push-11{left:91.66666667%}.col-md-push-10{left:83.33333333%}.col-md-push-9{left:75%}.col-md-push-8{left:66.66666667%}.col-md-push-7{left:58.33333333%}.col-md-push-6{left:50%}.col-md-push-5{left:41.66666667%}.col-md-push-4{left:33.33333333%}.col-md-push-3{left:25%}.col-md-push-2{left:16.66666667%}.col-md-push-1{left:8.33333333%}.col-md-push-0{left:auto}.col-md-offset-12{margin-left:100%}.col-md-offset-11{margin-left:91.66666667%}.col-md-offset-10{margin-left:83.33333333%}.col-md-offset-9{margin-left:75%}.col-md-offset-8{margin-left:66.66666667%}.col-md-offset-7{margin-left:58.33333333%}.col-md-offset-6{margin-left:50%}.col-md-offset-5{margin-left:41.66666667%}.col-md-offset-4{margin-left:33.33333333%}.col-md-offset-3{margin-left:25%}.col-md-offset-2{margin-left:16.66666667%}.col-md-offset-1{margin-left:8.33333333%}.col-md-offset-0{margin-left:0}}@media (min-width:1200px){.col-lg-1,.col-lg-2,.col-lg-3,.col-lg-4,.col-lg-5,.col-lg-6,.col-lg-7,.col-lg-8,.col-lg-9,.col-lg-10,.col-lg-11,.col-lg-12{float:left}.col-lg-12{width:100%}.col-lg-11{width:91.66666667%}.col-lg-10{width:83.33333333%}.col-lg-9{width:75%}.col-lg-8{width:66.66666667%}.col-lg-7{width:58.33333333%}.col-lg-6{width:50%}.col-lg-5{width:41.66666667%}.col-lg-4{width:33.33333333%}.col-lg-3{width:25%}.col-lg-2{width:16.66666667%}.col-lg-1{width:8.33333333%}.col-lg-pull-12{right:100%}.col-lg-pull-11{right:91.66666667%}.col-lg-pull-10{right:83.33333333%}.col-lg-pull-9{right:75%}.col-lg-pull-8{right:66.66666667%}.col-lg-pull-7{right:58.33333333%}.col-lg-pull-6{right:50%}.col-lg-pull-5{right:41.66666667%}.col-lg-pull-4{right:33.33333333%}.col-lg-pull-3{right:25%}.col-lg-pull-2{right:16.66666667%}.col-lg-pull-1{right:8.33333333%}.col-lg-pull-0{right:auto}.col-lg-push-12{left:100%}.col-lg-push-11{left:91.66666667%}.col-lg-push-10{left:83.33333333%}.col-lg-push-9{left:75%}.col-lg-push-8{left:66.66666667%}.col-lg-push-7{left:58.33333333%}.col-lg-push-6{left:50%}.col-lg-push-5{left:41.66666667%}.col-lg-push-4{left:33.33333333%}.col-lg-push-3{left:25%}.col-lg-push-2{left:16.66666667%}.col-lg-push-1{left:8.33333333%}.col-lg-push-0{left:auto}.col-lg-offset-12{margin-left:100%}.col-lg-offset-11{margin-left:91.66666667%}.col-lg-offset-10{margin-left:83.33333333%}.col-lg-offset-9{margin-left:75%}.col-lg-offset-8{margin-left:66.66666667%}.col-lg-offset-7{margin-left:58.33333333%}.col-lg-offset-6{margin-left:50%}.col-lg-offset-5{margin-left:41.66666667%}.col-lg-offset-4{margin-left:33.33333333%}.col-lg-offset-3{margin-left:25%}.col-lg-offset-2{margin-left:16.66666667%}.col-lg-offset-1{margin-left:8.33333333%}.col-lg-offset-0{margin-left:0}}table{background-color:transparent}caption{padding-top:8px;padding-bottom:8px;color:#777;text-align:left}th{text-align:left}.table{width:100%;max-width:100%;margin-bottom:20px}.table>thead>tr>th,.table>tbody>tr>th,.table>tfoot>tr>th,.table>thead>tr>td,.table>tbody>tr>td,.table>tfoot>tr>td{padding:8px;line-height:1.42857143;vertical-align:top;border-top:1px solid #ddd}.table>thead>tr>th{vertical-align:bottom;border-bottom:2px solid #ddd}.table>caption+thead>tr:first-child>th,.table>colgroup+thead>tr:first-child>th,.table>thead:first-child>tr:first-child>th,.table>caption+thead>tr:first-child>td,.table>colgroup+thead>tr:first-child>td,.table>thead:first-child>tr:first-child>td{border-top:0}.table>tbody+tbody{border-top:2px solid #ddd}.table .table{background-color:#fff}.table-condensed>thead>tr>th,.table-condensed>tbody>tr>th,.table-condensed>tfoot>tr>th,.table-condensed>thead>tr>td,.table-condensed>tbody>tr>td,.table-condensed>tfoot>tr>td{padding:5px}.table-bordered{border:1px solid #ddd}.table-bordered>thead>tr>th,.table-bordered>tbody>tr>th,.table-bordered>tfoot>tr>th,.table-bordered>thead>tr>td,.table-bordered>tbody>tr>td,.table-bordered>tfoot>tr>td{border:1px solid #ddd}.table-bordered>thead>tr>th,.table-bordered>thead>tr>td{border-bottom-width:2px}.table-striped>tbody>tr:nth-child(odd){background-color:#f9f9f9}.table-hover>tbody>tr:hover{background-color:#f5f5f5}table col[class*=col-]{position:static;display:table-column;float:none}table td[class*=col-],table th[class*=col-]{position:static;display:table-cell;float:none}.table>thead>tr>td.active,.table>tbody>tr>td.active,.table>tfoot>tr>td.active,.table>thead>tr>th.active,.table>tbody>tr>th.active,.table>tfoot>tr>th.active,.table>thead>tr.active>td,.table>tbody>tr.active>td,.table>tfoot>tr.active>td,.table>thead>tr.active>th,.table>tbody>tr.active>th,.table>tfoot>tr.active>th{background-color:#f5f5f5}.table-hover>tbody>tr>td.active:hover,.table-hover>tbody>tr>th.active:hover,.table-hover>tbody>tr.active:hover>td,.table-hover>tbody>tr:hover>.active,.table-hover>tbody>tr.active:hover>th{background-color:#e8e8e8}.table>thead>tr>td.success,.table>tbody>tr>td.success,.table>tfoot>tr>td.success,.table>thead>tr>th.success,.table>tbody>tr>th.success,.table>tfoot>tr>th.success,.table>thead>tr.success>td,.table>tbody>tr.success>td,.table>tfoot>tr.success>td,.table>thead>tr.success>th,.table>tbody>tr.success>th,.table>tfoot>tr.success>th{background-color:#dff0d8}.table-hover>tbody>tr>td.success:hover,.table-hover>tbody>tr>th.success:hover,.table-hover>tbody>tr.success:hover>td,.table-hover>tbody>tr:hover>.success,.table-hover>tbody>tr.success:hover>th{background-color:#d0e9c6}.table>thead>tr>td.info,.table>tbody>tr>td.info,.table>tfoot>tr>td.info,.table>thead>tr>th.info,.table>tbody>tr>th.info,.table>tfoot>tr>th.info,.table>thead>tr.info>td,.table>tbody>tr.info>td,.table>tfoot>tr.info>td,.table>thead>tr.info>th,.table>tbody>tr.info>th,.table>tfoot>tr.info>th{background-color:#d9edf7}.table-hover>tbody>tr>td.info:hover,.table-hover>tbody>tr>th.info:hover,.table-hover>tbody>tr.info:hover>td,.table-hover>tbody>tr:hover>.info,.table-hover>tbody>tr.info:hover>th{background-color:#c4e3f3}.table>thead>tr>td.warning,.table>tbody>tr>td.warning,.table>tfoot>tr>td.warning,.table>thead>tr>th.warning,.table>tbody>tr>th.warning,.table>tfoot>tr>th.warning,.table>thead>tr.warning>td,.table>tbody>tr.warning>td,.table>tfoot>tr.warning>td,.table>thead>tr.warning>th,.table>tbody>tr.warning>th,.table>tfoot>tr.warning>th{background-color:#fcf8e3}.table-hover>tbody>tr>td.warning:hover,.table-hover>tbody>tr>th.warning:hover,.table-hover>tbody>tr.warning:hover>td,.table-hover>tbody>tr:hover>.warning,.table-hover>tbody>tr.warning:hover>th{background-color:#faf2cc}.table>thead>tr>td.danger,.table>tbody>tr>td.danger,.table>tfoot>tr>td.danger,.table>thead>tr>th.danger,.table>tbody>tr>th.danger,.table>tfoot>tr>th.danger,.table>thead>tr.danger>td,.table>tbody>tr.danger>td,.table>tfoot>tr.danger>td,.table>thead>tr.danger>th,.table>tbody>tr.danger>th,.table>tfoot>tr.danger>th{background-color:#f2dede}.table-hover>tbody>tr>td.danger:hover,.table-hover>tbody>tr>th.danger:hover,.table-hover>tbody>tr.danger:hover>td,.table-hover>tbody>tr:hover>.danger,.table-hover>tbody>tr.danger:hover>th{background-color:#ebcccc}.table-responsive{min-height:.01%;overflow-x:auto}@media screen and (max-width:767px){.table-responsive{width:100%;margin-bottom:15px;overflow-y:hidden;-ms-overflow-style:-ms-autohiding-scrollbar;border:1px solid #ddd}.table-responsive>.table{margin-bottom:0}.table-responsive>.table>thead>tr>th,.table-responsive>.table>tbody>tr>th,.table-responsive>.table>tfoot>tr>th,.table-responsive>.table>thead>tr>td,.table-responsive>.table>tbody>tr>td,.table-responsive>.table>tfoot>tr>td{white-space:nowrap}.table-responsive>.table-bordered{border:0}.table-responsive>.table-bordered>thead>tr>th:first-child,.table-responsive>.table-bordered>tbody>tr>th:first-child,.table-responsive>.table-bordered>tfoot>tr>th:first-child,.table-responsive>.table-bordered>thead>tr>td:first-child,.table-responsive>.table-bordered>tbody>tr>td:first-child,.table-responsive>.table-bordered>tfoot>tr>td:first-child{border-left:0}.table-responsive>.table-bordered>thead>tr>th:last-child,.table-responsive>.table-bordered>tbody>tr>th:last-child,.table-responsive>.table-bordered>tfoot>tr>th:last-child,.table-responsive>.table-bordered>thead>tr>td:last-child,.table-responsive>.table-bordered>tbody>tr>td:last-child,.table-responsive>.table-bordered>tfoot>tr>td:last-child{border-right:0}.table-responsive>.table-bordered>tbody>tr:last-child>th,.table-responsive>.table-bordered>tfoot>tr:last-child>th,.table-responsive>.table-bordered>tbody>tr:last-child>td,.table-responsive>.table-bordered>tfoot>tr:last-child>td{border-bottom:0}}fieldset{min-width:0;padding:0;margin:0;border:0}legend{display:block;width:100%;padding:0;margin-bottom:20px;font-size:21px;line-height:inherit;color:#333;border:0;border-bottom:1px solid #e5e5e5}label{display:inline-block;max-width:100%;margin-bottom:5px;font-weight:700}input[type=search]{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}input[type=radio],input[type=checkbox]{margin:4px 0 0;margin-top:1px \9;line-height:normal}input[type=file]{display:block}input[type=range]{display:block;width:100%}select[multiple],select[size]{height:auto}input[type=file]:focus,input[type=radio]:focus,input[type=checkbox]:focus{outline:thin dotted;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}output{display:block;padding-top:7px;font-size:14px;line-height:1.42857143;color:#555}.form-control{display:block;width:100%;height:34px;padding:6px 12px;font-size:14px;line-height:1.42857143;color:#555;background-color:#fff;background-image:none;border:1px solid #ccc;border-radius:4px;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075);-webkit-transition:border-color ease-in-out .15s,-webkit-box-shadow ease-in-out .15s;-o-transition:border-color ease-in-out .15s,box-shadow ease-in-out .15s;transition:border-color ease-in-out .15s,box-shadow ease-in-out .15s}.form-control:focus{border-color:#66afe9;outline:0;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 8px rgba(102,175,233,.6);box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 8px rgba(102,175,233,.6)}.form-control::-moz-placeholder{color:#999;opacity:1}.form-control:-ms-input-placeholder{color:#999}.form-control::-webkit-input-placeholder{color:#999}.form-control[disabled],.form-control[readonly],fieldset[disabled] .form-control{cursor:not-allowed;background-color:#eee;opacity:1}textarea.form-control{height:auto}input[type=search]{-webkit-appearance:none}@media screen and (-webkit-min-device-pixel-ratio:0){input[type=date],input[type=time],input[type=datetime-local],input[type=month]{line-height:34px}input[type=date].input-sm,input[type=time].input-sm,input[type=datetime-local].input-sm,input[type=month].input-sm{line-height:30px}input[type=date].input-lg,input[type=time].input-lg,input[type=datetime-local].input-lg,input[type=month].input-lg{line-height:46px}}.form-group{margin-bottom:15px}.radio,.checkbox{position:relative;display:block;margin-top:10px;margin-bottom:10px}.radio label,.checkbox label{min-height:20px;padding-left:20px;margin-bottom:0;font-weight:400;cursor:pointer}.radio input[type=radio],.radio-inline input[type=radio],.checkbox input[type=checkbox],.checkbox-inline input[type=checkbox]{position:absolute;margin-top:4px \9;margin-left:-20px}.radio+.radio,.checkbox+.checkbox{margin-top:-5px}.radio-inline,.checkbox-inline{display:inline-block;padding-left:20px;margin-bottom:0;font-weight:400;vertical-align:middle;cursor:pointer}.radio-inline+.radio-inline,.checkbox-inline+.checkbox-inline{margin-top:0;margin-left:10px}input[type=radio][disabled],input[type=checkbox][disabled],input[type=radio].disabled,input[type=checkbox].disabled,fieldset[disabled] input[type=radio],fieldset[disabled] input[type=checkbox]{cursor:not-allowed}.radio-inline.disabled,.checkbox-inline.disabled,fieldset[disabled] .radio-inline,fieldset[disabled] .checkbox-inline{cursor:not-allowed}.radio.disabled label,.checkbox.disabled label,fieldset[disabled] .radio label,fieldset[disabled] .checkbox label{cursor:not-allowed}.form-control-static{padding-top:7px;padding-bottom:7px;margin-bottom:0}.form-control-static.input-lg,.form-control-static.input-sm{padding-right:0;padding-left:0}.input-sm,.form-group-sm .form-control{height:30px;padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}select.input-sm,select.form-group-sm .form-control{height:30px;line-height:30px}textarea.input-sm,textarea.form-group-sm .form-control,select[multiple].input-sm,select[multiple].form-group-sm .form-control{height:auto}.input-lg,.form-group-lg .form-control{height:46px;padding:10px 16px;font-size:18px;line-height:1.33;border-radius:6px}select.input-lg,select.form-group-lg .form-control{height:46px;line-height:46px}textarea.input-lg,textarea.form-group-lg .form-control,select[multiple].input-lg,select[multiple].form-group-lg .form-control{height:auto}.has-feedback{position:relative}.has-feedback .form-control{padding-right:42.5px}.form-control-feedback{position:absolute;top:0;right:0;z-index:2;display:block;width:34px;height:34px;line-height:34px;text-align:center;pointer-events:none}.input-lg+.form-control-feedback{width:46px;height:46px;line-height:46px}.input-sm+.form-control-feedback{width:30px;height:30px;line-height:30px}.has-success .help-block,.has-success .control-label,.has-success .radio,.has-success .checkbox,.has-success .radio-inline,.has-success .checkbox-inline,.has-success.radio label,.has-success.checkbox label,.has-success.radio-inline label,.has-success.checkbox-inline label{color:#3c763d}.has-success .form-control{border-color:#3c763d;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075)}.has-success .form-control:focus{border-color:#2b542c;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #67b168;box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #67b168}.has-success .input-group-addon{color:#3c763d;background-color:#dff0d8;border-color:#3c763d}.has-success .form-control-feedback{color:#3c763d}.has-warning .help-block,.has-warning .control-label,.has-warning .radio,.has-warning .checkbox,.has-warning .radio-inline,.has-warning .checkbox-inline,.has-warning.radio label,.has-warning.checkbox label,.has-warning.radio-inline label,.has-warning.checkbox-inline label{color:#8a6d3b}.has-warning .form-control{border-color:#8a6d3b;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075)}.has-warning .form-control:focus{border-color:#66512c;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #c0a16b;box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #c0a16b}.has-warning .input-group-addon{color:#8a6d3b;background-color:#fcf8e3;border-color:#8a6d3b}.has-warning .form-control-feedback{color:#8a6d3b}.has-error .help-block,.has-error .control-label,.has-error .radio,.has-error .checkbox,.has-error .radio-inline,.has-error .checkbox-inline,.has-error.radio label,.has-error.checkbox label,.has-error.radio-inline label,.has-error.checkbox-inline label{color:#a94442}.has-error .form-control{border-color:#a94442;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075);box-shadow:inset 0 1px 1px rgba(0,0,0,.075)}.has-error .form-control:focus{border-color:#843534;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #ce8483;box-shadow:inset 0 1px 1px rgba(0,0,0,.075),0 0 6px #ce8483}.has-error .input-group-addon{color:#a94442;background-color:#f2dede;border-color:#a94442}.has-error .form-control-feedback{color:#a94442}.has-feedback label~.form-control-feedback{top:25px}.has-feedback label.sr-only~.form-control-feedback{top:0}.help-block{display:block;margin-top:5px;margin-bottom:10px;color:#737373}@media (min-width:768px){.form-inline .form-group{display:inline-block;margin-bottom:0;vertical-align:middle}.form-inline .form-control{display:inline-block;width:auto;vertical-align:middle}.form-inline .form-control-static{display:inline-block}.form-inline .input-group{display:inline-table;vertical-align:middle}.form-inline .input-group .input-group-addon,.form-inline .input-group .input-group-btn,.form-inline .input-group .form-control{width:auto}.form-inline .input-group>.form-control{width:100%}.form-inline .control-label{margin-bottom:0;vertical-align:middle}.form-inline .radio,.form-inline .checkbox{display:inline-block;margin-top:0;margin-bottom:0;vertical-align:middle}.form-inline .radio label,.form-inline .checkbox label{padding-left:0}.form-inline .radio input[type=radio],.form-inline .checkbox input[type=checkbox]{position:relative;margin-left:0}.form-inline .has-feedback .form-control-feedback{top:0}}.form-horizontal .radio,.form-horizontal .checkbox,.form-horizontal .radio-inline,.form-horizontal .checkbox-inline{padding-top:7px;margin-top:0;margin-bottom:0}.form-horizontal .radio,.form-horizontal .checkbox{min-height:27px}.form-horizontal .form-group{margin-right:-15px;margin-left:-15px}@media (min-width:768px){.form-horizontal .control-label{padding-top:7px;margin-bottom:0;text-align:right}}.form-horizontal .has-feedback .form-control-feedback{right:15px}@media (min-width:768px){.form-horizontal .form-group-lg .control-label{padding-top:14.3px}}@media (min-width:768px){.form-horizontal .form-group-sm .control-label{padding-top:6px}}.btn{display:inline-block;padding:6px 12px;margin-bottom:0;font-size:14px;font-weight:400;line-height:1.42857143;text-align:center;white-space:nowrap;vertical-align:middle;-ms-touch-action:manipulation;touch-action:manipulation;cursor:pointer;-webkit-user-select:none;-moz-user-select:none;-ms-user-select:none;user-select:none;background-image:none;border:1px solid transparent;border-radius:4px}.btn:focus,.btn:active:focus,.btn.active:focus,.btn.focus,.btn:active.focus,.btn.active.focus{outline:thin dotted;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}.btn:hover,.btn:focus,.btn.focus{color:#333;text-decoration:none}.btn:active,.btn.active{background-image:none;outline:0;-webkit-box-shadow:inset 0 3px 5px rgba(0,0,0,.125);box-shadow:inset 0 3px 5px rgba(0,0,0,.125)}.btn.disabled,.btn[disabled],fieldset[disabled] .btn{pointer-events:none;cursor:not-allowed;filter:alpha(opacity=65);-webkit-box-shadow:none;box-shadow:none;opacity:.65}.btn-default{color:#333;background-color:#fff;border-color:#ccc}.btn-default:hover,.btn-default:focus,.btn-default.focus,.btn-default:active,.btn-default.active,.open>.dropdown-toggle.btn-default{color:#333;background-color:#e6e6e6;border-color:#adadad}.btn-default:active,.btn-default.active,.open>.dropdown-toggle.btn-default{background-image:none}.btn-default.disabled,.btn-default[disabled],fieldset[disabled] .btn-default,.btn-default.disabled:hover,.btn-default[disabled]:hover,fieldset[disabled] .btn-default:hover,.btn-default.disabled:focus,.btn-default[disabled]:focus,fieldset[disabled] .btn-default:focus,.btn-default.disabled.focus,.btn-default[disabled].focus,fieldset[disabled] .btn-default.focus,.btn-default.disabled:active,.btn-default[disabled]:active,fieldset[disabled] .btn-default:active,.btn-default.disabled.active,.btn-default[disabled].active,fieldset[disabled] .btn-default.active{background-color:#fff;border-color:#ccc}.btn-default .badge{color:#fff;background-color:#333}.btn-primary{color:#fff;background-color:#337ab7;border-color:#2e6da4}.btn-primary:hover,.btn-primary:focus,.btn-primary.focus,.btn-primary:active,.btn-primary.active,.open>.dropdown-toggle.btn-primary{color:#fff;background-color:#286090;border-color:#204d74}.btn-primary:active,.btn-primary.active,.open>.dropdown-toggle.btn-primary{background-image:none}.btn-primary.disabled,.btn-primary[disabled],fieldset[disabled] .btn-primary,.btn-primary.disabled:hover,.btn-primary[disabled]:hover,fieldset[disabled] .btn-primary:hover,.btn-primary.disabled:focus,.btn-primary[disabled]:focus,fieldset[disabled] .btn-primary:focus,.btn-primary.disabled.focus,.btn-primary[disabled].focus,fieldset[disabled] .btn-primary.focus,.btn-primary.disabled:active,.btn-primary[disabled]:active,fieldset[disabled] .btn-primary:active,.btn-primary.disabled.active,.btn-primary[disabled].active,fieldset[disabled] .btn-primary.active{background-color:#337ab7;border-color:#2e6da4}.btn-primary .badge{color:#337ab7;background-color:#fff}.btn-success{color:#fff;background-color:#5cb85c;border-color:#4cae4c}.btn-success:hover,.btn-success:focus,.btn-success.focus,.btn-success:active,.btn-success.active,.open>.dropdown-toggle.btn-success{color:#fff;background-color:#449d44;border-color:#398439}.btn-success:active,.btn-success.active,.open>.dropdown-toggle.btn-success{background-image:none}.btn-success.disabled,.btn-success[disabled],fieldset[disabled] .btn-success,.btn-success.disabled:hover,.btn-success[disabled]:hover,fieldset[disabled] .btn-success:hover,.btn-success.disabled:focus,.btn-success[disabled]:focus,fieldset[disabled] .btn-success:focus,.btn-success.disabled.focus,.btn-success[disabled].focus,fieldset[disabled] .btn-success.focus,.btn-success.disabled:active,.btn-success[disabled]:active,fieldset[disabled] .btn-success:active,.btn-success.disabled.active,.btn-success[disabled].active,fieldset[disabled] .btn-success.active{background-color:#5cb85c;border-color:#4cae4c}.btn-success .badge{color:#5cb85c;background-color:#fff}.btn-info{color:#fff;background-color:#5bc0de;border-color:#46b8da}.btn-info:hover,.btn-info:focus,.btn-info.focus,.btn-info:active,.btn-info.active,.open>.dropdown-toggle.btn-info{color:#fff;background-color:#31b0d5;border-color:#269abc}.btn-info:active,.btn-info.active,.open>.dropdown-toggle.btn-info{background-image:none}.btn-info.disabled,.btn-info[disabled],fieldset[disabled] .btn-info,.btn-info.disabled:hover,.btn-info[disabled]:hover,fieldset[disabled] .btn-info:hover,.btn-info.disabled:focus,.btn-info[disabled]:focus,fieldset[disabled] .btn-info:focus,.btn-info.disabled.focus,.btn-info[disabled].focus,fieldset[disabled] .btn-info.focus,.btn-info.disabled:active,.btn-info[disabled]:active,fieldset[disabled] .btn-info:active,.btn-info.disabled.active,.btn-info[disabled].active,fieldset[disabled] .btn-info.active{background-color:#5bc0de;border-color:#46b8da}.btn-info .badge{color:#5bc0de;background-color:#fff}.btn-warning{color:#fff;background-color:#f0ad4e;border-color:#eea236}.btn-warning:hover,.btn-warning:focus,.btn-warning.focus,.btn-warning:active,.btn-warning.active,.open>.dropdown-toggle.btn-warning{color:#fff;background-color:#ec971f;border-color:#d58512}.btn-warning:active,.btn-warning.active,.open>.dropdown-toggle.btn-warning{background-image:none}.btn-warning.disabled,.btn-warning[disabled],fieldset[disabled] .btn-warning,.btn-warning.disabled:hover,.btn-warning[disabled]:hover,fieldset[disabled] .btn-warning:hover,.btn-warning.disabled:focus,.btn-warning[disabled]:focus,fieldset[disabled] .btn-warning:focus,.btn-warning.disabled.focus,.btn-warning[disabled].focus,fieldset[disabled] .btn-warning.focus,.btn-warning.disabled:active,.btn-warning[disabled]:active,fieldset[disabled] .btn-warning:active,.btn-warning.disabled.active,.btn-warning[disabled].active,fieldset[disabled] .btn-warning.active{background-color:#f0ad4e;border-color:#eea236}.btn-warning .badge{color:#f0ad4e;background-color:#fff}.btn-danger{color:#fff;background-color:#d9534f;border-color:#d43f3a}.btn-danger:hover,.btn-danger:focus,.btn-danger.focus,.btn-danger:active,.btn-danger.active,.open>.dropdown-toggle.btn-danger{color:#fff;background-color:#c9302c;border-color:#ac2925}.btn-danger:active,.btn-danger.active,.open>.dropdown-toggle.btn-danger{background-image:none}.btn-danger.disabled,.btn-danger[disabled],fieldset[disabled] .btn-danger,.btn-danger.disabled:hover,.btn-danger[disabled]:hover,fieldset[disabled] .btn-danger:hover,.btn-danger.disabled:focus,.btn-danger[disabled]:focus,fieldset[disabled] .btn-danger:focus,.btn-danger.disabled.focus,.btn-danger[disabled].focus,fieldset[disabled] .btn-danger.focus,.btn-danger.disabled:active,.btn-danger[disabled]:active,fieldset[disabled] .btn-danger:active,.btn-danger.disabled.active,.btn-danger[disabled].active,fieldset[disabled] .btn-danger.active{background-color:#d9534f;border-color:#d43f3a}.btn-danger .badge{color:#d9534f;background-color:#fff}.btn-link{font-weight:400;color:#337ab7;border-radius:0}.btn-link,.btn-link:active,.btn-link.active,.btn-link[disabled],fieldset[disabled] .btn-link{background-color:transparent;-webkit-box-shadow:none;box-shadow:none}.btn-link,.btn-link:hover,.btn-link:focus,.btn-link:active{border-color:transparent}.btn-link:hover,.btn-link:focus{color:#23527c;text-decoration:underline;background-color:transparent}.btn-link[disabled]:hover,fieldset[disabled] .btn-link:hover,.btn-link[disabled]:focus,fieldset[disabled] .btn-link:focus{color:#777;text-decoration:none}.btn-lg,.btn-group-lg>.btn{padding:10px 16px;font-size:18px;line-height:1.33;border-radius:6px}.btn-sm,.btn-group-sm>.btn{padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}.btn-xs,.btn-group-xs>.btn{padding:1px 5px;font-size:12px;line-height:1.5;border-radius:3px}.btn-block{display:block;width:100%}.btn-block+.btn-block{margin-top:5px}input[type=submit].btn-block,input[type=reset].btn-block,input[type=button].btn-block{width:100%}.fade{opacity:0;-webkit-transition:opacity .15s linear;-o-transition:opacity .15s linear;transition:opacity .15s linear}.fade.in{opacity:1}.collapse{display:none;visibility:hidden}.collapse.in{display:block;visibility:visible}tr.collapse.in{display:table-row}tbody.collapse.in{display:table-row-group}.collapsing{position:relative;height:0;overflow:hidden;-webkit-transition-timing-function:ease;-o-transition-timing-function:ease;transition-timing-function:ease;-webkit-transition-duration:.35s;-o-transition-duration:.35s;transition-duration:.35s;-webkit-transition-property:height,visibility;-o-transition-property:height,visibility;transition-property:height,visibility}.caret{display:inline-block;width:0;height:0;margin-left:2px;vertical-align:middle;border-top:4px solid;border-right:4px solid transparent;border-left:4px solid transparent}.dropdown{position:relative}.dropdown-toggle:focus{outline:0}.dropdown-menu{position:absolute;top:100%;left:0;z-index:1000;display:none;float:left;min-width:160px;padding:5px 0;margin:2px 0 0;font-size:14px;text-align:left;list-style:none;background-color:#fff;-webkit-background-clip:padding-box;background-clip:padding-box;border:1px solid #ccc;border:1px solid rgba(0,0,0,.15);border-radius:4px;-webkit-box-shadow:0 6px 12px rgba(0,0,0,.175);box-shadow:0 6px 12px rgba(0,0,0,.175)}.dropdown-menu.pull-right{right:0;left:auto}.dropdown-menu .divider{height:1px;margin:9px 0;overflow:hidden;background-color:#e5e5e5}.dropdown-menu>li>a{display:block;padding:3px 20px;clear:both;font-weight:400;line-height:1.42857143;color:#333;white-space:nowrap}.dropdown-menu>li>a:hover,.dropdown-menu>li>a:focus{color:#262626;text-decoration:none;background-color:#f5f5f5}.dropdown-menu>.active>a,.dropdown-menu>.active>a:hover,.dropdown-menu>.active>a:focus{color:#fff;text-decoration:none;background-color:#337ab7;outline:0}.dropdown-menu>.disabled>a,.dropdown-menu>.disabled>a:hover,.dropdown-menu>.disabled>a:focus{color:#777}.dropdown-menu>.disabled>a:hover,.dropdown-menu>.disabled>a:focus{text-decoration:none;cursor:not-allowed;background-color:transparent;background-image:none;filter:progid:DXImageTransform.Microsoft.gradient(enabled=false)}.open>.dropdown-menu{display:block}.open>a{outline:0}.dropdown-menu-right{right:0;left:auto}.dropdown-menu-left{right:auto;left:0}.dropdown-header{display:block;padding:3px 20px;font-size:12px;line-height:1.42857143;color:#777;white-space:nowrap}.dropdown-backdrop{position:fixed;top:0;right:0;bottom:0;left:0;z-index:990}.pull-right>.dropdown-menu{right:0;left:auto}.dropup .caret,.navbar-fixed-bottom .dropdown .caret{content:"";border-top:0;border-bottom:4px solid}.dropup .dropdown-menu,.navbar-fixed-bottom .dropdown .dropdown-menu{top:auto;bottom:100%;margin-bottom:1px}@media (min-width:768px){.navbar-right .dropdown-menu{right:0;left:auto}.navbar-right .dropdown-menu-left{right:auto;left:0}}.btn-group,.btn-group-vertical{position:relative;display:inline-block;vertical-align:middle}.btn-group>.btn,.btn-group-vertical>.btn{position:relative;float:left}.btn-group>.btn:hover,.btn-group-vertical>.btn:hover,.btn-group>.btn:focus,.btn-group-vertical>.btn:focus,.btn-group>.btn:active,.btn-group-vertical>.btn:active,.btn-group>.btn.active,.btn-group-vertical>.btn.active{z-index:2}.btn-group .btn+.btn,.btn-group .btn+.btn-group,.btn-group .btn-group+.btn,.btn-group .btn-group+.btn-group{margin-left:-1px}.btn-toolbar{margin-left:-5px}.btn-toolbar .btn-group,.btn-toolbar .input-group{float:left}.btn-toolbar>.btn,.btn-toolbar>.btn-group,.btn-toolbar>.input-group{margin-left:5px}.btn-group>.btn:not(:first-child):not(:last-child):not(.dropdown-toggle){border-radius:0}.btn-group>.btn:first-child{margin-left:0}.btn-group>.btn:first-child:not(:last-child):not(.dropdown-toggle){border-top-right-radius:0;border-bottom-right-radius:0}.btn-group>.btn:last-child:not(:first-child),.btn-group>.dropdown-toggle:not(:first-child){border-top-left-radius:0;border-bottom-left-radius:0}.btn-group>.btn-group{float:left}.btn-group>.btn-group:not(:first-child):not(:last-child)>.btn{border-radius:0}.btn-group>.btn-group:first-child>.btn:last-child,.btn-group>.btn-group:first-child>.dropdown-toggle{border-top-right-radius:0;border-bottom-right-radius:0}.btn-group>.btn-group:last-child>.btn:first-child{border-top-left-radius:0;border-bottom-left-radius:0}.btn-group .dropdown-toggle:active,.btn-group.open .dropdown-toggle{outline:0}.btn-group>.btn+.dropdown-toggle{padding-right:8px;padding-left:8px}.btn-group>.btn-lg+.dropdown-toggle{padding-right:12px;padding-left:12px}.btn-group.open .dropdown-toggle{-webkit-box-shadow:inset 0 3px 5px rgba(0,0,0,.125);box-shadow:inset 0 3px 5px rgba(0,0,0,.125)}.btn-group.open .dropdown-toggle.btn-link{-webkit-box-shadow:none;box-shadow:none}.btn .caret{margin-left:0}.btn-lg .caret{border-width:5px 5px 0;border-bottom-width:0}.dropup .btn-lg .caret{border-width:0 5px 5px}.btn-group-vertical>.btn,.btn-group-vertical>.btn-group,.btn-group-vertical>.btn-group>.btn{display:block;float:none;width:100%;max-width:100%}.btn-group-vertical>.btn-group>.btn{float:none}.btn-group-vertical>.btn+.btn,.btn-group-vertical>.btn+.btn-group,.btn-group-vertical>.btn-group+.btn,.btn-group-vertical>.btn-group+.btn-group{margin-top:-1px;margin-left:0}.btn-group-vertical>.btn:not(:first-child):not(:last-child){border-radius:0}.btn-group-vertical>.btn:first-child:not(:last-child){border-top-right-radius:4px;border-bottom-right-radius:0;border-bottom-left-radius:0}.btn-group-vertical>.btn:last-child:not(:first-child){border-top-left-radius:0;border-top-right-radius:0;border-bottom-left-radius:4px}.btn-group-vertical>.btn-group:not(:first-child):not(:last-child)>.btn{border-radius:0}.btn-group-vertical>.btn-group:first-child:not(:last-child)>.btn:last-child,.btn-group-vertical>.btn-group:first-child:not(:last-child)>.dropdown-toggle{border-bottom-right-radius:0;border-bottom-left-radius:0}.btn-group-vertical>.btn-group:last-child:not(:first-child)>.btn:first-child{border-top-left-radius:0;border-top-right-radius:0}.btn-group-justified{display:table;width:100%;table-layout:fixed;border-collapse:separate}.btn-group-justified>.btn,.btn-group-justified>.btn-group{display:table-cell;float:none;width:1%}.btn-group-justified>.btn-group .btn{width:100%}.btn-group-justified>.btn-group .dropdown-menu{left:auto}[data-toggle=buttons]>.btn input[type=radio],[data-toggle=buttons]>.btn-group>.btn input[type=radio],[data-toggle=buttons]>.btn input[type=checkbox],[data-toggle=buttons]>.btn-group>.btn input[type=checkbox]{position:absolute;clip:rect(0,0,0,0);pointer-events:none}.input-group{position:relative;display:table;border-collapse:separate}.input-group[class*=col-]{float:none;padding-right:0;padding-left:0}.input-group .form-control{position:relative;z-index:2;float:left;width:100%;margin-bottom:0}.input-group-lg>.form-control,.input-group-lg>.input-group-addon,.input-group-lg>.input-group-btn>.btn{height:46px;padding:10px 16px;font-size:18px;line-height:1.33;border-radius:6px}select.input-group-lg>.form-control,select.input-group-lg>.input-group-addon,select.input-group-lg>.input-group-btn>.btn{height:46px;line-height:46px}textarea.input-group-lg>.form-control,textarea.input-group-lg>.input-group-addon,textarea.input-group-lg>.input-group-btn>.btn,select[multiple].input-group-lg>.form-control,select[multiple].input-group-lg>.input-group-addon,select[multiple].input-group-lg>.input-group-btn>.btn{height:auto}.input-group-sm>.form-control,.input-group-sm>.input-group-addon,.input-group-sm>.input-group-btn>.btn{height:30px;padding:5px 10px;font-size:12px;line-height:1.5;border-radius:3px}select.input-group-sm>.form-control,select.input-group-sm>.input-group-addon,select.input-group-sm>.input-group-btn>.btn{height:30px;line-height:30px}textarea.input-group-sm>.form-control,textarea.input-group-sm>.input-group-addon,textarea.input-group-sm>.input-group-btn>.btn,select[multiple].input-group-sm>.form-control,select[multiple].input-group-sm>.input-group-addon,select[multiple].input-group-sm>.input-group-btn>.btn{height:auto}.input-group-addon,.input-group-btn,.input-group .form-control{display:table-cell}.input-group-addon:not(:first-child):not(:last-child),.input-group-btn:not(:first-child):not(:last-child),.input-group .form-control:not(:first-child):not(:last-child){border-radius:0}.input-group-addon,.input-group-btn{width:1%;white-space:nowrap;vertical-align:middle}.input-group-addon{padding:6px 12px;font-size:14px;font-weight:400;line-height:1;color:#555;text-align:center;background-color:#eee;border:1px solid #ccc;border-radius:4px}.input-group-addon.input-sm{padding:5px 10px;font-size:12px;border-radius:3px}.input-group-addon.input-lg{padding:10px 16px;font-size:18px;border-radius:6px}.input-group-addon input[type=radio],.input-group-addon input[type=checkbox]{margin-top:0}.input-group .form-control:first-child,.input-group-addon:first-child,.input-group-btn:first-child>.btn,.input-group-btn:first-child>.btn-group>.btn,.input-group-btn:first-child>.dropdown-toggle,.input-group-btn:last-child>.btn:not(:last-child):not(.dropdown-toggle),.input-group-btn:last-child>.btn-group:not(:last-child)>.btn{border-top-right-radius:0;border-bottom-right-radius:0}.input-group-addon:first-child{border-right:0}.input-group .form-control:last-child,.input-group-addon:last-child,.input-group-btn:last-child>.btn,.input-group-btn:last-child>.btn-group>.btn,.input-group-btn:last-child>.dropdown-toggle,.input-group-btn:first-child>.btn:not(:first-child),.input-group-btn:first-child>.btn-group:not(:first-child)>.btn{border-top-left-radius:0;border-bottom-left-radius:0}.input-group-addon:last-child{border-left:0}.input-group-btn{position:relative;font-size:0;white-space:nowrap}.input-group-btn>.btn{position:relative}.input-group-btn>.btn+.btn{margin-left:-1px}.input-group-btn>.btn:hover,.input-group-btn>.btn:focus,.input-group-btn>.btn:active{z-index:2}.input-group-btn:first-child>.btn,.input-group-btn:first-child>.btn-group{margin-right:-1px}.input-group-btn:last-child>.btn,.input-group-btn:last-child>.btn-group{margin-left:-1px}.nav{padding-left:0;margin-bottom:0;list-style:none}.nav>li{position:relative;display:block}.nav>li>a{position:relative;display:block;padding:10px 15px}.nav>li>a:hover,.nav>li>a:focus{text-decoration:none;background-color:#eee}.nav>li.disabled>a{color:#777}.nav>li.disabled>a:hover,.nav>li.disabled>a:focus{color:#777;text-decoration:none;cursor:not-allowed;background-color:transparent}.nav .open>a,.nav .open>a:hover,.nav .open>a:focus{background-color:#eee;border-color:#337ab7}.nav .nav-divider{height:1px;margin:9px 0;overflow:hidden;background-color:#e5e5e5}.nav>li>a>img{max-width:none}.nav-tabs{border-bottom:1px solid #ddd}.nav-tabs>li{float:left;margin-bottom:-1px}.nav-tabs>li>a{margin-right:2px;line-height:1.42857143;border:1px solid transparent;border-radius:4px 4px 0 0}.nav-tabs>li>a:hover{border-color:#eee #eee #ddd}.nav-tabs>li.active>a,.nav-tabs>li.active>a:hover,.nav-tabs>li.active>a:focus{color:#555;cursor:default;background-color:#fff;border:1px solid #ddd;border-bottom-color:transparent}.nav-tabs.nav-justified{width:100%;border-bottom:0}.nav-tabs.nav-justified>li{float:none}.nav-tabs.nav-justified>li>a{margin-bottom:5px;text-align:center}.nav-tabs.nav-justified>.dropdown .dropdown-menu{top:auto;left:auto}@media (min-width:768px){.nav-tabs.nav-justified>li{display:table-cell;width:1%}.nav-tabs.nav-justified>li>a{margin-bottom:0}}.nav-tabs.nav-justified>li>a{margin-right:0;border-radius:4px}.nav-tabs.nav-justified>.active>a,.nav-tabs.nav-justified>.active>a:hover,.nav-tabs.nav-justified>.active>a:focus{border:1px solid #ddd}@media (min-width:768px){.nav-tabs.nav-justified>li>a{border-bottom:1px solid #ddd;border-radius:4px 4px 0 0}.nav-tabs.nav-justified>.active>a,.nav-tabs.nav-justified>.active>a:hover,.nav-tabs.nav-justified>.active>a:focus{border-bottom-color:#fff}}.nav-pills>li{float:left}.nav-pills>li>a{border-radius:4px}.nav-pills>li+li{margin-left:2px}.nav-pills>li.active>a,.nav-pills>li.active>a:hover,.nav-pills>li.active>a:focus{color:#fff;background-color:#337ab7}.nav-stacked>li{float:none}.nav-stacked>li+li{margin-top:2px;margin-left:0}.nav-justified{width:100%}.nav-justified>li{float:none}.nav-justified>li>a{margin-bottom:5px;text-align:center}.nav-justified>.dropdown .dropdown-menu{top:auto;left:auto}@media (min-width:768px){.nav-justified>li{display:table-cell;width:1%}.nav-justified>li>a{margin-bottom:0}}.nav-tabs-justified{border-bottom:0}.nav-tabs-justified>li>a{margin-right:0;border-radius:4px}.nav-tabs-justified>.active>a,.nav-tabs-justified>.active>a:hover,.nav-tabs-justified>.active>a:focus{border:1px solid #ddd}@media (min-width:768px){.nav-tabs-justified>li>a{border-bottom:1px solid #ddd;border-radius:4px 4px 0 0}.nav-tabs-justified>.active>a,.nav-tabs-justified>.active>a:hover,.nav-tabs-justified>.active>a:focus{border-bottom-color:#fff}}.tab-content>.tab-pane{display:none;visibility:hidden}.tab-content>.active{display:block;visibility:visible}.nav-tabs .dropdown-menu{margin-top:-1px;border-top-left-radius:0;border-top-right-radius:0}.navbar{position:relative;min-height:50px;margin-bottom:20px;border:1px solid transparent}@media (min-width:768px){.navbar{border-radius:4px}}@media (min-width:768px){.navbar-header{float:left}}.navbar-collapse{padding-right:15px;padding-left:15px;overflow-x:visible;-webkit-overflow-scrolling:touch;border-top:1px solid transparent;-webkit-box-shadow:inset 0 1px 0 rgba(255,255,255,.1);box-shadow:inset 0 1px 0 rgba(255,255,255,.1)}.navbar-collapse.in{overflow-y:auto}@media (min-width:768px){.navbar-collapse{width:auto;border-top:0;-webkit-box-shadow:none;box-shadow:none}.navbar-collapse.collapse{display:block!important;height:auto!important;padding-bottom:0;overflow:visible!important;visibility:visible!important}.navbar-collapse.in{overflow-y:visible}.navbar-fixed-top .navbar-collapse,.navbar-static-top .navbar-collapse,.navbar-fixed-bottom .navbar-collapse{padding-right:0;padding-left:0}}.navbar-fixed-top .navbar-collapse,.navbar-fixed-bottom .navbar-collapse{max-height:340px}@media (max-device-width:480px) and (orientation:landscape){.navbar-fixed-top .navbar-collapse,.navbar-fixed-bottom .navbar-collapse{max-height:200px}}.container>.navbar-header,.container-fluid>.navbar-header,.container>.navbar-collapse,.container-fluid>.navbar-collapse{margin-right:-15px;margin-left:-15px}@media (min-width:768px){.container>.navbar-header,.container-fluid>.navbar-header,.container>.navbar-collapse,.container-fluid>.navbar-collapse{margin-right:0;margin-left:0}}.navbar-static-top{z-index:1000;border-width:0 0 1px}@media (min-width:768px){.navbar-static-top{border-radius:0}}.navbar-fixed-top,.navbar-fixed-bottom{position:fixed;right:0;left:0;z-index:1030}@media (min-width:768px){.navbar-fixed-top,.navbar-fixed-bottom{border-radius:0}}.navbar-fixed-top{top:0;border-width:0 0 1px}.navbar-fixed-bottom{bottom:0;margin-bottom:0;border-width:1px 0 0}.navbar-brand{float:left;height:50px;padding:15px 15px;font-size:18px;line-height:20px}.navbar-brand:hover,.navbar-brand:focus{text-decoration:none}.navbar-brand>img{display:block}@media (min-width:768px){.navbar>.container .navbar-brand,.navbar>.container-fluid .navbar-brand{margin-left:-15px}}.navbar-toggle{position:relative;float:right;padding:9px 10px;margin-top:8px;margin-right:15px;margin-bottom:8px;background-color:transparent;background-image:none;border:1px solid transparent;border-radius:4px}.navbar-toggle:focus{outline:0}.navbar-toggle .icon-bar{display:block;width:22px;height:2px;border-radius:1px}.navbar-toggle .icon-bar+.icon-bar{margin-top:4px}@media (min-width:768px){.navbar-toggle{display:none}}.navbar-nav{margin:7.5px -15px}.navbar-nav>li>a{padding-top:10px;padding-bottom:10px;line-height:20px}@media (max-width:767px){.navbar-nav .open .dropdown-menu{position:static;float:none;width:auto;margin-top:0;background-color:transparent;border:0;-webkit-box-shadow:none;box-shadow:none}.navbar-nav .open .dropdown-menu>li>a,.navbar-nav .open .dropdown-menu .dropdown-header{padding:5px 15px 5px 25px}.navbar-nav .open .dropdown-menu>li>a{line-height:20px}.navbar-nav .open .dropdown-menu>li>a:hover,.navbar-nav .open .dropdown-menu>li>a:focus{background-image:none}}@media (min-width:768px){.navbar-nav{float:left;margin:0}.navbar-nav>li{float:left}.navbar-nav>li>a{padding-top:15px;padding-bottom:15px}}.navbar-form{padding:10px 15px;margin-top:8px;margin-right:-15px;margin-bottom:8px;margin-left:-15px;border-top:1px solid transparent;border-bottom:1px solid transparent;-webkit-box-shadow:inset 0 1px 0 rgba(255,255,255,.1),0 1px 0 rgba(255,255,255,.1);box-shadow:inset 0 1px 0 rgba(255,255,255,.1),0 1px 0 rgba(255,255,255,.1)}@media (min-width:768px){.navbar-form .form-group{display:inline-block;margin-bottom:0;vertical-align:middle}.navbar-form .form-control{display:inline-block;width:auto;vertical-align:middle}.navbar-form .form-control-static{display:inline-block}.navbar-form .input-group{display:inline-table;vertical-align:middle}.navbar-form .input-group .input-group-addon,.navbar-form .input-group .input-group-btn,.navbar-form .input-group .form-control{width:auto}.navbar-form .input-group>.form-control{width:100%}.navbar-form .control-label{margin-bottom:0;vertical-align:middle}.navbar-form .radio,.navbar-form .checkbox{display:inline-block;margin-top:0;margin-bottom:0;vertical-align:middle}.navbar-form .radio label,.navbar-form .checkbox label{padding-left:0}.navbar-form .radio input[type=radio],.navbar-form .checkbox input[type=checkbox]{position:relative;margin-left:0}.navbar-form .has-feedback .form-control-feedback{top:0}}@media (max-width:767px){.navbar-form .form-group{margin-bottom:5px}.navbar-form .form-group:last-child{margin-bottom:0}}@media (min-width:768px){.navbar-form{width:auto;padding-top:0;padding-bottom:0;margin-right:0;margin-left:0;border:0;-webkit-box-shadow:none;box-shadow:none}}.navbar-nav>li>.dropdown-menu{margin-top:0;border-top-left-radius:0;border-top-right-radius:0}.navbar-fixed-bottom .navbar-nav>li>.dropdown-menu{border-top-left-radius:4px;border-top-right-radius:4px;border-bottom-right-radius:0;border-bottom-left-radius:0}.navbar-btn{margin-top:8px;margin-bottom:8px}.navbar-btn.btn-sm{margin-top:10px;margin-bottom:10px}.navbar-btn.btn-xs{margin-top:14px;margin-bottom:14px}.navbar-text{margin-top:15px;margin-bottom:15px}@media (min-width:768px){.navbar-text{float:left;margin-right:15px;margin-left:15px}}@media (min-width:768px){.navbar-left{float:left!important}.navbar-right{float:right!important;margin-right:-15px}.navbar-right~.navbar-right{margin-right:0}}.navbar-default{background-color:#f8f8f8;border-color:#e7e7e7}.navbar-default .navbar-brand{color:#777}.navbar-default .navbar-brand:hover,.navbar-default .navbar-brand:focus{color:#5e5e5e;background-color:transparent}.navbar-default .navbar-text{color:#777}.navbar-default .navbar-nav>li>a{color:#777}.navbar-default .navbar-nav>li>a:hover,.navbar-default .navbar-nav>li>a:focus{color:#333;background-color:transparent}.navbar-default .navbar-nav>.active>a,.navbar-default .navbar-nav>.active>a:hover,.navbar-default .navbar-nav>.active>a:focus{color:#555;background-color:#e7e7e7}.navbar-default .navbar-nav>.disabled>a,.navbar-default .navbar-nav>.disabled>a:hover,.navbar-default .navbar-nav>.disabled>a:focus{color:#ccc;background-color:transparent}.navbar-default .navbar-toggle{border-color:#ddd}.navbar-default .navbar-toggle:hover,.navbar-default .navbar-toggle:focus{background-color:#ddd}.navbar-default .navbar-toggle .icon-bar{background-color:#888}.navbar-default .navbar-collapse,.navbar-default .navbar-form{border-color:#e7e7e7}.navbar-default .navbar-nav>.open>a,.navbar-default .navbar-nav>.open>a:hover,.navbar-default .navbar-nav>.open>a:focus{color:#555;background-color:#e7e7e7}@media (max-width:767px){.navbar-default .navbar-nav .open .dropdown-menu>li>a{color:#777}.navbar-default .navbar-nav .open .dropdown-menu>li>a:hover,.navbar-default .navbar-nav .open .dropdown-menu>li>a:focus{color:#333;background-color:transparent}.navbar-default .navbar-nav .open .dropdown-menu>.active>a,.navbar-default .navbar-nav .open .dropdown-menu>.active>a:hover,.navbar-default .navbar-nav .open .dropdown-menu>.active>a:focus{color:#555;background-color:#e7e7e7}.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a,.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a:hover,.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a:focus{color:#ccc;background-color:transparent}}.navbar-default .navbar-link{color:#777}.navbar-default .navbar-link:hover{color:#333}.navbar-default .btn-link{color:#777}.navbar-default .btn-link:hover,.navbar-default .btn-link:focus{color:#333}.navbar-default .btn-link[disabled]:hover,fieldset[disabled] .navbar-default .btn-link:hover,.navbar-default .btn-link[disabled]:focus,fieldset[disabled] .navbar-default .btn-link:focus{color:#ccc}.navbar-inverse{background-color:#222;border-color:#080808}.navbar-inverse .navbar-brand{color:#9d9d9d}.navbar-inverse .navbar-brand:hover,.navbar-inverse .navbar-brand:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-text{color:#9d9d9d}.navbar-inverse .navbar-nav>li>a{color:#9d9d9d}.navbar-inverse .navbar-nav>li>a:hover,.navbar-inverse .navbar-nav>li>a:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-nav>.active>a,.navbar-inverse .navbar-nav>.active>a:hover,.navbar-inverse .navbar-nav>.active>a:focus{color:#fff;background-color:#080808}.navbar-inverse .navbar-nav>.disabled>a,.navbar-inverse .navbar-nav>.disabled>a:hover,.navbar-inverse .navbar-nav>.disabled>a:focus{color:#444;background-color:transparent}.navbar-inverse .navbar-toggle{border-color:#333}.navbar-inverse .navbar-toggle:hover,.navbar-inverse .navbar-toggle:focus{background-color:#333}.navbar-inverse .navbar-toggle .icon-bar{background-color:#fff}.navbar-inverse .navbar-collapse,.navbar-inverse .navbar-form{border-color:#101010}.navbar-inverse .navbar-nav>.open>a,.navbar-inverse .navbar-nav>.open>a:hover,.navbar-inverse .navbar-nav>.open>a:focus{color:#fff;background-color:#080808}@media (max-width:767px){.navbar-inverse .navbar-nav .open .dropdown-menu>.dropdown-header{border-color:#080808}.navbar-inverse .navbar-nav .open .dropdown-menu .divider{background-color:#080808}.navbar-inverse .navbar-nav .open .dropdown-menu>li>a{color:#9d9d9d}.navbar-inverse .navbar-nav .open .dropdown-menu>li>a:hover,.navbar-inverse .navbar-nav .open .dropdown-menu>li>a:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a,.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a:hover,.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a:focus{color:#fff;background-color:#080808}.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a,.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a:hover,.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a:focus{color:#444;background-color:transparent}}.navbar-inverse .navbar-link{color:#9d9d9d}.navbar-inverse .navbar-link:hover{color:#fff}.navbar-inverse .btn-link{color:#9d9d9d}.navbar-inverse .btn-link:hover,.navbar-inverse .btn-link:focus{color:#fff}.navbar-inverse .btn-link[disabled]:hover,fieldset[disabled] .navbar-inverse .btn-link:hover,.navbar-inverse .btn-link[disabled]:focus,fieldset[disabled] .navbar-inverse .btn-link:focus{color:#444}.breadcrumb{padding:8px 15px;margin-bottom:20px;list-style:none;background-color:#f5f5f5;border-radius:4px}.breadcrumb>li{display:inline-block}.breadcrumb>li+li:before{padding:0 5px;color:#ccc;content:"/\00a0"}.breadcrumb>.active{color:#777}.pagination{display:inline-block;padding-left:0;margin:20px 0;border-radius:4px}.pagination>li{display:inline}.pagination>li>a,.pagination>li>span{position:relative;float:left;padding:6px 12px;margin-left:-1px;line-height:1.42857143;color:#337ab7;text-decoration:none;background-color:#fff;border:1px solid #ddd}.pagination>li:first-child>a,.pagination>li:first-child>span{margin-left:0;border-top-left-radius:4px;border-bottom-left-radius:4px}.pagination>li:last-child>a,.pagination>li:last-child>span{border-top-right-radius:4px;border-bottom-right-radius:4px}.pagination>li>a:hover,.pagination>li>span:hover,.pagination>li>a:focus,.pagination>li>span:focus{color:#23527c;background-color:#eee;border-color:#ddd}.pagination>.active>a,.pagination>.active>span,.pagination>.active>a:hover,.pagination>.active>span:hover,.pagination>.active>a:focus,.pagination>.active>span:focus{z-index:2;color:#fff;cursor:default;background-color:#337ab7;border-color:#337ab7}.pagination>.disabled>span,.pagination>.disabled>span:hover,.pagination>.disabled>span:focus,.pagination>.disabled>a,.pagination>.disabled>a:hover,.pagination>.disabled>a:focus{color:#777;cursor:not-allowed;background-color:#fff;border-color:#ddd}.pagination-lg>li>a,.pagination-lg>li>span{padding:10px 16px;font-size:18px}.pagination-lg>li:first-child>a,.pagination-lg>li:first-child>span{border-top-left-radius:6px;border-bottom-left-radius:6px}.pagination-lg>li:last-child>a,.pagination-lg>li:last-child>span{border-top-right-radius:6px;border-bottom-right-radius:6px}.pagination-sm>li>a,.pagination-sm>li>span{padding:5px 10px;font-size:12px}.pagination-sm>li:first-child>a,.pagination-sm>li:first-child>span{border-top-left-radius:3px;border-bottom-left-radius:3px}.pagination-sm>li:last-child>a,.pagination-sm>li:last-child>span{border-top-right-radius:3px;border-bottom-right-radius:3px}.pager{padding-left:0;margin:20px 0;text-align:center;list-style:none}.pager li{display:inline}.pager li>a,.pager li>span{display:inline-block;padding:5px 14px;background-color:#fff;border:1px solid #ddd;border-radius:15px}.pager li>a:hover,.pager li>a:focus{text-decoration:none;background-color:#eee}.pager .next>a,.pager .next>span{float:right}.pager .previous>a,.pager .previous>span{float:left}.pager .disabled>a,.pager .disabled>a:hover,.pager .disabled>a:focus,.pager .disabled>span{color:#777;cursor:not-allowed;background-color:#fff}.label{display:inline;padding:.2em .6em .3em;font-size:75%;font-weight:700;line-height:1;color:#fff;text-align:center;white-space:nowrap;vertical-align:baseline;border-radius:.25em}a.label:hover,a.label:focus{color:#fff;text-decoration:none;cursor:pointer}.label:empty{display:none}.btn .label{position:relative;top:-1px}.label-default{background-color:#777}.label-default[href]:hover,.label-default[href]:focus{background-color:#5e5e5e}.label-primary{background-color:#337ab7}.label-primary[href]:hover,.label-primary[href]:focus{background-color:#286090}.label-success{background-color:#5cb85c}.label-success[href]:hover,.label-success[href]:focus{background-color:#449d44}.label-info{background-color:#5bc0de}.label-info[href]:hover,.label-info[href]:focus{background-color:#31b0d5}.label-warning{background-color:#f0ad4e}.label-warning[href]:hover,.label-warning[href]:focus{background-color:#ec971f}.label-danger{background-color:#d9534f}.label-danger[href]:hover,.label-danger[href]:focus{background-color:#c9302c}.badge{display:inline-block;min-width:10px;padding:3px 7px;font-size:12px;font-weight:700;line-height:1;color:#fff;text-align:center;white-space:nowrap;vertical-align:baseline;background-color:#777;border-radius:10px}.badge:empty{display:none}.btn .badge{position:relative;top:-1px}.btn-xs .badge{top:0;padding:1px 5px}a.badge:hover,a.badge:focus{color:#fff;text-decoration:none;cursor:pointer}.list-group-item.active>.badge,.nav-pills>.active>a>.badge{color:#337ab7;background-color:#fff}.list-group-item>.badge{float:right}.list-group-item>.badge+.badge{margin-right:5px}.nav-pills>li>a>.badge{margin-left:3px}.jumbotron{padding:30px 15px;margin-bottom:30px;color:inherit;background-color:#eee}.jumbotron h1,.jumbotron .h1{color:inherit}.jumbotron p{margin-bottom:15px;font-size:21px;font-weight:200}.jumbotron>hr{border-top-color:#d5d5d5}.container .jumbotron,.container-fluid .jumbotron{border-radius:6px}.jumbotron .container{max-width:100%}@media screen and (min-width:768px){.jumbotron{padding:48px 0}.container .jumbotron,.container-fluid .jumbotron{padding-right:60px;padding-left:60px}.jumbotron h1,.jumbotron .h1{font-size:63px}}.thumbnail{display:block;padding:4px;margin-bottom:20px;line-height:1.42857143;background-color:#fff;border:1px solid #ddd;border-radius:4px;-webkit-transition:border .2s ease-in-out;-o-transition:border .2s ease-in-out;transition:border .2s ease-in-out}.thumbnail>img,.thumbnail a>img{margin-right:auto;margin-left:auto}a.thumbnail:hover,a.thumbnail:focus,a.thumbnail.active{border-color:#337ab7}.thumbnail .caption{padding:9px;color:#333}.alert{padding:15px;margin-bottom:20px;border:1px solid transparent;border-radius:4px}.alert h4{margin-top:0;color:inherit}.alert .alert-link{font-weight:700}.alert>p,.alert>ul{margin-bottom:0}.alert>p+p{margin-top:5px}.alert-dismissable,.alert-dismissible{padding-right:35px}.alert-dismissable .close,.alert-dismissible .close{position:relative;top:-2px;right:-21px;color:inherit}.alert-success{color:#3c763d;background-color:#dff0d8;border-color:#d6e9c6}.alert-success hr{border-top-color:#c9e2b3}.alert-success .alert-link{color:#2b542c}.alert-info{color:#31708f;background-color:#d9edf7;border-color:#bce8f1}.alert-info hr{border-top-color:#a6e1ec}.alert-info .alert-link{color:#245269}.alert-warning{color:#8a6d3b;background-color:#fcf8e3;border-color:#faebcc}.alert-warning hr{border-top-color:#f7e1b5}.alert-warning .alert-link{color:#66512c}.alert-danger{color:#a94442;background-color:#f2dede;border-color:#ebccd1}.alert-danger hr{border-top-color:#e4b9c0}.alert-danger .alert-link{color:#843534}@-webkit-keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}@-o-keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}@keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}.progress{height:20px;margin-bottom:20px;overflow:hidden;background-color:#f5f5f5;border-radius:4px;-webkit-box-shadow:inset 0 1px 2px rgba(0,0,0,.1);box-shadow:inset 0 1px 2px rgba(0,0,0,.1)}.progress-bar{float:left;width:0;height:100%;font-size:12px;line-height:20px;color:#fff;text-align:center;background-color:#337ab7;-webkit-box-shadow:inset 0 -1px 0 rgba(0,0,0,.15);box-shadow:inset 0 -1px 0 rgba(0,0,0,.15);-webkit-transition:width .6s ease;-o-transition:width .6s ease;transition:width .6s ease}.progress-striped .progress-bar,.progress-bar-striped{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);-webkit-background-size:40px 40px;background-size:40px 40px}.progress.active .progress-bar,.progress-bar.active{-webkit-animation:progress-bar-stripes 2s linear infinite;-o-animation:progress-bar-stripes 2s linear infinite;animation:progress-bar-stripes 2s linear infinite}.progress-bar-success{background-color:#5cb85c}.progress-striped .progress-bar-success{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.progress-bar-info{background-color:#5bc0de}.progress-striped .progress-bar-info{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.progress-bar-warning{background-color:#f0ad4e}.progress-striped .progress-bar-warning{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.progress-bar-danger{background-color:#d9534f}.progress-striped .progress-bar-danger{background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:-o-linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,.15) 50%,rgba(255,255,255,.15) 75%,transparent 75%,transparent)}.media{margin-top:15px}.media:first-child{margin-top:0}.media-right,.media>.pull-right{padding-left:10px}.media-left,.media>.pull-left{padding-right:10px}.media-left,.media-right,.media-body{display:table-cell;vertical-align:top}.media-middle{vertical-align:middle}.media-bottom{vertical-align:bottom}.media-heading{margin-top:0;margin-bottom:5px}.media-list{padding-left:0;list-style:none}.list-group{padding-left:0;margin-bottom:20px}.list-group-item{position:relative;display:block;padding:10px 15px;margin-bottom:-1px;background-color:#fff;border:1px solid #ddd}.list-group-item:first-child{border-top-left-radius:4px;border-top-right-radius:4px}.list-group-item:last-child{margin-bottom:0;border-bottom-right-radius:4px;border-bottom-left-radius:4px}a.list-group-item{color:#555}a.list-group-item .list-group-item-heading{color:#333}a.list-group-item:hover,a.list-group-item:focus{color:#555;text-decoration:none;background-color:#f5f5f5}.list-group-item.disabled,.list-group-item.disabled:hover,.list-group-item.disabled:focus{color:#777;cursor:not-allowed;background-color:#eee}.list-group-item.disabled .list-group-item-heading,.list-group-item.disabled:hover .list-group-item-heading,.list-group-item.disabled:focus .list-group-item-heading{color:inherit}.list-group-item.disabled .list-group-item-text,.list-group-item.disabled:hover .list-group-item-text,.list-group-item.disabled:focus .list-group-item-text{color:#777}.list-group-item.active,.list-group-item.active:hover,.list-group-item.active:focus{z-index:2;color:#fff;background-color:#337ab7;border-color:#337ab7}.list-group-item.active .list-group-item-heading,.list-group-item.active:hover .list-group-item-heading,.list-group-item.active:focus .list-group-item-heading,.list-group-item.active .list-group-item-heading>small,.list-group-item.active:hover .list-group-item-heading>small,.list-group-item.active:focus .list-group-item-heading>small,.list-group-item.active .list-group-item-heading>.small,.list-group-item.active:hover .list-group-item-heading>.small,.list-group-item.active:focus .list-group-item-heading>.small{color:inherit}.list-group-item.active .list-group-item-text,.list-group-item.active:hover .list-group-item-text,.list-group-item.active:focus .list-group-item-text{color:#c7ddef}.list-group-item-success{color:#3c763d;background-color:#dff0d8}a.list-group-item-success{color:#3c763d}a.list-group-item-success .list-group-item-heading{color:inherit}a.list-group-item-success:hover,a.list-group-item-success:focus{color:#3c763d;background-color:#d0e9c6}a.list-group-item-success.active,a.list-group-item-success.active:hover,a.list-group-item-success.active:focus{color:#fff;background-color:#3c763d;border-color:#3c763d}.list-group-item-info{color:#31708f;background-color:#d9edf7}a.list-group-item-info{color:#31708f}a.list-group-item-info .list-group-item-heading{color:inherit}a.list-group-item-info:hover,a.list-group-item-info:focus{color:#31708f;background-color:#c4e3f3}a.list-group-item-info.active,a.list-group-item-info.active:hover,a.list-group-item-info.active:focus{color:#fff;background-color:#31708f;border-color:#31708f}.list-group-item-warning{color:#8a6d3b;background-color:#fcf8e3}a.list-group-item-warning{color:#8a6d3b}a.list-group-item-warning .list-group-item-heading{color:inherit}a.list-group-item-warning:hover,a.list-group-item-warning:focus{color:#8a6d3b;background-color:#faf2cc}a.list-group-item-warning.active,a.list-group-item-warning.active:hover,a.list-group-item-warning.active:focus{color:#fff;background-color:#8a6d3b;border-color:#8a6d3b}.list-group-item-danger{color:#a94442;background-color:#f2dede}a.list-group-item-danger{color:#a94442}a.list-group-item-danger .list-group-item-heading{color:inherit}a.list-group-item-danger:hover,a.list-group-item-danger:focus{color:#a94442;background-color:#ebcccc}a.list-group-item-danger.active,a.list-group-item-danger.active:hover,a.list-group-item-danger.active:focus{color:#fff;background-color:#a94442;border-color:#a94442}.list-group-item-heading{margin-top:0;margin-bottom:5px}.list-group-item-text{margin-bottom:0;line-height:1.3}.panel{margin-bottom:20px;background-color:#fff;border:1px solid transparent;border-radius:4px;-webkit-box-shadow:0 1px 1px rgba(0,0,0,.05);box-shadow:0 1px 1px rgba(0,0,0,.05)}.panel-body{padding:15px}.panel-heading{padding:10px 15px;border-bottom:1px solid transparent;border-top-left-radius:3px;border-top-right-radius:3px}.panel-heading>.dropdown .dropdown-toggle{color:inherit}.panel-title{margin-top:0;margin-bottom:0;font-size:16px;color:inherit}.panel-title>a{color:inherit}.panel-footer{padding:10px 15px;background-color:#f5f5f5;border-top:1px solid #ddd;border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel>.list-group,.panel>.panel-collapse>.list-group{margin-bottom:0}.panel>.list-group .list-group-item,.panel>.panel-collapse>.list-group .list-group-item{border-width:1px 0;border-radius:0}.panel>.list-group:first-child .list-group-item:first-child,.panel>.panel-collapse>.list-group:first-child .list-group-item:first-child{border-top:0;border-top-left-radius:3px;border-top-right-radius:3px}.panel>.list-group:last-child .list-group-item:last-child,.panel>.panel-collapse>.list-group:last-child .list-group-item:last-child{border-bottom:0;border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel-heading+.list-group .list-group-item:first-child{border-top-width:0}.list-group+.panel-footer{border-top-width:0}.panel>.table,.panel>.table-responsive>.table,.panel>.panel-collapse>.table{margin-bottom:0}.panel>.table caption,.panel>.table-responsive>.table caption,.panel>.panel-collapse>.table caption{padding-right:15px;padding-left:15px}.panel>.table:first-child,.panel>.table-responsive:first-child>.table:first-child{border-top-left-radius:3px;border-top-right-radius:3px}.panel>.table:first-child>thead:first-child>tr:first-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child,.panel>.table:first-child>tbody:first-child>tr:first-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child{border-top-left-radius:3px;border-top-right-radius:3px}.panel>.table:first-child>thead:first-child>tr:first-child td:first-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child td:first-child,.panel>.table:first-child>tbody:first-child>tr:first-child td:first-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child td:first-child,.panel>.table:first-child>thead:first-child>tr:first-child th:first-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child th:first-child,.panel>.table:first-child>tbody:first-child>tr:first-child th:first-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child th:first-child{border-top-left-radius:3px}.panel>.table:first-child>thead:first-child>tr:first-child td:last-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child td:last-child,.panel>.table:first-child>tbody:first-child>tr:first-child td:last-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child td:last-child,.panel>.table:first-child>thead:first-child>tr:first-child th:last-child,.panel>.table-responsive:first-child>.table:first-child>thead:first-child>tr:first-child th:last-child,.panel>.table:first-child>tbody:first-child>tr:first-child th:last-child,.panel>.table-responsive:first-child>.table:first-child>tbody:first-child>tr:first-child th:last-child{border-top-right-radius:3px}.panel>.table:last-child,.panel>.table-responsive:last-child>.table:last-child{border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel>.table:last-child>tbody:last-child>tr:last-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child,.panel>.table:last-child>tfoot:last-child>tr:last-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child{border-bottom-right-radius:3px;border-bottom-left-radius:3px}.panel>.table:last-child>tbody:last-child>tr:last-child td:first-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child td:first-child,.panel>.table:last-child>tfoot:last-child>tr:last-child td:first-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child td:first-child,.panel>.table:last-child>tbody:last-child>tr:last-child th:first-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child th:first-child,.panel>.table:last-child>tfoot:last-child>tr:last-child th:first-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child th:first-child{border-bottom-left-radius:3px}.panel>.table:last-child>tbody:last-child>tr:last-child td:last-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child td:last-child,.panel>.table:last-child>tfoot:last-child>tr:last-child td:last-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child td:last-child,.panel>.table:last-child>tbody:last-child>tr:last-child th:last-child,.panel>.table-responsive:last-child>.table:last-child>tbody:last-child>tr:last-child th:last-child,.panel>.table:last-child>tfoot:last-child>tr:last-child th:last-child,.panel>.table-responsive:last-child>.table:last-child>tfoot:last-child>tr:last-child th:last-child{border-bottom-right-radius:3px}.panel>.panel-body+.table,.panel>.panel-body+.table-responsive,.panel>.table+.panel-body,.panel>.table-responsive+.panel-body{border-top:1px solid #ddd}.panel>.table>tbody:first-child>tr:first-child th,.panel>.table>tbody:first-child>tr:first-child td{border-top:0}.panel>.table-bordered,.panel>.table-responsive>.table-bordered{border:0}.panel>.table-bordered>thead>tr>th:first-child,.panel>.table-responsive>.table-bordered>thead>tr>th:first-child,.panel>.table-bordered>tbody>tr>th:first-child,.panel>.table-responsive>.table-bordered>tbody>tr>th:first-child,.panel>.table-bordered>tfoot>tr>th:first-child,.panel>.table-responsive>.table-bordered>tfoot>tr>th:first-child,.panel>.table-bordered>thead>tr>td:first-child,.panel>.table-responsive>.table-bordered>thead>tr>td:first-child,.panel>.table-bordered>tbody>tr>td:first-child,.panel>.table-responsive>.table-bordered>tbody>tr>td:first-child,.panel>.table-bordered>tfoot>tr>td:first-child,.panel>.table-responsive>.table-bordered>tfoot>tr>td:first-child{border-left:0}.panel>.table-bordered>thead>tr>th:last-child,.panel>.table-responsive>.table-bordered>thead>tr>th:last-child,.panel>.table-bordered>tbody>tr>th:last-child,.panel>.table-responsive>.table-bordered>tbody>tr>th:last-child,.panel>.table-bordered>tfoot>tr>th:last-child,.panel>.table-responsive>.table-bordered>tfoot>tr>th:last-child,.panel>.table-bordered>thead>tr>td:last-child,.panel>.table-responsive>.table-bordered>thead>tr>td:last-child,.panel>.table-bordered>tbody>tr>td:last-child,.panel>.table-responsive>.table-bordered>tbody>tr>td:last-child,.panel>.table-bordered>tfoot>tr>td:last-child,.panel>.table-responsive>.table-bordered>tfoot>tr>td:last-child{border-right:0}.panel>.table-bordered>thead>tr:first-child>td,.panel>.table-responsive>.table-bordered>thead>tr:first-child>td,.panel>.table-bordered>tbody>tr:first-child>td,.panel>.table-responsive>.table-bordered>tbody>tr:first-child>td,.panel>.table-bordered>thead>tr:first-child>th,.panel>.table-responsive>.table-bordered>thead>tr:first-child>th,.panel>.table-bordered>tbody>tr:first-child>th,.panel>.table-responsive>.table-bordered>tbody>tr:first-child>th{border-bottom:0}.panel>.table-bordered>tbody>tr:last-child>td,.panel>.table-responsive>.table-bordered>tbody>tr:last-child>td,.panel>.table-bordered>tfoot>tr:last-child>td,.panel>.table-responsive>.table-bordered>tfoot>tr:last-child>td,.panel>.table-bordered>tbody>tr:last-child>th,.panel>.table-responsive>.table-bordered>tbody>tr:last-child>th,.panel>.table-bordered>tfoot>tr:last-child>th,.panel>.table-responsive>.table-bordered>tfoot>tr:last-child>th{border-bottom:0}.panel>.table-responsive{margin-bottom:0;border:0}.panel-group{margin-bottom:20px}.panel-group .panel{margin-bottom:0;border-radius:4px}.panel-group .panel+.panel{margin-top:5px}.panel-group .panel-heading{border-bottom:0}.panel-group .panel-heading+.panel-collapse>.panel-body,.panel-group .panel-heading+.panel-collapse>.list-group{border-top:1px solid #ddd}.panel-group .panel-footer{border-top:0}.panel-group .panel-footer+.panel-collapse .panel-body{border-bottom:1px solid #ddd}.panel-default{border-color:#ddd}.panel-default>.panel-heading{color:#333;background-color:#f5f5f5;border-color:#ddd}.panel-default>.panel-heading+.panel-collapse>.panel-body{border-top-color:#ddd}.panel-default>.panel-heading .badge{color:#f5f5f5;background-color:#333}.panel-default>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#ddd}.panel-primary{border-color:#337ab7}.panel-primary>.panel-heading{color:#fff;background-color:#337ab7;border-color:#337ab7}.panel-primary>.panel-heading+.panel-collapse>.panel-body{border-top-color:#337ab7}.panel-primary>.panel-heading .badge{color:#337ab7;background-color:#fff}.panel-primary>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#337ab7}.panel-success{border-color:#d6e9c6}.panel-success>.panel-heading{color:#3c763d;background-color:#dff0d8;border-color:#d6e9c6}.panel-success>.panel-heading+.panel-collapse>.panel-body{border-top-color:#d6e9c6}.panel-success>.panel-heading .badge{color:#dff0d8;background-color:#3c763d}.panel-success>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#d6e9c6}.panel-info{border-color:#bce8f1}.panel-info>.panel-heading{color:#31708f;background-color:#d9edf7;border-color:#bce8f1}.panel-info>.panel-heading+.panel-collapse>.panel-body{border-top-color:#bce8f1}.panel-info>.panel-heading .badge{color:#d9edf7;background-color:#31708f}.panel-info>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#bce8f1}.panel-warning{border-color:#faebcc}.panel-warning>.panel-heading{color:#8a6d3b;background-color:#fcf8e3;border-color:#faebcc}.panel-warning>.panel-heading+.panel-collapse>.panel-body{border-top-color:#faebcc}.panel-warning>.panel-heading .badge{color:#fcf8e3;background-color:#8a6d3b}.panel-warning>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#faebcc}.panel-danger{border-color:#ebccd1}.panel-danger>.panel-heading{color:#a94442;background-color:#f2dede;border-color:#ebccd1}.panel-danger>.panel-heading+.panel-collapse>.panel-body{border-top-color:#ebccd1}.panel-danger>.panel-heading .badge{color:#f2dede;background-color:#a94442}.panel-danger>.panel-footer+.panel-collapse>.panel-body{border-bottom-color:#ebccd1}.embed-responsive{position:relative;display:block;height:0;padding:0;overflow:hidden}.embed-responsive .embed-responsive-item,.embed-responsive iframe,.embed-responsive embed,.embed-responsive object,.embed-responsive video{position:absolute;top:0;bottom:0;left:0;width:100%;height:100%;border:0}.embed-responsive.embed-responsive-16by9{padding-bottom:56.25%}.embed-responsive.embed-responsive-4by3{padding-bottom:75%}.well{min-height:20px;padding:19px;margin-bottom:20px;background-color:#f5f5f5;border:1px solid #e3e3e3;border-radius:4px;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,.05);box-shadow:inset 0 1px 1px rgba(0,0,0,.05)}.well blockquote{border-color:#ddd;border-color:rgba(0,0,0,.15)}.well-lg{padding:24px;border-radius:6px}.well-sm{padding:9px;border-radius:3px}.close{float:right;font-size:21px;font-weight:700;line-height:1;color:#000;text-shadow:0 1px 0 #fff;filter:alpha(opacity=20);opacity:.2}.close:hover,.close:focus{color:#000;text-decoration:none;cursor:pointer;filter:alpha(opacity=50);opacity:.5}button.close{-webkit-appearance:none;padding:0;cursor:pointer;background:0 0;border:0}.modal-open{overflow:hidden}.modal{position:fixed;top:0;right:0;bottom:0;left:0;z-index:1040;display:none;overflow:hidden;-webkit-overflow-scrolling:touch;outline:0}.modal.fade .modal-dialog{-webkit-transition:-webkit-transform .3s ease-out;-o-transition:-o-transform .3s ease-out;transition:transform .3s ease-out;-webkit-transform:translate(0,-25%);-ms-transform:translate(0,-25%);-o-transform:translate(0,-25%);transform:translate(0,-25%)}.modal.in .modal-dialog{-webkit-transform:translate(0,0);-ms-transform:translate(0,0);-o-transform:translate(0,0);transform:translate(0,0)}.modal-open .modal{overflow-x:hidden;overflow-y:auto}.modal-dialog{position:relative;width:auto;margin:10px}.modal-content{position:relative;background-color:#fff;-webkit-background-clip:padding-box;background-clip:padding-box;border:1px solid #999;border:1px solid rgba(0,0,0,.2);border-radius:6px;outline:0;-webkit-box-shadow:0 3px 9px rgba(0,0,0,.5);box-shadow:0 3px 9px rgba(0,0,0,.5)}.modal-backdrop{position:absolute;top:0;right:0;left:0;background-color:#000}.modal-backdrop.fade{filter:alpha(opacity=0);opacity:0}.modal-backdrop.in{filter:alpha(opacity=50);opacity:.5}.modal-header{min-height:16.43px;padding:15px;border-bottom:1px solid #e5e5e5}.modal-header .close{margin-top:-2px}.modal-title{margin:0;line-height:1.42857143}.modal-body{position:relative;padding:15px}.modal-footer{padding:15px;text-align:right;border-top:1px solid #e5e5e5}.modal-footer .btn+.btn{margin-bottom:0;margin-left:5px}.modal-footer .btn-group .btn+.btn{margin-left:-1px}.modal-footer .btn-block+.btn-block{margin-left:0}.modal-scrollbar-measure{position:absolute;top:-9999px;width:50px;height:50px;overflow:scroll}@media (min-width:768px){.modal-dialog{width:600px;margin:30px auto}.modal-content{-webkit-box-shadow:0 5px 15px rgba(0,0,0,.5);box-shadow:0 5px 15px rgba(0,0,0,.5)}.modal-sm{width:300px}}@media (min-width:992px){.modal-lg{width:900px}}.tooltip{position:absolute;z-index:1070;display:block;font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;font-size:12px;font-weight:400;line-height:1.4;visibility:visible;filter:alpha(opacity=0);opacity:0}.tooltip.in{filter:alpha(opacity=90);opacity:.9}.tooltip.top{padding:5px 0;margin-top:-3px}.tooltip.right{padding:0 5px;margin-left:3px}.tooltip.bottom{padding:5px 0;margin-top:3px}.tooltip.left{padding:0 5px;margin-left:-3px}.tooltip-inner{max-width:200px;padding:3px 8px;color:#fff;text-align:center;text-decoration:none;background-color:#000;border-radius:4px}.tooltip-arrow{position:absolute;width:0;height:0;border-color:transparent;border-style:solid}.tooltip.top .tooltip-arrow{bottom:0;left:50%;margin-left:-5px;border-width:5px 5px 0;border-top-color:#000}.tooltip.top-left .tooltip-arrow{right:5px;bottom:0;margin-bottom:-5px;border-width:5px 5px 0;border-top-color:#000}.tooltip.top-right .tooltip-arrow{bottom:0;left:5px;margin-bottom:-5px;border-width:5px 5px 0;border-top-color:#000}.tooltip.right .tooltip-arrow{top:50%;left:0;margin-top:-5px;border-width:5px 5px 5px 0;border-right-color:#000}.tooltip.left .tooltip-arrow{top:50%;right:0;margin-top:-5px;border-width:5px 0 5px 5px;border-left-color:#000}.tooltip.bottom .tooltip-arrow{top:0;left:50%;margin-left:-5px;border-width:0 5px 5px;border-bottom-color:#000}.tooltip.bottom-left .tooltip-arrow{top:0;right:5px;margin-top:-5px;border-width:0 5px 5px;border-bottom-color:#000}.tooltip.bottom-right .tooltip-arrow{top:0;left:5px;margin-top:-5px;border-width:0 5px 5px;border-bottom-color:#000}.popover{position:absolute;top:0;left:0;z-index:1060;display:none;max-width:276px;padding:1px;font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;font-size:14px;font-weight:400;line-height:1.42857143;text-align:left;white-space:normal;background-color:#fff;-webkit-background-clip:padding-box;background-clip:padding-box;border:1px solid #ccc;border:1px solid rgba(0,0,0,.2);border-radius:6px;-webkit-box-shadow:0 5px 10px rgba(0,0,0,.2);box-shadow:0 5px 10px rgba(0,0,0,.2)}.popover.top{margin-top:-10px}.popover.right{margin-left:10px}.popover.bottom{margin-top:10px}.popover.left{margin-left:-10px}.popover-title{padding:8px 14px;margin:0;font-size:14px;background-color:#f7f7f7;border-bottom:1px solid #ebebeb;border-radius:5px 5px 0 0}.popover-content{padding:9px 14px}.popover>.arrow,.popover>.arrow:after{position:absolute;display:block;width:0;height:0;border-color:transparent;border-style:solid}.popover>.arrow{border-width:11px}.popover>.arrow:after{content:"";border-width:10px}.popover.top>.arrow{bottom:-11px;left:50%;margin-left:-11px;border-top-color:#999;border-top-color:rgba(0,0,0,.25);border-bottom-width:0}.popover.top>.arrow:after{bottom:1px;margin-left:-10px;content:" ";border-top-color:#fff;border-bottom-width:0}.popover.right>.arrow{top:50%;left:-11px;margin-top:-11px;border-right-color:#999;border-right-color:rgba(0,0,0,.25);border-left-width:0}.popover.right>.arrow:after{bottom:-10px;left:1px;content:" ";border-right-color:#fff;border-left-width:0}.popover.bottom>.arrow{top:-11px;left:50%;margin-left:-11px;border-top-width:0;border-bottom-color:#999;border-bottom-color:rgba(0,0,0,.25)}.popover.bottom>.arrow:after{top:1px;margin-left:-10px;content:" ";border-top-width:0;border-bottom-color:#fff}.popover.left>.arrow{top:50%;right:-11px;margin-top:-11px;border-right-width:0;border-left-color:#999;border-left-color:rgba(0,0,0,.25)}.popover.left>.arrow:after{right:1px;bottom:-10px;content:" ";border-right-width:0;border-left-color:#fff}.carousel{position:relative}.carousel-inner{position:relative;width:100%;overflow:hidden}.carousel-inner>.item{position:relative;display:none;-webkit-transition:.6s ease-in-out left;-o-transition:.6s ease-in-out left;transition:.6s ease-in-out left}.carousel-inner>.item>img,.carousel-inner>.item>a>img{line-height:1}@media all and (transform-3d),(-webkit-transform-3d){.carousel-inner>.item{-webkit-transition:-webkit-transform .6s ease-in-out;-o-transition:-o-transform .6s ease-in-out;transition:transform .6s ease-in-out;-webkit-backface-visibility:hidden;backface-visibility:hidden;-webkit-perspective:1000;perspective:1000}.carousel-inner>.item.next,.carousel-inner>.item.active.right{left:0;-webkit-transform:translate3d(100%,0,0);transform:translate3d(100%,0,0)}.carousel-inner>.item.prev,.carousel-inner>.item.active.left{left:0;-webkit-transform:translate3d(-100%,0,0);transform:translate3d(-100%,0,0)}.carousel-inner>.item.next.left,.carousel-inner>.item.prev.right,.carousel-inner>.item.active{left:0;-webkit-transform:translate3d(0,0,0);transform:translate3d(0,0,0)}}.carousel-inner>.active,.carousel-inner>.next,.carousel-inner>.prev{display:block}.carousel-inner>.active{left:0}.carousel-inner>.next,.carousel-inner>.prev{position:absolute;top:0;width:100%}.carousel-inner>.next{left:100%}.carousel-inner>.prev{left:-100%}.carousel-inner>.next.left,.carousel-inner>.prev.right{left:0}.carousel-inner>.active.left{left:-100%}.carousel-inner>.active.right{left:100%}.carousel-control{position:absolute;top:0;bottom:0;left:0;width:15%;font-size:20px;color:#fff;text-align:center;text-shadow:0 1px 2px rgba(0,0,0,.6);filter:alpha(opacity=50);opacity:.5}.carousel-control.left{background-image:-webkit-linear-gradient(left,rgba(0,0,0,.5) 0,rgba(0,0,0,.0001) 100%);background-image:-o-linear-gradient(left,rgba(0,0,0,.5) 0,rgba(0,0,0,.0001) 100%);background-image:-webkit-gradient(linear,left top,right top,from(rgba(0,0,0,.5)),to(rgba(0,0,0,.0001)));background-image:linear-gradient(to right,rgba(0,0,0,.5) 0,rgba(0,0,0,.0001) 100%);filter:progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000', endColorstr='#00000000', GradientType=1);background-repeat:repeat-x}.carousel-control.right{right:0;left:auto;background-image:-webkit-linear-gradient(left,rgba(0,0,0,.0001) 0,rgba(0,0,0,.5) 100%);background-image:-o-linear-gradient(left,rgba(0,0,0,.0001) 0,rgba(0,0,0,.5) 100%);background-image:-webkit-gradient(linear,left top,right top,from(rgba(0,0,0,.0001)),to(rgba(0,0,0,.5)));background-image:linear-gradient(to right,rgba(0,0,0,.0001) 0,rgba(0,0,0,.5) 100%);filter:progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000', endColorstr='#80000000', GradientType=1);background-repeat:repeat-x}.carousel-control:hover,.carousel-control:focus{color:#fff;text-decoration:none;filter:alpha(opacity=90);outline:0;opacity:.9}.carousel-control .icon-prev,.carousel-control .icon-next,.carousel-control .glyphicon-chevron-left,.carousel-control .glyphicon-chevron-right{position:absolute;top:50%;z-index:5;display:inline-block}.carousel-control .icon-prev,.carousel-control .glyphicon-chevron-left{left:50%;margin-left:-10px}.carousel-control .icon-next,.carousel-control .glyphicon-chevron-right{right:50%;margin-right:-10px}.carousel-control .icon-prev,.carousel-control .icon-next{width:20px;height:20px;margin-top:-10px;font-family:serif}.carousel-control .icon-prev:before{content:'\2039'}.carousel-control .icon-next:before{content:'\203a'}.carousel-indicators{position:absolute;bottom:10px;left:50%;z-index:15;width:60%;padding-left:0;margin-left:-30%;text-align:center;list-style:none}.carousel-indicators li{display:inline-block;width:10px;height:10px;margin:1px;text-indent:-999px;cursor:pointer;background-color:#000 \9;background-color:rgba(0,0,0,0);border:1px solid #fff;border-radius:10px}.carousel-indicators .active{width:12px;height:12px;margin:0;background-color:#fff}.carousel-caption{position:absolute;right:15%;bottom:20px;left:15%;z-index:10;padding-top:20px;padding-bottom:20px;color:#fff;text-align:center;text-shadow:0 1px 2px rgba(0,0,0,.6)}.carousel-caption .btn{text-shadow:none}@media screen and (min-width:768px){.carousel-control .glyphicon-chevron-left,.carousel-control .glyphicon-chevron-right,.carousel-control .icon-prev,.carousel-control .icon-next{width:30px;height:30px;margin-top:-15px;font-size:30px}.carousel-control .glyphicon-chevron-left,.carousel-control .icon-prev{margin-left:-15px}.carousel-control .glyphicon-chevron-right,.carousel-control .icon-next{margin-right:-15px}.carousel-caption{right:20%;left:20%;padding-bottom:30px}.carousel-indicators{bottom:20px}}.clearfix:before,.clearfix:after,.dl-horizontal dd:before,.dl-horizontal dd:after,.container:before,.container:after,.container-fluid:before,.container-fluid:after,.row:before,.row:after,.form-horizontal .form-group:before,.form-horizontal .form-group:after,.btn-toolbar:before,.btn-toolbar:after,.btn-group-vertical>.btn-group:before,.btn-group-vertical>.btn-group:after,.nav:before,.nav:after,.navbar:before,.navbar:after,.navbar-header:before,.navbar-header:after,.navbar-collapse:before,.navbar-collapse:after,.pager:before,.pager:after,.panel-body:before,.panel-body:after,.modal-footer:before,.modal-footer:after{display:table;content:" "}.clearfix:after,.dl-horizontal dd:after,.container:after,.container-fluid:after,.row:after,.form-horizontal .form-group:after,.btn-toolbar:after,.btn-group-vertical>.btn-group:after,.nav:after,.navbar:after,.navbar-header:after,.navbar-collapse:after,.pager:after,.panel-body:after,.modal-footer:after{clear:both}.center-block{display:block;margin-right:auto;margin-left:auto}.pull-right{float:right!important}.pull-left{float:left!important}.hide{display:none!important}.show{display:block!important}.invisible{visibility:hidden}.text-hide{font:0/0 a;color:transparent;text-shadow:none;background-color:transparent;border:0}.hidden{display:none!important;visibility:hidden!important}.affix{position:fixed}@-ms-viewport{width:device-width}.visible-xs,.visible-sm,.visible-md,.visible-lg{display:none!important}.visible-xs-block,.visible-xs-inline,.visible-xs-inline-block,.visible-sm-block,.visible-sm-inline,.visible-sm-inline-block,.visible-md-block,.visible-md-inline,.visible-md-inline-block,.visible-lg-block,.visible-lg-inline,.visible-lg-inline-block{display:none!important}@media (max-width:767px){.visible-xs{display:block!important}table.visible-xs{display:table}tr.visible-xs{display:table-row!important}th.visible-xs,td.visible-xs{display:table-cell!important}}@media (max-width:767px){.visible-xs-block{display:block!important}}@media (max-width:767px){.visible-xs-inline{display:inline!important}}@media (max-width:767px){.visible-xs-inline-block{display:inline-block!important}}@media (min-width:768px) and (max-width:991px){.visible-sm{display:block!important}table.visible-sm{display:table}tr.visible-sm{display:table-row!important}th.visible-sm,td.visible-sm{display:table-cell!important}}@media (min-width:768px) and (max-width:991px){.visible-sm-block{display:block!important}}@media (min-width:768px) and (max-width:991px){.visible-sm-inline{display:inline!important}}@media (min-width:768px) and (max-width:991px){.visible-sm-inline-block{display:inline-block!important}}@media (min-width:992px) and (max-width:1199px){.visible-md{display:block!important}table.visible-md{display:table}tr.visible-md{display:table-row!important}th.visible-md,td.visible-md{display:table-cell!important}}@media (min-width:992px) and (max-width:1199px){.visible-md-block{display:block!important}}@media (min-width:992px) and (max-width:1199px){.visible-md-inline{display:inline!important}}@media (min-width:992px) and (max-width:1199px){.visible-md-inline-block{display:inline-block!important}}@media (min-width:1200px){.visible-lg{display:block!important}table.visible-lg{display:table}tr.visible-lg{display:table-row!important}th.visible-lg,td.visible-lg{display:table-cell!important}}@media (min-width:1200px){.visible-lg-block{display:block!important}}@media (min-width:1200px){.visible-lg-inline{display:inline!important}}@media (min-width:1200px){.visible-lg-inline-block{display:inline-block!important}}@media (max-width:767px){.hidden-xs{display:none!important}}@media (min-width:768px) and (max-width:991px){.hidden-sm{display:none!important}}@media (min-width:992px) and (max-width:1199px){.hidden-md{display:none!important}}@media (min-width:1200px){.hidden-lg{display:none!important}}.visible-print{display:none!important}@media print{.visible-print{display:block!important}table.visible-print{display:table}tr.visible-print{display:table-row!important}th.visible-print,td.visible-print{display:table-cell!important}}.visible-print-block{display:none!important}@media print{.visible-print-block{display:block!important}}.visible-print-inline{display:none!important}@media print{.visible-print-inline{display:inline!important}}.visible-print-inline-block{display:none!important}@media print{.visible-print-inline-block{display:inline-block!important}}@media print{.hidden-print{display:none!important}}</style> + <style>/* bootstrap custom style stuff - taken from demo template. */ +/* + * Base structure + */ + +/* Move down content because we have a fixed navbar that is 50px tall */ +body { + padding-top: 50px; +} + + +/* + * Global add-ons + */ + +.sub-header { + padding-bottom: 10px; + border-bottom: 1px solid #eee; +} + +/* + * Top navigation + * Hide default border to remove 1px line. + */ +.navbar-fixed-top { + border: 0; +} + +/* + * Sidebar + */ + +/* Hide for mobile, show later */ +.sidebar { + display: none; +} +@media (min-width: 768px) { + .sidebar { + position: fixed; + top: 51px; + bottom: 0; + left: 0; + z-index: 1000; + display: block; + padding: 20px; + overflow-x: hidden; + overflow-y: auto; /* Scrollable contents if viewport is shorter than content. */ + background-color: #f5f5f5; + border-right: 1px solid #eee; + } +} + +/* Sidebar navigation */ +.nav-sidebar { + margin-right: -21px; /* 20px padding + 1px border */ + margin-bottom: 20px; + margin-left: -20px; +} +.nav-sidebar > li > a { + padding-right: 20px; + padding-left: 20px; +} +.nav-sidebar > .active > a, +.nav-sidebar > .active > a:hover, +.nav-sidebar > .active > a:focus { + color: #fff; + background-color: #428bca; +} + + +/* + * Main content + */ + +.main { + padding: 20px; +} +@media (min-width: 768px) { + .main { + padding-right: 40px; + padding-left: 40px; + } +} +.main .page-header { + margin-top: 0; +} + + +/* + * Placeholder dashboard ideas + */ + +.placeholders { + margin-bottom: 30px; + text-align: center; +} +.placeholders h4 { + margin-bottom: 0; +} +.placeholder { + margin-bottom: 20px; +} +.placeholder img { + display: inline-block; + border-radius: 50%; +} + +.text-success-custom{ + color: rgba(6, 108, 8, 1); +} +.text-danger-custom{ + font-weight: bold; + color: rgba(213, 24, 20, 1); +} +.panel-danger-custom .panel-title{ + font-weight: bold; + color: rgba(213, 24, 20, 1); +}t status + +.panel-success-custom .panel-title{ + color: rgba(6, 108, 8, 1); +}t status +</style> + + <!-- HTML5 shim and Respond.js for IE8 support of HTML5 elements and media queries --> + <!-- WARNING: Respond.js doesn't work if you view the page via file:// --> + <!--[if lt IE 9]> + <script src="https://oss.maxcdn.com/html5shiv/3.7.2/html5shiv.min.js"></script> + <script src="https://oss.maxcdn.com/respond/1.4.2/respond.min.js"></script> + <![endif]--> + + </head> + <body> + + <nav class="navbar navbar-inverse navbar-fixed-top" role="navigation"> + <div class="container-fluid"> + <div class="navbar-header"> + + <button type="button" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#navbar" aria-expanded="false" aria-controls="navbar"> + <span class="sr-only">Toggle navigation</span> + <span class="icon-bar"></span> + <span class="icon-bar"></span> + <span class="icon-bar"></span> + </button> + <a class="navbar-brand" href="#">Tool Test Results (powered by Planemo)</a> + </div> + <div id="navbar" class="navbar-collapse collapse"> + <ul class="nav navbar-nav navbar-right"> + + <li><a href="https://galaxyproject.org">Galaxy</a></li> + <li><a href="https://planemo.readthedocs.org">Planemo</a></li> + + </ul> + <div class="navbar-form navbar-right"> + </div> + </div> + </div> + </nav> + + <div class="container-fluid"> + <div class="row"> + <div class="col-sm-3 col-md-2 sidebar"> + <ul class="nav nav-sidebar"> + <li><a href="#overview" class="text-success"><strong>Overview</strong></a></li> + </ul> + <ul class="nav nav-sidebar" id="nav-sidebar-tests"> + </ul> + </div> + <div class="col-sm-9 col-sm-offset-3 col-md-10 col-md-offset-2 main"> + <!-- <h1 class="page-header">Tests</h1> --> + <h2 id="overview">Overview</h2> + <div id="overview-content"></div> + <div class="progress"> + </div> + <h2 id="tests">Tests</h2> + <p>The remainder of this contains a description for each test executed to run these jobs.</p> + </div> + </div> + </div> + + <script>/*! jQuery v2.1.1 | (c) 2005, 2014 jQuery Foundation, Inc. | jquery.org/license */ +!function(a,b){"object"==typeof module&&"object"==typeof module.exports?module.exports=a.document?b(a,!0):function(a){if(!a.document)throw new Error("jQuery requires a window with a document");return b(a)}:b(a)}("undefined"!=typeof window?window:this,function(a,b){var c=[],d=c.slice,e=c.concat,f=c.push,g=c.indexOf,h={},i=h.toString,j=h.hasOwnProperty,k={},l=a.document,m="2.1.1",n=function(a,b){return new n.fn.init(a,b)},o=/^[\s\uFEFF\xA0]+|[\s\uFEFF\xA0]+$/g,p=/^-ms-/,q=/-([\da-z])/gi,r=function(a,b){return b.toUpperCase()};n.fn=n.prototype={jquery:m,constructor:n,selector:"",length:0,toArray:function(){return d.call(this)},get:function(a){return null!=a?0>a?this[a+this.length]:this[a]:d.call(this)},pushStack:function(a){var b=n.merge(this.constructor(),a);return b.prevObject=this,b.context=this.context,b},each:function(a,b){return n.each(this,a,b)},map:function(a){return this.pushStack(n.map(this,function(b,c){return a.call(b,c,b)}))},slice:function(){return this.pushStack(d.apply(this,arguments))},first:function(){return this.eq(0)},last:function(){return this.eq(-1)},eq:function(a){var b=this.length,c=+a+(0>a?b:0);return this.pushStack(c>=0&&b>c?[this[c]]:[])},end:function(){return this.prevObject||this.constructor(null)},push:f,sort:c.sort,splice:c.splice},n.extend=n.fn.extend=function(){var a,b,c,d,e,f,g=arguments[0]||{},h=1,i=arguments.length,j=!1;for("boolean"==typeof g&&(j=g,g=arguments[h]||{},h++),"object"==typeof g||n.isFunction(g)||(g={}),h===i&&(g=this,h--);i>h;h++)if(null!=(a=arguments[h]))for(b in a)c=g[b],d=a[b],g!==d&&(j&&d&&(n.isPlainObject(d)||(e=n.isArray(d)))?(e?(e=!1,f=c&&n.isArray(c)?c:[]):f=c&&n.isPlainObject(c)?c:{},g[b]=n.extend(j,f,d)):void 0!==d&&(g[b]=d));return g},n.extend({expando:"jQuery"+(m+Math.random()).replace(/\D/g,""),isReady:!0,error:function(a){throw new Error(a)},noop:function(){},isFunction:function(a){return"function"===n.type(a)},isArray:Array.isArray,isWindow:function(a){return null!=a&&a===a.window},isNumeric:function(a){return!n.isArray(a)&&a-parseFloat(a)>=0},isPlainObject:function(a){return"object"!==n.type(a)||a.nodeType||n.isWindow(a)?!1:a.constructor&&!j.call(a.constructor.prototype,"isPrototypeOf")?!1:!0},isEmptyObject:function(a){var b;for(b in a)return!1;return!0},type:function(a){return null==a?a+"":"object"==typeof a||"function"==typeof a?h[i.call(a)]||"object":typeof a},globalEval:function(a){var b,c=eval;a=n.trim(a),a&&(1===a.indexOf("use strict")?(b=l.createElement("script"),b.text=a,l.head.appendChild(b).parentNode.removeChild(b)):c(a))},camelCase:function(a){return a.replace(p,"ms-").replace(q,r)},nodeName:function(a,b){return a.nodeName&&a.nodeName.toLowerCase()===b.toLowerCase()},each:function(a,b,c){var d,e=0,f=a.length,g=s(a);if(c){if(g){for(;f>e;e++)if(d=b.apply(a[e],c),d===!1)break}else for(e in a)if(d=b.apply(a[e],c),d===!1)break}else if(g){for(;f>e;e++)if(d=b.call(a[e],e,a[e]),d===!1)break}else for(e in a)if(d=b.call(a[e],e,a[e]),d===!1)break;return a},trim:function(a){return null==a?"":(a+"").replace(o,"")},makeArray:function(a,b){var c=b||[];return null!=a&&(s(Object(a))?n.merge(c,"string"==typeof a?[a]:a):f.call(c,a)),c},inArray:function(a,b,c){return null==b?-1:g.call(b,a,c)},merge:function(a,b){for(var c=+b.length,d=0,e=a.length;c>d;d++)a[e++]=b[d];return a.length=e,a},grep:function(a,b,c){for(var d,e=[],f=0,g=a.length,h=!c;g>f;f++)d=!b(a[f],f),d!==h&&e.push(a[f]);return e},map:function(a,b,c){var d,f=0,g=a.length,h=s(a),i=[];if(h)for(;g>f;f++)d=b(a[f],f,c),null!=d&&i.push(d);else for(f in a)d=b(a[f],f,c),null!=d&&i.push(d);return e.apply([],i)},guid:1,proxy:function(a,b){var c,e,f;return"string"==typeof b&&(c=a[b],b=a,a=c),n.isFunction(a)?(e=d.call(arguments,2),f=function(){return a.apply(b||this,e.concat(d.call(arguments)))},f.guid=a.guid=a.guid||n.guid++,f):void 0},now:Date.now,support:k}),n.each("Boolean Number String Function Array Date RegExp Object Error".split(" "),function(a,b){h["[object "+b+"]"]=b.toLowerCase()});function s(a){var b=a.length,c=n.type(a);return"function"===c||n.isWindow(a)?!1:1===a.nodeType&&b?!0:"array"===c||0===b||"number"==typeof b&&b>0&&b-1 in a}var t=function(a){var b,c,d,e,f,g,h,i,j,k,l,m,n,o,p,q,r,s,t,u="sizzle"+-new Date,v=a.document,w=0,x=0,y=gb(),z=gb(),A=gb(),B=function(a,b){return a===b&&(l=!0),0},C="undefined",D=1<<31,E={}.hasOwnProperty,F=[],G=F.pop,H=F.push,I=F.push,J=F.slice,K=F.indexOf||function(a){for(var b=0,c=this.length;c>b;b++)if(this[b]===a)return b;return-1},L="checked|selected|async|autofocus|autoplay|controls|defer|disabled|hidden|ismap|loop|multiple|open|readonly|required|scoped",M="[\\x20\\t\\r\\n\\f]",N="(?:\\\\.|[\\w-]|[^\\x00-\\xa0])+",O=N.replace("w","w#"),P="\\["+M+"*("+N+")(?:"+M+"*([*^$|!~]?=)"+M+"*(?:'((?:\\\\.|[^\\\\'])*)'|\"((?:\\\\.|[^\\\\\"])*)\"|("+O+"))|)"+M+"*\\]",Q=":("+N+")(?:\\((('((?:\\\\.|[^\\\\'])*)'|\"((?:\\\\.|[^\\\\\"])*)\")|((?:\\\\.|[^\\\\()[\\]]|"+P+")*)|.*)\\)|)",R=new RegExp("^"+M+"+|((?:^|[^\\\\])(?:\\\\.)*)"+M+"+$","g"),S=new RegExp("^"+M+"*,"+M+"*"),T=new RegExp("^"+M+"*([>+~]|"+M+")"+M+"*"),U=new RegExp("="+M+"*([^\\]'\"]*?)"+M+"*\\]","g"),V=new RegExp(Q),W=new RegExp("^"+O+"$"),X={ID:new RegExp("^#("+N+")"),CLASS:new RegExp("^\\.("+N+")"),TAG:new RegExp("^("+N.replace("w","w*")+")"),ATTR:new RegExp("^"+P),PSEUDO:new RegExp("^"+Q),CHILD:new RegExp("^:(only|first|last|nth|nth-last)-(child|of-type)(?:\\("+M+"*(even|odd|(([+-]|)(\\d*)n|)"+M+"*(?:([+-]|)"+M+"*(\\d+)|))"+M+"*\\)|)","i"),bool:new RegExp("^(?:"+L+")$","i"),needsContext:new RegExp("^"+M+"*[>+~]|:(even|odd|eq|gt|lt|nth|first|last)(?:\\("+M+"*((?:-\\d)?\\d*)"+M+"*\\)|)(?=[^-]|$)","i")},Y=/^(?:input|select|textarea|button)$/i,Z=/^h\d$/i,$=/^[^{]+\{\s*\[native \w/,_=/^(?:#([\w-]+)|(\w+)|\.([\w-]+))$/,ab=/[+~]/,bb=/'|\\/g,cb=new RegExp("\\\\([\\da-f]{1,6}"+M+"?|("+M+")|.)","ig"),db=function(a,b,c){var d="0x"+b-65536;return d!==d||c?b:0>d?String.fromCharCode(d+65536):String.fromCharCode(d>>10|55296,1023&d|56320)};try{I.apply(F=J.call(v.childNodes),v.childNodes),F[v.childNodes.length].nodeType}catch(eb){I={apply:F.length?function(a,b){H.apply(a,J.call(b))}:function(a,b){var c=a.length,d=0;while(a[c++]=b[d++]);a.length=c-1}}}function fb(a,b,d,e){var f,h,j,k,l,o,r,s,w,x;if((b?b.ownerDocument||b:v)!==n&&m(b),b=b||n,d=d||[],!a||"string"!=typeof a)return d;if(1!==(k=b.nodeType)&&9!==k)return[];if(p&&!e){if(f=_.exec(a))if(j=f[1]){if(9===k){if(h=b.getElementById(j),!h||!h.parentNode)return d;if(h.id===j)return d.push(h),d}else if(b.ownerDocument&&(h=b.ownerDocument.getElementById(j))&&t(b,h)&&h.id===j)return d.push(h),d}else{if(f[2])return I.apply(d,b.getElementsByTagName(a)),d;if((j=f[3])&&c.getElementsByClassName&&b.getElementsByClassName)return I.apply(d,b.getElementsByClassName(j)),d}if(c.qsa&&(!q||!q.test(a))){if(s=r=u,w=b,x=9===k&&a,1===k&&"object"!==b.nodeName.toLowerCase()){o=g(a),(r=b.getAttribute("id"))?s=r.replace(bb,"\\$&"):b.setAttribute("id",s),s="[id='"+s+"'] ",l=o.length;while(l--)o[l]=s+qb(o[l]);w=ab.test(a)&&ob(b.parentNode)||b,x=o.join(",")}if(x)try{return I.apply(d,w.querySelectorAll(x)),d}catch(y){}finally{r||b.removeAttribute("id")}}}return i(a.replace(R,"$1"),b,d,e)}function gb(){var a=[];function b(c,e){return a.push(c+" ")>d.cacheLength&&delete b[a.shift()],b[c+" "]=e}return b}function hb(a){return a[u]=!0,a}function ib(a){var b=n.createElement("div");try{return!!a(b)}catch(c){return!1}finally{b.parentNode&&b.parentNode.removeChild(b),b=null}}function jb(a,b){var c=a.split("|"),e=a.length;while(e--)d.attrHandle[c[e]]=b}function kb(a,b){var c=b&&a,d=c&&1===a.nodeType&&1===b.nodeType&&(~b.sourceIndex||D)-(~a.sourceIndex||D);if(d)return d;if(c)while(c=c.nextSibling)if(c===b)return-1;return a?1:-1}function lb(a){return function(b){var c=b.nodeName.toLowerCase();return"input"===c&&b.type===a}}function mb(a){return function(b){var c=b.nodeName.toLowerCase();return("input"===c||"button"===c)&&b.type===a}}function nb(a){return hb(function(b){return b=+b,hb(function(c,d){var e,f=a([],c.length,b),g=f.length;while(g--)c[e=f[g]]&&(c[e]=!(d[e]=c[e]))})})}function ob(a){return a&&typeof a.getElementsByTagName!==C&&a}c=fb.support={},f=fb.isXML=function(a){var b=a&&(a.ownerDocument||a).documentElement;return b?"HTML"!==b.nodeName:!1},m=fb.setDocument=function(a){var b,e=a?a.ownerDocument||a:v,g=e.defaultView;return e!==n&&9===e.nodeType&&e.documentElement?(n=e,o=e.documentElement,p=!f(e),g&&g!==g.top&&(g.addEventListener?g.addEventListener("unload",function(){m()},!1):g.attachEvent&&g.attachEvent("onunload",function(){m()})),c.attributes=ib(function(a){return a.className="i",!a.getAttribute("className")}),c.getElementsByTagName=ib(function(a){return a.appendChild(e.createComment("")),!a.getElementsByTagName("*").length}),c.getElementsByClassName=$.test(e.getElementsByClassName)&&ib(function(a){return a.innerHTML="<div class='a'></div><div class='a i'></div>",a.firstChild.className="i",2===a.getElementsByClassName("i").length}),c.getById=ib(function(a){return o.appendChild(a).id=u,!e.getElementsByName||!e.getElementsByName(u).length}),c.getById?(d.find.ID=function(a,b){if(typeof b.getElementById!==C&&p){var c=b.getElementById(a);return c&&c.parentNode?[c]:[]}},d.filter.ID=function(a){var b=a.replace(cb,db);return function(a){return a.getAttribute("id")===b}}):(delete d.find.ID,d.filter.ID=function(a){var b=a.replace(cb,db);return function(a){var c=typeof a.getAttributeNode!==C&&a.getAttributeNode("id");return c&&c.value===b}}),d.find.TAG=c.getElementsByTagName?function(a,b){return typeof b.getElementsByTagName!==C?b.getElementsByTagName(a):void 0}:function(a,b){var c,d=[],e=0,f=b.getElementsByTagName(a);if("*"===a){while(c=f[e++])1===c.nodeType&&d.push(c);return d}return f},d.find.CLASS=c.getElementsByClassName&&function(a,b){return typeof b.getElementsByClassName!==C&&p?b.getElementsByClassName(a):void 0},r=[],q=[],(c.qsa=$.test(e.querySelectorAll))&&(ib(function(a){a.innerHTML="<select msallowclip=''><option selected=''></option></select>",a.querySelectorAll("[msallowclip^='']").length&&q.push("[*^$]="+M+"*(?:''|\"\")"),a.querySelectorAll("[selected]").length||q.push("\\["+M+"*(?:value|"+L+")"),a.querySelectorAll(":checked").length||q.push(":checked")}),ib(function(a){var b=e.createElement("input");b.setAttribute("type","hidden"),a.appendChild(b).setAttribute("name","D"),a.querySelectorAll("[name=d]").length&&q.push("name"+M+"*[*^$|!~]?="),a.querySelectorAll(":enabled").length||q.push(":enabled",":disabled"),a.querySelectorAll("*,:x"),q.push(",.*:")})),(c.matchesSelector=$.test(s=o.matches||o.webkitMatchesSelector||o.mozMatchesSelector||o.oMatchesSelector||o.msMatchesSelector))&&ib(function(a){c.disconnectedMatch=s.call(a,"div"),s.call(a,"[s!='']:x"),r.push("!=",Q)}),q=q.length&&new RegExp(q.join("|")),r=r.length&&new RegExp(r.join("|")),b=$.test(o.compareDocumentPosition),t=b||$.test(o.contains)?function(a,b){var c=9===a.nodeType?a.documentElement:a,d=b&&b.parentNode;return a===d||!(!d||1!==d.nodeType||!(c.contains?c.contains(d):a.compareDocumentPosition&&16&a.compareDocumentPosition(d)))}:function(a,b){if(b)while(b=b.parentNode)if(b===a)return!0;return!1},B=b?function(a,b){if(a===b)return l=!0,0;var d=!a.compareDocumentPosition-!b.compareDocumentPosition;return d?d:(d=(a.ownerDocument||a)===(b.ownerDocument||b)?a.compareDocumentPosition(b):1,1&d||!c.sortDetached&&b.compareDocumentPosition(a)===d?a===e||a.ownerDocument===v&&t(v,a)?-1:b===e||b.ownerDocument===v&&t(v,b)?1:k?K.call(k,a)-K.call(k,b):0:4&d?-1:1)}:function(a,b){if(a===b)return l=!0,0;var c,d=0,f=a.parentNode,g=b.parentNode,h=[a],i=[b];if(!f||!g)return a===e?-1:b===e?1:f?-1:g?1:k?K.call(k,a)-K.call(k,b):0;if(f===g)return kb(a,b);c=a;while(c=c.parentNode)h.unshift(c);c=b;while(c=c.parentNode)i.unshift(c);while(h[d]===i[d])d++;return d?kb(h[d],i[d]):h[d]===v?-1:i[d]===v?1:0},e):n},fb.matches=function(a,b){return fb(a,null,null,b)},fb.matchesSelector=function(a,b){if((a.ownerDocument||a)!==n&&m(a),b=b.replace(U,"='$1']"),!(!c.matchesSelector||!p||r&&r.test(b)||q&&q.test(b)))try{var d=s.call(a,b);if(d||c.disconnectedMatch||a.document&&11!==a.document.nodeType)return d}catch(e){}return fb(b,n,null,[a]).length>0},fb.contains=function(a,b){return(a.ownerDocument||a)!==n&&m(a),t(a,b)},fb.attr=function(a,b){(a.ownerDocument||a)!==n&&m(a);var e=d.attrHandle[b.toLowerCase()],f=e&&E.call(d.attrHandle,b.toLowerCase())?e(a,b,!p):void 0;return void 0!==f?f:c.attributes||!p?a.getAttribute(b):(f=a.getAttributeNode(b))&&f.specified?f.value:null},fb.error=function(a){throw new Error("Syntax error, unrecognized expression: "+a)},fb.uniqueSort=function(a){var b,d=[],e=0,f=0;if(l=!c.detectDuplicates,k=!c.sortStable&&a.slice(0),a.sort(B),l){while(b=a[f++])b===a[f]&&(e=d.push(f));while(e--)a.splice(d[e],1)}return k=null,a},e=fb.getText=function(a){var b,c="",d=0,f=a.nodeType;if(f){if(1===f||9===f||11===f){if("string"==typeof a.textContent)return a.textContent;for(a=a.firstChild;a;a=a.nextSibling)c+=e(a)}else if(3===f||4===f)return a.nodeValue}else while(b=a[d++])c+=e(b);return c},d=fb.selectors={cacheLength:50,createPseudo:hb,match:X,attrHandle:{},find:{},relative:{">":{dir:"parentNode",first:!0}," ":{dir:"parentNode"},"+":{dir:"previousSibling",first:!0},"~":{dir:"previousSibling"}},preFilter:{ATTR:function(a){return a[1]=a[1].replace(cb,db),a[3]=(a[3]||a[4]||a[5]||"").replace(cb,db),"~="===a[2]&&(a[3]=" "+a[3]+" "),a.slice(0,4)},CHILD:function(a){return a[1]=a[1].toLowerCase(),"nth"===a[1].slice(0,3)?(a[3]||fb.error(a[0]),a[4]=+(a[4]?a[5]+(a[6]||1):2*("even"===a[3]||"odd"===a[3])),a[5]=+(a[7]+a[8]||"odd"===a[3])):a[3]&&fb.error(a[0]),a},PSEUDO:function(a){var b,c=!a[6]&&a[2];return X.CHILD.test(a[0])?null:(a[3]?a[2]=a[4]||a[5]||"":c&&V.test(c)&&(b=g(c,!0))&&(b=c.indexOf(")",c.length-b)-c.length)&&(a[0]=a[0].slice(0,b),a[2]=c.slice(0,b)),a.slice(0,3))}},filter:{TAG:function(a){var b=a.replace(cb,db).toLowerCase();return"*"===a?function(){return!0}:function(a){return a.nodeName&&a.nodeName.toLowerCase()===b}},CLASS:function(a){var b=y[a+" "];return b||(b=new RegExp("(^|"+M+")"+a+"("+M+"|$)"))&&y(a,function(a){return b.test("string"==typeof a.className&&a.className||typeof a.getAttribute!==C&&a.getAttribute("class")||"")})},ATTR:function(a,b,c){return function(d){var e=fb.attr(d,a);return null==e?"!="===b:b?(e+="","="===b?e===c:"!="===b?e!==c:"^="===b?c&&0===e.indexOf(c):"*="===b?c&&e.indexOf(c)>-1:"$="===b?c&&e.slice(-c.length)===c:"~="===b?(" "+e+" ").indexOf(c)>-1:"|="===b?e===c||e.slice(0,c.length+1)===c+"-":!1):!0}},CHILD:function(a,b,c,d,e){var f="nth"!==a.slice(0,3),g="last"!==a.slice(-4),h="of-type"===b;return 1===d&&0===e?function(a){return!!a.parentNode}:function(b,c,i){var j,k,l,m,n,o,p=f!==g?"nextSibling":"previousSibling",q=b.parentNode,r=h&&b.nodeName.toLowerCase(),s=!i&&!h;if(q){if(f){while(p){l=b;while(l=l[p])if(h?l.nodeName.toLowerCase()===r:1===l.nodeType)return!1;o=p="only"===a&&!o&&"nextSibling"}return!0}if(o=[g?q.firstChild:q.lastChild],g&&s){k=q[u]||(q[u]={}),j=k[a]||[],n=j[0]===w&&j[1],m=j[0]===w&&j[2],l=n&&q.childNodes[n];while(l=++n&&l&&l[p]||(m=n=0)||o.pop())if(1===l.nodeType&&++m&&l===b){k[a]=[w,n,m];break}}else if(s&&(j=(b[u]||(b[u]={}))[a])&&j[0]===w)m=j[1];else while(l=++n&&l&&l[p]||(m=n=0)||o.pop())if((h?l.nodeName.toLowerCase()===r:1===l.nodeType)&&++m&&(s&&((l[u]||(l[u]={}))[a]=[w,m]),l===b))break;return m-=e,m===d||m%d===0&&m/d>=0}}},PSEUDO:function(a,b){var c,e=d.pseudos[a]||d.setFilters[a.toLowerCase()]||fb.error("unsupported pseudo: "+a);return e[u]?e(b):e.length>1?(c=[a,a,"",b],d.setFilters.hasOwnProperty(a.toLowerCase())?hb(function(a,c){var d,f=e(a,b),g=f.length;while(g--)d=K.call(a,f[g]),a[d]=!(c[d]=f[g])}):function(a){return e(a,0,c)}):e}},pseudos:{not:hb(function(a){var b=[],c=[],d=h(a.replace(R,"$1"));return d[u]?hb(function(a,b,c,e){var f,g=d(a,null,e,[]),h=a.length;while(h--)(f=g[h])&&(a[h]=!(b[h]=f))}):function(a,e,f){return b[0]=a,d(b,null,f,c),!c.pop()}}),has:hb(function(a){return function(b){return fb(a,b).length>0}}),contains:hb(function(a){return function(b){return(b.textContent||b.innerText||e(b)).indexOf(a)>-1}}),lang:hb(function(a){return W.test(a||"")||fb.error("unsupported lang: "+a),a=a.replace(cb,db).toLowerCase(),function(b){var c;do if(c=p?b.lang:b.getAttribute("xml:lang")||b.getAttribute("lang"))return c=c.toLowerCase(),c===a||0===c.indexOf(a+"-");while((b=b.parentNode)&&1===b.nodeType);return!1}}),target:function(b){var c=a.location&&a.location.hash;return c&&c.slice(1)===b.id},root:function(a){return a===o},focus:function(a){return a===n.activeElement&&(!n.hasFocus||n.hasFocus())&&!!(a.type||a.href||~a.tabIndex)},enabled:function(a){return a.disabled===!1},disabled:function(a){return a.disabled===!0},checked:function(a){var b=a.nodeName.toLowerCase();return"input"===b&&!!a.checked||"option"===b&&!!a.selected},selected:function(a){return a.parentNode&&a.parentNode.selectedIndex,a.selected===!0},empty:function(a){for(a=a.firstChild;a;a=a.nextSibling)if(a.nodeType<6)return!1;return!0},parent:function(a){return!d.pseudos.empty(a)},header:function(a){return Z.test(a.nodeName)},input:function(a){return Y.test(a.nodeName)},button:function(a){var b=a.nodeName.toLowerCase();return"input"===b&&"button"===a.type||"button"===b},text:function(a){var b;return"input"===a.nodeName.toLowerCase()&&"text"===a.type&&(null==(b=a.getAttribute("type"))||"text"===b.toLowerCase())},first:nb(function(){return[0]}),last:nb(function(a,b){return[b-1]}),eq:nb(function(a,b,c){return[0>c?c+b:c]}),even:nb(function(a,b){for(var c=0;b>c;c+=2)a.push(c);return a}),odd:nb(function(a,b){for(var c=1;b>c;c+=2)a.push(c);return a}),lt:nb(function(a,b,c){for(var d=0>c?c+b:c;--d>=0;)a.push(d);return a}),gt:nb(function(a,b,c){for(var d=0>c?c+b:c;++d<b;)a.push(d);return a})}},d.pseudos.nth=d.pseudos.eq;for(b in{radio:!0,checkbox:!0,file:!0,password:!0,image:!0})d.pseudos[b]=lb(b);for(b in{submit:!0,reset:!0})d.pseudos[b]=mb(b);function pb(){}pb.prototype=d.filters=d.pseudos,d.setFilters=new pb,g=fb.tokenize=function(a,b){var c,e,f,g,h,i,j,k=z[a+" "];if(k)return b?0:k.slice(0);h=a,i=[],j=d.preFilter;while(h){(!c||(e=S.exec(h)))&&(e&&(h=h.slice(e[0].length)||h),i.push(f=[])),c=!1,(e=T.exec(h))&&(c=e.shift(),f.push({value:c,type:e[0].replace(R," ")}),h=h.slice(c.length));for(g in d.filter)!(e=X[g].exec(h))||j[g]&&!(e=j[g](e))||(c=e.shift(),f.push({value:c,type:g,matches:e}),h=h.slice(c.length));if(!c)break}return b?h.length:h?fb.error(a):z(a,i).slice(0)};function qb(a){for(var b=0,c=a.length,d="";c>b;b++)d+=a[b].value;return d}function rb(a,b,c){var d=b.dir,e=c&&"parentNode"===d,f=x++;return b.first?function(b,c,f){while(b=b[d])if(1===b.nodeType||e)return a(b,c,f)}:function(b,c,g){var h,i,j=[w,f];if(g){while(b=b[d])if((1===b.nodeType||e)&&a(b,c,g))return!0}else while(b=b[d])if(1===b.nodeType||e){if(i=b[u]||(b[u]={}),(h=i[d])&&h[0]===w&&h[1]===f)return j[2]=h[2];if(i[d]=j,j[2]=a(b,c,g))return!0}}}function sb(a){return a.length>1?function(b,c,d){var e=a.length;while(e--)if(!a[e](b,c,d))return!1;return!0}:a[0]}function tb(a,b,c){for(var d=0,e=b.length;e>d;d++)fb(a,b[d],c);return c}function ub(a,b,c,d,e){for(var f,g=[],h=0,i=a.length,j=null!=b;i>h;h++)(f=a[h])&&(!c||c(f,d,e))&&(g.push(f),j&&b.push(h));return g}function vb(a,b,c,d,e,f){return d&&!d[u]&&(d=vb(d)),e&&!e[u]&&(e=vb(e,f)),hb(function(f,g,h,i){var j,k,l,m=[],n=[],o=g.length,p=f||tb(b||"*",h.nodeType?[h]:h,[]),q=!a||!f&&b?p:ub(p,m,a,h,i),r=c?e||(f?a:o||d)?[]:g:q;if(c&&c(q,r,h,i),d){j=ub(r,n),d(j,[],h,i),k=j.length;while(k--)(l=j[k])&&(r[n[k]]=!(q[n[k]]=l))}if(f){if(e||a){if(e){j=[],k=r.length;while(k--)(l=r[k])&&j.push(q[k]=l);e(null,r=[],j,i)}k=r.length;while(k--)(l=r[k])&&(j=e?K.call(f,l):m[k])>-1&&(f[j]=!(g[j]=l))}}else r=ub(r===g?r.splice(o,r.length):r),e?e(null,g,r,i):I.apply(g,r)})}function wb(a){for(var b,c,e,f=a.length,g=d.relative[a[0].type],h=g||d.relative[" "],i=g?1:0,k=rb(function(a){return a===b},h,!0),l=rb(function(a){return K.call(b,a)>-1},h,!0),m=[function(a,c,d){return!g&&(d||c!==j)||((b=c).nodeType?k(a,c,d):l(a,c,d))}];f>i;i++)if(c=d.relative[a[i].type])m=[rb(sb(m),c)];else{if(c=d.filter[a[i].type].apply(null,a[i].matches),c[u]){for(e=++i;f>e;e++)if(d.relative[a[e].type])break;return vb(i>1&&sb(m),i>1&&qb(a.slice(0,i-1).concat({value:" "===a[i-2].type?"*":""})).replace(R,"$1"),c,e>i&&wb(a.slice(i,e)),f>e&&wb(a=a.slice(e)),f>e&&qb(a))}m.push(c)}return sb(m)}function xb(a,b){var c=b.length>0,e=a.length>0,f=function(f,g,h,i,k){var l,m,o,p=0,q="0",r=f&&[],s=[],t=j,u=f||e&&d.find.TAG("*",k),v=w+=null==t?1:Math.random()||.1,x=u.length;for(k&&(j=g!==n&&g);q!==x&&null!=(l=u[q]);q++){if(e&&l){m=0;while(o=a[m++])if(o(l,g,h)){i.push(l);break}k&&(w=v)}c&&((l=!o&&l)&&p--,f&&r.push(l))}if(p+=q,c&&q!==p){m=0;while(o=b[m++])o(r,s,g,h);if(f){if(p>0)while(q--)r[q]||s[q]||(s[q]=G.call(i));s=ub(s)}I.apply(i,s),k&&!f&&s.length>0&&p+b.length>1&&fb.uniqueSort(i)}return k&&(w=v,j=t),r};return c?hb(f):f}return h=fb.compile=function(a,b){var c,d=[],e=[],f=A[a+" "];if(!f){b||(b=g(a)),c=b.length;while(c--)f=wb(b[c]),f[u]?d.push(f):e.push(f);f=A(a,xb(e,d)),f.selector=a}return f},i=fb.select=function(a,b,e,f){var i,j,k,l,m,n="function"==typeof a&&a,o=!f&&g(a=n.selector||a);if(e=e||[],1===o.length){if(j=o[0]=o[0].slice(0),j.length>2&&"ID"===(k=j[0]).type&&c.getById&&9===b.nodeType&&p&&d.relative[j[1].type]){if(b=(d.find.ID(k.matches[0].replace(cb,db),b)||[])[0],!b)return e;n&&(b=b.parentNode),a=a.slice(j.shift().value.length)}i=X.needsContext.test(a)?0:j.length;while(i--){if(k=j[i],d.relative[l=k.type])break;if((m=d.find[l])&&(f=m(k.matches[0].replace(cb,db),ab.test(j[0].type)&&ob(b.parentNode)||b))){if(j.splice(i,1),a=f.length&&qb(j),!a)return I.apply(e,f),e;break}}}return(n||h(a,o))(f,b,!p,e,ab.test(a)&&ob(b.parentNode)||b),e},c.sortStable=u.split("").sort(B).join("")===u,c.detectDuplicates=!!l,m(),c.sortDetached=ib(function(a){return 1&a.compareDocumentPosition(n.createElement("div"))}),ib(function(a){return a.innerHTML="<a href='#'></a>","#"===a.firstChild.getAttribute("href")})||jb("type|href|height|width",function(a,b,c){return c?void 0:a.getAttribute(b,"type"===b.toLowerCase()?1:2)}),c.attributes&&ib(function(a){return a.innerHTML="<input/>",a.firstChild.setAttribute("value",""),""===a.firstChild.getAttribute("value")})||jb("value",function(a,b,c){return c||"input"!==a.nodeName.toLowerCase()?void 0:a.defaultValue}),ib(function(a){return null==a.getAttribute("disabled")})||jb(L,function(a,b,c){var d;return c?void 0:a[b]===!0?b.toLowerCase():(d=a.getAttributeNode(b))&&d.specified?d.value:null}),fb}(a);n.find=t,n.expr=t.selectors,n.expr[":"]=n.expr.pseudos,n.unique=t.uniqueSort,n.text=t.getText,n.isXMLDoc=t.isXML,n.contains=t.contains;var u=n.expr.match.needsContext,v=/^<(\w+)\s*\/?>(?:<\/\1>|)$/,w=/^.[^:#\[\.,]*$/;function x(a,b,c){if(n.isFunction(b))return n.grep(a,function(a,d){return!!b.call(a,d,a)!==c});if(b.nodeType)return n.grep(a,function(a){return a===b!==c});if("string"==typeof b){if(w.test(b))return n.filter(b,a,c);b=n.filter(b,a)}return n.grep(a,function(a){return g.call(b,a)>=0!==c})}n.filter=function(a,b,c){var d=b[0];return c&&(a=":not("+a+")"),1===b.length&&1===d.nodeType?n.find.matchesSelector(d,a)?[d]:[]:n.find.matches(a,n.grep(b,function(a){return 1===a.nodeType}))},n.fn.extend({find:function(a){var b,c=this.length,d=[],e=this;if("string"!=typeof a)return this.pushStack(n(a).filter(function(){for(b=0;c>b;b++)if(n.contains(e[b],this))return!0}));for(b=0;c>b;b++)n.find(a,e[b],d);return d=this.pushStack(c>1?n.unique(d):d),d.selector=this.selector?this.selector+" "+a:a,d},filter:function(a){return this.pushStack(x(this,a||[],!1))},not:function(a){return this.pushStack(x(this,a||[],!0))},is:function(a){return!!x(this,"string"==typeof a&&u.test(a)?n(a):a||[],!1).length}});var y,z=/^(?:\s*(<[\w\W]+>)[^>]*|#([\w-]*))$/,A=n.fn.init=function(a,b){var c,d;if(!a)return this;if("string"==typeof a){if(c="<"===a[0]&&">"===a[a.length-1]&&a.length>=3?[null,a,null]:z.exec(a),!c||!c[1]&&b)return!b||b.jquery?(b||y).find(a):this.constructor(b).find(a);if(c[1]){if(b=b instanceof n?b[0]:b,n.merge(this,n.parseHTML(c[1],b&&b.nodeType?b.ownerDocument||b:l,!0)),v.test(c[1])&&n.isPlainObject(b))for(c in b)n.isFunction(this[c])?this[c](b[c]):this.attr(c,b[c]);return this}return d=l.getElementById(c[2]),d&&d.parentNode&&(this.length=1,this[0]=d),this.context=l,this.selector=a,this}return a.nodeType?(this.context=this[0]=a,this.length=1,this):n.isFunction(a)?"undefined"!=typeof y.ready?y.ready(a):a(n):(void 0!==a.selector&&(this.selector=a.selector,this.context=a.context),n.makeArray(a,this))};A.prototype=n.fn,y=n(l);var B=/^(?:parents|prev(?:Until|All))/,C={children:!0,contents:!0,next:!0,prev:!0};n.extend({dir:function(a,b,c){var d=[],e=void 0!==c;while((a=a[b])&&9!==a.nodeType)if(1===a.nodeType){if(e&&n(a).is(c))break;d.push(a)}return d},sibling:function(a,b){for(var c=[];a;a=a.nextSibling)1===a.nodeType&&a!==b&&c.push(a);return c}}),n.fn.extend({has:function(a){var b=n(a,this),c=b.length;return this.filter(function(){for(var a=0;c>a;a++)if(n.contains(this,b[a]))return!0})},closest:function(a,b){for(var c,d=0,e=this.length,f=[],g=u.test(a)||"string"!=typeof a?n(a,b||this.context):0;e>d;d++)for(c=this[d];c&&c!==b;c=c.parentNode)if(c.nodeType<11&&(g?g.index(c)>-1:1===c.nodeType&&n.find.matchesSelector(c,a))){f.push(c);break}return this.pushStack(f.length>1?n.unique(f):f)},index:function(a){return a?"string"==typeof a?g.call(n(a),this[0]):g.call(this,a.jquery?a[0]:a):this[0]&&this[0].parentNode?this.first().prevAll().length:-1},add:function(a,b){return this.pushStack(n.unique(n.merge(this.get(),n(a,b))))},addBack:function(a){return this.add(null==a?this.prevObject:this.prevObject.filter(a))}});function D(a,b){while((a=a[b])&&1!==a.nodeType);return a}n.each({parent:function(a){var b=a.parentNode;return b&&11!==b.nodeType?b:null},parents:function(a){return n.dir(a,"parentNode")},parentsUntil:function(a,b,c){return n.dir(a,"parentNode",c)},next:function(a){return D(a,"nextSibling")},prev:function(a){return D(a,"previousSibling")},nextAll:function(a){return n.dir(a,"nextSibling")},prevAll:function(a){return n.dir(a,"previousSibling")},nextUntil:function(a,b,c){return n.dir(a,"nextSibling",c)},prevUntil:function(a,b,c){return n.dir(a,"previousSibling",c)},siblings:function(a){return n.sibling((a.parentNode||{}).firstChild,a)},children:function(a){return n.sibling(a.firstChild)},contents:function(a){return a.contentDocument||n.merge([],a.childNodes)}},function(a,b){n.fn[a]=function(c,d){var e=n.map(this,b,c);return"Until"!==a.slice(-5)&&(d=c),d&&"string"==typeof d&&(e=n.filter(d,e)),this.length>1&&(C[a]||n.unique(e),B.test(a)&&e.reverse()),this.pushStack(e)}});var E=/\S+/g,F={};function G(a){var b=F[a]={};return n.each(a.match(E)||[],function(a,c){b[c]=!0}),b}n.Callbacks=function(a){a="string"==typeof a?F[a]||G(a):n.extend({},a);var b,c,d,e,f,g,h=[],i=!a.once&&[],j=function(l){for(b=a.memory&&l,c=!0,g=e||0,e=0,f=h.length,d=!0;h&&f>g;g++)if(h[g].apply(l[0],l[1])===!1&&a.stopOnFalse){b=!1;break}d=!1,h&&(i?i.length&&j(i.shift()):b?h=[]:k.disable())},k={add:function(){if(h){var c=h.length;!function g(b){n.each(b,function(b,c){var d=n.type(c);"function"===d?a.unique&&k.has(c)||h.push(c):c&&c.length&&"string"!==d&&g(c)})}(arguments),d?f=h.length:b&&(e=c,j(b))}return this},remove:function(){return h&&n.each(arguments,function(a,b){var c;while((c=n.inArray(b,h,c))>-1)h.splice(c,1),d&&(f>=c&&f--,g>=c&&g--)}),this},has:function(a){return a?n.inArray(a,h)>-1:!(!h||!h.length)},empty:function(){return h=[],f=0,this},disable:function(){return h=i=b=void 0,this},disabled:function(){return!h},lock:function(){return i=void 0,b||k.disable(),this},locked:function(){return!i},fireWith:function(a,b){return!h||c&&!i||(b=b||[],b=[a,b.slice?b.slice():b],d?i.push(b):j(b)),this},fire:function(){return k.fireWith(this,arguments),this},fired:function(){return!!c}};return k},n.extend({Deferred:function(a){var b=[["resolve","done",n.Callbacks("once memory"),"resolved"],["reject","fail",n.Callbacks("once memory"),"rejected"],["notify","progress",n.Callbacks("memory")]],c="pending",d={state:function(){return c},always:function(){return e.done(arguments).fail(arguments),this},then:function(){var a=arguments;return n.Deferred(function(c){n.each(b,function(b,f){var g=n.isFunction(a[b])&&a[b];e[f[1]](function(){var a=g&&g.apply(this,arguments);a&&n.isFunction(a.promise)?a.promise().done(c.resolve).fail(c.reject).progress(c.notify):c[f[0]+"With"](this===d?c.promise():this,g?[a]:arguments)})}),a=null}).promise()},promise:function(a){return null!=a?n.extend(a,d):d}},e={};return d.pipe=d.then,n.each(b,function(a,f){var g=f[2],h=f[3];d[f[1]]=g.add,h&&g.add(function(){c=h},b[1^a][2].disable,b[2][2].lock),e[f[0]]=function(){return e[f[0]+"With"](this===e?d:this,arguments),this},e[f[0]+"With"]=g.fireWith}),d.promise(e),a&&a.call(e,e),e},when:function(a){var b=0,c=d.call(arguments),e=c.length,f=1!==e||a&&n.isFunction(a.promise)?e:0,g=1===f?a:n.Deferred(),h=function(a,b,c){return function(e){b[a]=this,c[a]=arguments.length>1?d.call(arguments):e,c===i?g.notifyWith(b,c):--f||g.resolveWith(b,c)}},i,j,k;if(e>1)for(i=new Array(e),j=new Array(e),k=new Array(e);e>b;b++)c[b]&&n.isFunction(c[b].promise)?c[b].promise().done(h(b,k,c)).fail(g.reject).progress(h(b,j,i)):--f;return f||g.resolveWith(k,c),g.promise()}});var H;n.fn.ready=function(a){return n.ready.promise().done(a),this},n.extend({isReady:!1,readyWait:1,holdReady:function(a){a?n.readyWait++:n.ready(!0)},ready:function(a){(a===!0?--n.readyWait:n.isReady)||(n.isReady=!0,a!==!0&&--n.readyWait>0||(H.resolveWith(l,[n]),n.fn.triggerHandler&&(n(l).triggerHandler("ready"),n(l).off("ready"))))}});function I(){l.removeEventListener("DOMContentLoaded",I,!1),a.removeEventListener("load",I,!1),n.ready()}n.ready.promise=function(b){return H||(H=n.Deferred(),"complete"===l.readyState?setTimeout(n.ready):(l.addEventListener("DOMContentLoaded",I,!1),a.addEventListener("load",I,!1))),H.promise(b)},n.ready.promise();var J=n.access=function(a,b,c,d,e,f,g){var h=0,i=a.length,j=null==c;if("object"===n.type(c)){e=!0;for(h in c)n.access(a,b,h,c[h],!0,f,g)}else if(void 0!==d&&(e=!0,n.isFunction(d)||(g=!0),j&&(g?(b.call(a,d),b=null):(j=b,b=function(a,b,c){return j.call(n(a),c)})),b))for(;i>h;h++)b(a[h],c,g?d:d.call(a[h],h,b(a[h],c)));return e?a:j?b.call(a):i?b(a[0],c):f};n.acceptData=function(a){return 1===a.nodeType||9===a.nodeType||!+a.nodeType};function K(){Object.defineProperty(this.cache={},0,{get:function(){return{}}}),this.expando=n.expando+Math.random()}K.uid=1,K.accepts=n.acceptData,K.prototype={key:function(a){if(!K.accepts(a))return 0;var b={},c=a[this.expando];if(!c){c=K.uid++;try{b[this.expando]={value:c},Object.defineProperties(a,b)}catch(d){b[this.expando]=c,n.extend(a,b)}}return this.cache[c]||(this.cache[c]={}),c},set:function(a,b,c){var d,e=this.key(a),f=this.cache[e];if("string"==typeof b)f[b]=c;else if(n.isEmptyObject(f))n.extend(this.cache[e],b);else for(d in b)f[d]=b[d];return f},get:function(a,b){var c=this.cache[this.key(a)];return void 0===b?c:c[b]},access:function(a,b,c){var d;return void 0===b||b&&"string"==typeof b&&void 0===c?(d=this.get(a,b),void 0!==d?d:this.get(a,n.camelCase(b))):(this.set(a,b,c),void 0!==c?c:b)},remove:function(a,b){var c,d,e,f=this.key(a),g=this.cache[f];if(void 0===b)this.cache[f]={};else{n.isArray(b)?d=b.concat(b.map(n.camelCase)):(e=n.camelCase(b),b in g?d=[b,e]:(d=e,d=d in g?[d]:d.match(E)||[])),c=d.length;while(c--)delete g[d[c]]}},hasData:function(a){return!n.isEmptyObject(this.cache[a[this.expando]]||{})},discard:function(a){a[this.expando]&&delete this.cache[a[this.expando]]}};var L=new K,M=new K,N=/^(?:\{[\w\W]*\}|\[[\w\W]*\])$/,O=/([A-Z])/g;function P(a,b,c){var d;if(void 0===c&&1===a.nodeType)if(d="data-"+b.replace(O,"-$1").toLowerCase(),c=a.getAttribute(d),"string"==typeof c){try{c="true"===c?!0:"false"===c?!1:"null"===c?null:+c+""===c?+c:N.test(c)?n.parseJSON(c):c}catch(e){}M.set(a,b,c)}else c=void 0;return c}n.extend({hasData:function(a){return M.hasData(a)||L.hasData(a)},data:function(a,b,c){return M.access(a,b,c)},removeData:function(a,b){M.remove(a,b) +},_data:function(a,b,c){return L.access(a,b,c)},_removeData:function(a,b){L.remove(a,b)}}),n.fn.extend({data:function(a,b){var c,d,e,f=this[0],g=f&&f.attributes;if(void 0===a){if(this.length&&(e=M.get(f),1===f.nodeType&&!L.get(f,"hasDataAttrs"))){c=g.length;while(c--)g[c]&&(d=g[c].name,0===d.indexOf("data-")&&(d=n.camelCase(d.slice(5)),P(f,d,e[d])));L.set(f,"hasDataAttrs",!0)}return e}return"object"==typeof a?this.each(function(){M.set(this,a)}):J(this,function(b){var c,d=n.camelCase(a);if(f&&void 0===b){if(c=M.get(f,a),void 0!==c)return c;if(c=M.get(f,d),void 0!==c)return c;if(c=P(f,d,void 0),void 0!==c)return c}else this.each(function(){var c=M.get(this,d);M.set(this,d,b),-1!==a.indexOf("-")&&void 0!==c&&M.set(this,a,b)})},null,b,arguments.length>1,null,!0)},removeData:function(a){return this.each(function(){M.remove(this,a)})}}),n.extend({queue:function(a,b,c){var d;return a?(b=(b||"fx")+"queue",d=L.get(a,b),c&&(!d||n.isArray(c)?d=L.access(a,b,n.makeArray(c)):d.push(c)),d||[]):void 0},dequeue:function(a,b){b=b||"fx";var c=n.queue(a,b),d=c.length,e=c.shift(),f=n._queueHooks(a,b),g=function(){n.dequeue(a,b)};"inprogress"===e&&(e=c.shift(),d--),e&&("fx"===b&&c.unshift("inprogress"),delete f.stop,e.call(a,g,f)),!d&&f&&f.empty.fire()},_queueHooks:function(a,b){var c=b+"queueHooks";return L.get(a,c)||L.access(a,c,{empty:n.Callbacks("once memory").add(function(){L.remove(a,[b+"queue",c])})})}}),n.fn.extend({queue:function(a,b){var c=2;return"string"!=typeof a&&(b=a,a="fx",c--),arguments.length<c?n.queue(this[0],a):void 0===b?this:this.each(function(){var c=n.queue(this,a,b);n._queueHooks(this,a),"fx"===a&&"inprogress"!==c[0]&&n.dequeue(this,a)})},dequeue:function(a){return this.each(function(){n.dequeue(this,a)})},clearQueue:function(a){return this.queue(a||"fx",[])},promise:function(a,b){var c,d=1,e=n.Deferred(),f=this,g=this.length,h=function(){--d||e.resolveWith(f,[f])};"string"!=typeof a&&(b=a,a=void 0),a=a||"fx";while(g--)c=L.get(f[g],a+"queueHooks"),c&&c.empty&&(d++,c.empty.add(h));return h(),e.promise(b)}});var Q=/[+-]?(?:\d*\.|)\d+(?:[eE][+-]?\d+|)/.source,R=["Top","Right","Bottom","Left"],S=function(a,b){return a=b||a,"none"===n.css(a,"display")||!n.contains(a.ownerDocument,a)},T=/^(?:checkbox|radio)$/i;!function(){var a=l.createDocumentFragment(),b=a.appendChild(l.createElement("div")),c=l.createElement("input");c.setAttribute("type","radio"),c.setAttribute("checked","checked"),c.setAttribute("name","t"),b.appendChild(c),k.checkClone=b.cloneNode(!0).cloneNode(!0).lastChild.checked,b.innerHTML="<textarea>x</textarea>",k.noCloneChecked=!!b.cloneNode(!0).lastChild.defaultValue}();var U="undefined";k.focusinBubbles="onfocusin"in a;var V=/^key/,W=/^(?:mouse|pointer|contextmenu)|click/,X=/^(?:focusinfocus|focusoutblur)$/,Y=/^([^.]*)(?:\.(.+)|)$/;function Z(){return!0}function $(){return!1}function _(){try{return l.activeElement}catch(a){}}n.event={global:{},add:function(a,b,c,d,e){var f,g,h,i,j,k,l,m,o,p,q,r=L.get(a);if(r){c.handler&&(f=c,c=f.handler,e=f.selector),c.guid||(c.guid=n.guid++),(i=r.events)||(i=r.events={}),(g=r.handle)||(g=r.handle=function(b){return typeof n!==U&&n.event.triggered!==b.type?n.event.dispatch.apply(a,arguments):void 0}),b=(b||"").match(E)||[""],j=b.length;while(j--)h=Y.exec(b[j])||[],o=q=h[1],p=(h[2]||"").split(".").sort(),o&&(l=n.event.special[o]||{},o=(e?l.delegateType:l.bindType)||o,l=n.event.special[o]||{},k=n.extend({type:o,origType:q,data:d,handler:c,guid:c.guid,selector:e,needsContext:e&&n.expr.match.needsContext.test(e),namespace:p.join(".")},f),(m=i[o])||(m=i[o]=[],m.delegateCount=0,l.setup&&l.setup.call(a,d,p,g)!==!1||a.addEventListener&&a.addEventListener(o,g,!1)),l.add&&(l.add.call(a,k),k.handler.guid||(k.handler.guid=c.guid)),e?m.splice(m.delegateCount++,0,k):m.push(k),n.event.global[o]=!0)}},remove:function(a,b,c,d,e){var f,g,h,i,j,k,l,m,o,p,q,r=L.hasData(a)&&L.get(a);if(r&&(i=r.events)){b=(b||"").match(E)||[""],j=b.length;while(j--)if(h=Y.exec(b[j])||[],o=q=h[1],p=(h[2]||"").split(".").sort(),o){l=n.event.special[o]||{},o=(d?l.delegateType:l.bindType)||o,m=i[o]||[],h=h[2]&&new RegExp("(^|\\.)"+p.join("\\.(?:.*\\.|)")+"(\\.|$)"),g=f=m.length;while(f--)k=m[f],!e&&q!==k.origType||c&&c.guid!==k.guid||h&&!h.test(k.namespace)||d&&d!==k.selector&&("**"!==d||!k.selector)||(m.splice(f,1),k.selector&&m.delegateCount--,l.remove&&l.remove.call(a,k));g&&!m.length&&(l.teardown&&l.teardown.call(a,p,r.handle)!==!1||n.removeEvent(a,o,r.handle),delete i[o])}else for(o in i)n.event.remove(a,o+b[j],c,d,!0);n.isEmptyObject(i)&&(delete r.handle,L.remove(a,"events"))}},trigger:function(b,c,d,e){var f,g,h,i,k,m,o,p=[d||l],q=j.call(b,"type")?b.type:b,r=j.call(b,"namespace")?b.namespace.split("."):[];if(g=h=d=d||l,3!==d.nodeType&&8!==d.nodeType&&!X.test(q+n.event.triggered)&&(q.indexOf(".")>=0&&(r=q.split("."),q=r.shift(),r.sort()),k=q.indexOf(":")<0&&"on"+q,b=b[n.expando]?b:new n.Event(q,"object"==typeof b&&b),b.isTrigger=e?2:3,b.namespace=r.join("."),b.namespace_re=b.namespace?new RegExp("(^|\\.)"+r.join("\\.(?:.*\\.|)")+"(\\.|$)"):null,b.result=void 0,b.target||(b.target=d),c=null==c?[b]:n.makeArray(c,[b]),o=n.event.special[q]||{},e||!o.trigger||o.trigger.apply(d,c)!==!1)){if(!e&&!o.noBubble&&!n.isWindow(d)){for(i=o.delegateType||q,X.test(i+q)||(g=g.parentNode);g;g=g.parentNode)p.push(g),h=g;h===(d.ownerDocument||l)&&p.push(h.defaultView||h.parentWindow||a)}f=0;while((g=p[f++])&&!b.isPropagationStopped())b.type=f>1?i:o.bindType||q,m=(L.get(g,"events")||{})[b.type]&&L.get(g,"handle"),m&&m.apply(g,c),m=k&&g[k],m&&m.apply&&n.acceptData(g)&&(b.result=m.apply(g,c),b.result===!1&&b.preventDefault());return b.type=q,e||b.isDefaultPrevented()||o._default&&o._default.apply(p.pop(),c)!==!1||!n.acceptData(d)||k&&n.isFunction(d[q])&&!n.isWindow(d)&&(h=d[k],h&&(d[k]=null),n.event.triggered=q,d[q](),n.event.triggered=void 0,h&&(d[k]=h)),b.result}},dispatch:function(a){a=n.event.fix(a);var b,c,e,f,g,h=[],i=d.call(arguments),j=(L.get(this,"events")||{})[a.type]||[],k=n.event.special[a.type]||{};if(i[0]=a,a.delegateTarget=this,!k.preDispatch||k.preDispatch.call(this,a)!==!1){h=n.event.handlers.call(this,a,j),b=0;while((f=h[b++])&&!a.isPropagationStopped()){a.currentTarget=f.elem,c=0;while((g=f.handlers[c++])&&!a.isImmediatePropagationStopped())(!a.namespace_re||a.namespace_re.test(g.namespace))&&(a.handleObj=g,a.data=g.data,e=((n.event.special[g.origType]||{}).handle||g.handler).apply(f.elem,i),void 0!==e&&(a.result=e)===!1&&(a.preventDefault(),a.stopPropagation()))}return k.postDispatch&&k.postDispatch.call(this,a),a.result}},handlers:function(a,b){var c,d,e,f,g=[],h=b.delegateCount,i=a.target;if(h&&i.nodeType&&(!a.button||"click"!==a.type))for(;i!==this;i=i.parentNode||this)if(i.disabled!==!0||"click"!==a.type){for(d=[],c=0;h>c;c++)f=b[c],e=f.selector+" ",void 0===d[e]&&(d[e]=f.needsContext?n(e,this).index(i)>=0:n.find(e,this,null,[i]).length),d[e]&&d.push(f);d.length&&g.push({elem:i,handlers:d})}return h<b.length&&g.push({elem:this,handlers:b.slice(h)}),g},props:"altKey bubbles cancelable ctrlKey currentTarget eventPhase metaKey relatedTarget shiftKey target timeStamp view which".split(" "),fixHooks:{},keyHooks:{props:"char charCode key keyCode".split(" "),filter:function(a,b){return null==a.which&&(a.which=null!=b.charCode?b.charCode:b.keyCode),a}},mouseHooks:{props:"button buttons clientX clientY offsetX offsetY pageX pageY screenX screenY toElement".split(" "),filter:function(a,b){var c,d,e,f=b.button;return null==a.pageX&&null!=b.clientX&&(c=a.target.ownerDocument||l,d=c.documentElement,e=c.body,a.pageX=b.clientX+(d&&d.scrollLeft||e&&e.scrollLeft||0)-(d&&d.clientLeft||e&&e.clientLeft||0),a.pageY=b.clientY+(d&&d.scrollTop||e&&e.scrollTop||0)-(d&&d.clientTop||e&&e.clientTop||0)),a.which||void 0===f||(a.which=1&f?1:2&f?3:4&f?2:0),a}},fix:function(a){if(a[n.expando])return a;var b,c,d,e=a.type,f=a,g=this.fixHooks[e];g||(this.fixHooks[e]=g=W.test(e)?this.mouseHooks:V.test(e)?this.keyHooks:{}),d=g.props?this.props.concat(g.props):this.props,a=new n.Event(f),b=d.length;while(b--)c=d[b],a[c]=f[c];return a.target||(a.target=l),3===a.target.nodeType&&(a.target=a.target.parentNode),g.filter?g.filter(a,f):a},special:{load:{noBubble:!0},focus:{trigger:function(){return this!==_()&&this.focus?(this.focus(),!1):void 0},delegateType:"focusin"},blur:{trigger:function(){return this===_()&&this.blur?(this.blur(),!1):void 0},delegateType:"focusout"},click:{trigger:function(){return"checkbox"===this.type&&this.click&&n.nodeName(this,"input")?(this.click(),!1):void 0},_default:function(a){return n.nodeName(a.target,"a")}},beforeunload:{postDispatch:function(a){void 0!==a.result&&a.originalEvent&&(a.originalEvent.returnValue=a.result)}}},simulate:function(a,b,c,d){var e=n.extend(new n.Event,c,{type:a,isSimulated:!0,originalEvent:{}});d?n.event.trigger(e,null,b):n.event.dispatch.call(b,e),e.isDefaultPrevented()&&c.preventDefault()}},n.removeEvent=function(a,b,c){a.removeEventListener&&a.removeEventListener(b,c,!1)},n.Event=function(a,b){return this instanceof n.Event?(a&&a.type?(this.originalEvent=a,this.type=a.type,this.isDefaultPrevented=a.defaultPrevented||void 0===a.defaultPrevented&&a.returnValue===!1?Z:$):this.type=a,b&&n.extend(this,b),this.timeStamp=a&&a.timeStamp||n.now(),void(this[n.expando]=!0)):new n.Event(a,b)},n.Event.prototype={isDefaultPrevented:$,isPropagationStopped:$,isImmediatePropagationStopped:$,preventDefault:function(){var a=this.originalEvent;this.isDefaultPrevented=Z,a&&a.preventDefault&&a.preventDefault()},stopPropagation:function(){var a=this.originalEvent;this.isPropagationStopped=Z,a&&a.stopPropagation&&a.stopPropagation()},stopImmediatePropagation:function(){var a=this.originalEvent;this.isImmediatePropagationStopped=Z,a&&a.stopImmediatePropagation&&a.stopImmediatePropagation(),this.stopPropagation()}},n.each({mouseenter:"mouseover",mouseleave:"mouseout",pointerenter:"pointerover",pointerleave:"pointerout"},function(a,b){n.event.special[a]={delegateType:b,bindType:b,handle:function(a){var c,d=this,e=a.relatedTarget,f=a.handleObj;return(!e||e!==d&&!n.contains(d,e))&&(a.type=f.origType,c=f.handler.apply(this,arguments),a.type=b),c}}}),k.focusinBubbles||n.each({focus:"focusin",blur:"focusout"},function(a,b){var c=function(a){n.event.simulate(b,a.target,n.event.fix(a),!0)};n.event.special[b]={setup:function(){var d=this.ownerDocument||this,e=L.access(d,b);e||d.addEventListener(a,c,!0),L.access(d,b,(e||0)+1)},teardown:function(){var d=this.ownerDocument||this,e=L.access(d,b)-1;e?L.access(d,b,e):(d.removeEventListener(a,c,!0),L.remove(d,b))}}}),n.fn.extend({on:function(a,b,c,d,e){var f,g;if("object"==typeof a){"string"!=typeof b&&(c=c||b,b=void 0);for(g in a)this.on(g,b,c,a[g],e);return this}if(null==c&&null==d?(d=b,c=b=void 0):null==d&&("string"==typeof b?(d=c,c=void 0):(d=c,c=b,b=void 0)),d===!1)d=$;else if(!d)return this;return 1===e&&(f=d,d=function(a){return n().off(a),f.apply(this,arguments)},d.guid=f.guid||(f.guid=n.guid++)),this.each(function(){n.event.add(this,a,d,c,b)})},one:function(a,b,c,d){return this.on(a,b,c,d,1)},off:function(a,b,c){var d,e;if(a&&a.preventDefault&&a.handleObj)return d=a.handleObj,n(a.delegateTarget).off(d.namespace?d.origType+"."+d.namespace:d.origType,d.selector,d.handler),this;if("object"==typeof a){for(e in a)this.off(e,b,a[e]);return this}return(b===!1||"function"==typeof b)&&(c=b,b=void 0),c===!1&&(c=$),this.each(function(){n.event.remove(this,a,c,b)})},trigger:function(a,b){return this.each(function(){n.event.trigger(a,b,this)})},triggerHandler:function(a,b){var c=this[0];return c?n.event.trigger(a,b,c,!0):void 0}});var ab=/<(?!area|br|col|embed|hr|img|input|link|meta|param)(([\w:]+)[^>]*)\/>/gi,bb=/<([\w:]+)/,cb=/<|&#?\w+;/,db=/<(?:script|style|link)/i,eb=/checked\s*(?:[^=]|=\s*.checked.)/i,fb=/^$|\/(?:java|ecma)script/i,gb=/^true\/(.*)/,hb=/^\s*<!(?:\[CDATA\[|--)|(?:\]\]|--)>\s*$/g,ib={option:[1,"<select multiple='multiple'>","</select>"],thead:[1,"<table>","</table>"],col:[2,"<table><colgroup>","</colgroup></table>"],tr:[2,"<table><tbody>","</tbody></table>"],td:[3,"<table><tbody><tr>","</tr></tbody></table>"],_default:[0,"",""]};ib.optgroup=ib.option,ib.tbody=ib.tfoot=ib.colgroup=ib.caption=ib.thead,ib.th=ib.td;function jb(a,b){return n.nodeName(a,"table")&&n.nodeName(11!==b.nodeType?b:b.firstChild,"tr")?a.getElementsByTagName("tbody")[0]||a.appendChild(a.ownerDocument.createElement("tbody")):a}function kb(a){return a.type=(null!==a.getAttribute("type"))+"/"+a.type,a}function lb(a){var b=gb.exec(a.type);return b?a.type=b[1]:a.removeAttribute("type"),a}function mb(a,b){for(var c=0,d=a.length;d>c;c++)L.set(a[c],"globalEval",!b||L.get(b[c],"globalEval"))}function nb(a,b){var c,d,e,f,g,h,i,j;if(1===b.nodeType){if(L.hasData(a)&&(f=L.access(a),g=L.set(b,f),j=f.events)){delete g.handle,g.events={};for(e in j)for(c=0,d=j[e].length;d>c;c++)n.event.add(b,e,j[e][c])}M.hasData(a)&&(h=M.access(a),i=n.extend({},h),M.set(b,i))}}function ob(a,b){var c=a.getElementsByTagName?a.getElementsByTagName(b||"*"):a.querySelectorAll?a.querySelectorAll(b||"*"):[];return void 0===b||b&&n.nodeName(a,b)?n.merge([a],c):c}function pb(a,b){var c=b.nodeName.toLowerCase();"input"===c&&T.test(a.type)?b.checked=a.checked:("input"===c||"textarea"===c)&&(b.defaultValue=a.defaultValue)}n.extend({clone:function(a,b,c){var d,e,f,g,h=a.cloneNode(!0),i=n.contains(a.ownerDocument,a);if(!(k.noCloneChecked||1!==a.nodeType&&11!==a.nodeType||n.isXMLDoc(a)))for(g=ob(h),f=ob(a),d=0,e=f.length;e>d;d++)pb(f[d],g[d]);if(b)if(c)for(f=f||ob(a),g=g||ob(h),d=0,e=f.length;e>d;d++)nb(f[d],g[d]);else nb(a,h);return g=ob(h,"script"),g.length>0&&mb(g,!i&&ob(a,"script")),h},buildFragment:function(a,b,c,d){for(var e,f,g,h,i,j,k=b.createDocumentFragment(),l=[],m=0,o=a.length;o>m;m++)if(e=a[m],e||0===e)if("object"===n.type(e))n.merge(l,e.nodeType?[e]:e);else if(cb.test(e)){f=f||k.appendChild(b.createElement("div")),g=(bb.exec(e)||["",""])[1].toLowerCase(),h=ib[g]||ib._default,f.innerHTML=h[1]+e.replace(ab,"<$1></$2>")+h[2],j=h[0];while(j--)f=f.lastChild;n.merge(l,f.childNodes),f=k.firstChild,f.textContent=""}else l.push(b.createTextNode(e));k.textContent="",m=0;while(e=l[m++])if((!d||-1===n.inArray(e,d))&&(i=n.contains(e.ownerDocument,e),f=ob(k.appendChild(e),"script"),i&&mb(f),c)){j=0;while(e=f[j++])fb.test(e.type||"")&&c.push(e)}return k},cleanData:function(a){for(var b,c,d,e,f=n.event.special,g=0;void 0!==(c=a[g]);g++){if(n.acceptData(c)&&(e=c[L.expando],e&&(b=L.cache[e]))){if(b.events)for(d in b.events)f[d]?n.event.remove(c,d):n.removeEvent(c,d,b.handle);L.cache[e]&&delete L.cache[e]}delete M.cache[c[M.expando]]}}}),n.fn.extend({text:function(a){return J(this,function(a){return void 0===a?n.text(this):this.empty().each(function(){(1===this.nodeType||11===this.nodeType||9===this.nodeType)&&(this.textContent=a)})},null,a,arguments.length)},append:function(){return this.domManip(arguments,function(a){if(1===this.nodeType||11===this.nodeType||9===this.nodeType){var b=jb(this,a);b.appendChild(a)}})},prepend:function(){return this.domManip(arguments,function(a){if(1===this.nodeType||11===this.nodeType||9===this.nodeType){var b=jb(this,a);b.insertBefore(a,b.firstChild)}})},before:function(){return this.domManip(arguments,function(a){this.parentNode&&this.parentNode.insertBefore(a,this)})},after:function(){return this.domManip(arguments,function(a){this.parentNode&&this.parentNode.insertBefore(a,this.nextSibling)})},remove:function(a,b){for(var c,d=a?n.filter(a,this):this,e=0;null!=(c=d[e]);e++)b||1!==c.nodeType||n.cleanData(ob(c)),c.parentNode&&(b&&n.contains(c.ownerDocument,c)&&mb(ob(c,"script")),c.parentNode.removeChild(c));return this},empty:function(){for(var a,b=0;null!=(a=this[b]);b++)1===a.nodeType&&(n.cleanData(ob(a,!1)),a.textContent="");return this},clone:function(a,b){return a=null==a?!1:a,b=null==b?a:b,this.map(function(){return n.clone(this,a,b)})},html:function(a){return J(this,function(a){var b=this[0]||{},c=0,d=this.length;if(void 0===a&&1===b.nodeType)return b.innerHTML;if("string"==typeof a&&!db.test(a)&&!ib[(bb.exec(a)||["",""])[1].toLowerCase()]){a=a.replace(ab,"<$1></$2>");try{for(;d>c;c++)b=this[c]||{},1===b.nodeType&&(n.cleanData(ob(b,!1)),b.innerHTML=a);b=0}catch(e){}}b&&this.empty().append(a)},null,a,arguments.length)},replaceWith:function(){var a=arguments[0];return this.domManip(arguments,function(b){a=this.parentNode,n.cleanData(ob(this)),a&&a.replaceChild(b,this)}),a&&(a.length||a.nodeType)?this:this.remove()},detach:function(a){return this.remove(a,!0)},domManip:function(a,b){a=e.apply([],a);var c,d,f,g,h,i,j=0,l=this.length,m=this,o=l-1,p=a[0],q=n.isFunction(p);if(q||l>1&&"string"==typeof p&&!k.checkClone&&eb.test(p))return this.each(function(c){var d=m.eq(c);q&&(a[0]=p.call(this,c,d.html())),d.domManip(a,b)});if(l&&(c=n.buildFragment(a,this[0].ownerDocument,!1,this),d=c.firstChild,1===c.childNodes.length&&(c=d),d)){for(f=n.map(ob(c,"script"),kb),g=f.length;l>j;j++)h=c,j!==o&&(h=n.clone(h,!0,!0),g&&n.merge(f,ob(h,"script"))),b.call(this[j],h,j);if(g)for(i=f[f.length-1].ownerDocument,n.map(f,lb),j=0;g>j;j++)h=f[j],fb.test(h.type||"")&&!L.access(h,"globalEval")&&n.contains(i,h)&&(h.src?n._evalUrl&&n._evalUrl(h.src):n.globalEval(h.textContent.replace(hb,"")))}return this}}),n.each({appendTo:"append",prependTo:"prepend",insertBefore:"before",insertAfter:"after",replaceAll:"replaceWith"},function(a,b){n.fn[a]=function(a){for(var c,d=[],e=n(a),g=e.length-1,h=0;g>=h;h++)c=h===g?this:this.clone(!0),n(e[h])[b](c),f.apply(d,c.get());return this.pushStack(d)}});var qb,rb={};function sb(b,c){var d,e=n(c.createElement(b)).appendTo(c.body),f=a.getDefaultComputedStyle&&(d=a.getDefaultComputedStyle(e[0]))?d.display:n.css(e[0],"display");return e.detach(),f}function tb(a){var b=l,c=rb[a];return c||(c=sb(a,b),"none"!==c&&c||(qb=(qb||n("<iframe frameborder='0' width='0' height='0'/>")).appendTo(b.documentElement),b=qb[0].contentDocument,b.write(),b.close(),c=sb(a,b),qb.detach()),rb[a]=c),c}var ub=/^margin/,vb=new RegExp("^("+Q+")(?!px)[a-z%]+$","i"),wb=function(a){return a.ownerDocument.defaultView.getComputedStyle(a,null)};function xb(a,b,c){var d,e,f,g,h=a.style;return c=c||wb(a),c&&(g=c.getPropertyValue(b)||c[b]),c&&(""!==g||n.contains(a.ownerDocument,a)||(g=n.style(a,b)),vb.test(g)&&ub.test(b)&&(d=h.width,e=h.minWidth,f=h.maxWidth,h.minWidth=h.maxWidth=h.width=g,g=c.width,h.width=d,h.minWidth=e,h.maxWidth=f)),void 0!==g?g+"":g}function yb(a,b){return{get:function(){return a()?void delete this.get:(this.get=b).apply(this,arguments)}}}!function(){var b,c,d=l.documentElement,e=l.createElement("div"),f=l.createElement("div");if(f.style){f.style.backgroundClip="content-box",f.cloneNode(!0).style.backgroundClip="",k.clearCloneStyle="content-box"===f.style.backgroundClip,e.style.cssText="border:0;width:0;height:0;top:0;left:-9999px;margin-top:1px;position:absolute",e.appendChild(f);function g(){f.style.cssText="-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box;display:block;margin-top:1%;top:1%;border:1px;padding:1px;width:4px;position:absolute",f.innerHTML="",d.appendChild(e);var g=a.getComputedStyle(f,null);b="1%"!==g.top,c="4px"===g.width,d.removeChild(e)}a.getComputedStyle&&n.extend(k,{pixelPosition:function(){return g(),b},boxSizingReliable:function(){return null==c&&g(),c},reliableMarginRight:function(){var b,c=f.appendChild(l.createElement("div"));return c.style.cssText=f.style.cssText="-webkit-box-sizing:content-box;-moz-box-sizing:content-box;box-sizing:content-box;display:block;margin:0;border:0;padding:0",c.style.marginRight=c.style.width="0",f.style.width="1px",d.appendChild(e),b=!parseFloat(a.getComputedStyle(c,null).marginRight),d.removeChild(e),b}})}}(),n.swap=function(a,b,c,d){var e,f,g={};for(f in b)g[f]=a.style[f],a.style[f]=b[f];e=c.apply(a,d||[]);for(f in b)a.style[f]=g[f];return e};var zb=/^(none|table(?!-c[ea]).+)/,Ab=new RegExp("^("+Q+")(.*)$","i"),Bb=new RegExp("^([+-])=("+Q+")","i"),Cb={position:"absolute",visibility:"hidden",display:"block"},Db={letterSpacing:"0",fontWeight:"400"},Eb=["Webkit","O","Moz","ms"];function Fb(a,b){if(b in a)return b;var c=b[0].toUpperCase()+b.slice(1),d=b,e=Eb.length;while(e--)if(b=Eb[e]+c,b in a)return b;return d}function Gb(a,b,c){var d=Ab.exec(b);return d?Math.max(0,d[1]-(c||0))+(d[2]||"px"):b}function Hb(a,b,c,d,e){for(var f=c===(d?"border":"content")?4:"width"===b?1:0,g=0;4>f;f+=2)"margin"===c&&(g+=n.css(a,c+R[f],!0,e)),d?("content"===c&&(g-=n.css(a,"padding"+R[f],!0,e)),"margin"!==c&&(g-=n.css(a,"border"+R[f]+"Width",!0,e))):(g+=n.css(a,"padding"+R[f],!0,e),"padding"!==c&&(g+=n.css(a,"border"+R[f]+"Width",!0,e)));return g}function Ib(a,b,c){var d=!0,e="width"===b?a.offsetWidth:a.offsetHeight,f=wb(a),g="border-box"===n.css(a,"boxSizing",!1,f);if(0>=e||null==e){if(e=xb(a,b,f),(0>e||null==e)&&(e=a.style[b]),vb.test(e))return e;d=g&&(k.boxSizingReliable()||e===a.style[b]),e=parseFloat(e)||0}return e+Hb(a,b,c||(g?"border":"content"),d,f)+"px"}function Jb(a,b){for(var c,d,e,f=[],g=0,h=a.length;h>g;g++)d=a[g],d.style&&(f[g]=L.get(d,"olddisplay"),c=d.style.display,b?(f[g]||"none"!==c||(d.style.display=""),""===d.style.display&&S(d)&&(f[g]=L.access(d,"olddisplay",tb(d.nodeName)))):(e=S(d),"none"===c&&e||L.set(d,"olddisplay",e?c:n.css(d,"display"))));for(g=0;h>g;g++)d=a[g],d.style&&(b&&"none"!==d.style.display&&""!==d.style.display||(d.style.display=b?f[g]||"":"none"));return a}n.extend({cssHooks:{opacity:{get:function(a,b){if(b){var c=xb(a,"opacity");return""===c?"1":c}}}},cssNumber:{columnCount:!0,fillOpacity:!0,flexGrow:!0,flexShrink:!0,fontWeight:!0,lineHeight:!0,opacity:!0,order:!0,orphans:!0,widows:!0,zIndex:!0,zoom:!0},cssProps:{"float":"cssFloat"},style:function(a,b,c,d){if(a&&3!==a.nodeType&&8!==a.nodeType&&a.style){var e,f,g,h=n.camelCase(b),i=a.style;return b=n.cssProps[h]||(n.cssProps[h]=Fb(i,h)),g=n.cssHooks[b]||n.cssHooks[h],void 0===c?g&&"get"in g&&void 0!==(e=g.get(a,!1,d))?e:i[b]:(f=typeof c,"string"===f&&(e=Bb.exec(c))&&(c=(e[1]+1)*e[2]+parseFloat(n.css(a,b)),f="number"),null!=c&&c===c&&("number"!==f||n.cssNumber[h]||(c+="px"),k.clearCloneStyle||""!==c||0!==b.indexOf("background")||(i[b]="inherit"),g&&"set"in g&&void 0===(c=g.set(a,c,d))||(i[b]=c)),void 0)}},css:function(a,b,c,d){var e,f,g,h=n.camelCase(b);return b=n.cssProps[h]||(n.cssProps[h]=Fb(a.style,h)),g=n.cssHooks[b]||n.cssHooks[h],g&&"get"in g&&(e=g.get(a,!0,c)),void 0===e&&(e=xb(a,b,d)),"normal"===e&&b in Db&&(e=Db[b]),""===c||c?(f=parseFloat(e),c===!0||n.isNumeric(f)?f||0:e):e}}),n.each(["height","width"],function(a,b){n.cssHooks[b]={get:function(a,c,d){return c?zb.test(n.css(a,"display"))&&0===a.offsetWidth?n.swap(a,Cb,function(){return Ib(a,b,d)}):Ib(a,b,d):void 0},set:function(a,c,d){var e=d&&wb(a);return Gb(a,c,d?Hb(a,b,d,"border-box"===n.css(a,"boxSizing",!1,e),e):0)}}}),n.cssHooks.marginRight=yb(k.reliableMarginRight,function(a,b){return b?n.swap(a,{display:"inline-block"},xb,[a,"marginRight"]):void 0}),n.each({margin:"",padding:"",border:"Width"},function(a,b){n.cssHooks[a+b]={expand:function(c){for(var d=0,e={},f="string"==typeof c?c.split(" "):[c];4>d;d++)e[a+R[d]+b]=f[d]||f[d-2]||f[0];return e}},ub.test(a)||(n.cssHooks[a+b].set=Gb)}),n.fn.extend({css:function(a,b){return J(this,function(a,b,c){var d,e,f={},g=0;if(n.isArray(b)){for(d=wb(a),e=b.length;e>g;g++)f[b[g]]=n.css(a,b[g],!1,d);return f}return void 0!==c?n.style(a,b,c):n.css(a,b)},a,b,arguments.length>1)},show:function(){return Jb(this,!0)},hide:function(){return Jb(this)},toggle:function(a){return"boolean"==typeof a?a?this.show():this.hide():this.each(function(){S(this)?n(this).show():n(this).hide()})}});function Kb(a,b,c,d,e){return new Kb.prototype.init(a,b,c,d,e)}n.Tween=Kb,Kb.prototype={constructor:Kb,init:function(a,b,c,d,e,f){this.elem=a,this.prop=c,this.easing=e||"swing",this.options=b,this.start=this.now=this.cur(),this.end=d,this.unit=f||(n.cssNumber[c]?"":"px")},cur:function(){var a=Kb.propHooks[this.prop];return a&&a.get?a.get(this):Kb.propHooks._default.get(this)},run:function(a){var b,c=Kb.propHooks[this.prop];return this.pos=b=this.options.duration?n.easing[this.easing](a,this.options.duration*a,0,1,this.options.duration):a,this.now=(this.end-this.start)*b+this.start,this.options.step&&this.options.step.call(this.elem,this.now,this),c&&c.set?c.set(this):Kb.propHooks._default.set(this),this}},Kb.prototype.init.prototype=Kb.prototype,Kb.propHooks={_default:{get:function(a){var b;return null==a.elem[a.prop]||a.elem.style&&null!=a.elem.style[a.prop]?(b=n.css(a.elem,a.prop,""),b&&"auto"!==b?b:0):a.elem[a.prop]},set:function(a){n.fx.step[a.prop]?n.fx.step[a.prop](a):a.elem.style&&(null!=a.elem.style[n.cssProps[a.prop]]||n.cssHooks[a.prop])?n.style(a.elem,a.prop,a.now+a.unit):a.elem[a.prop]=a.now}}},Kb.propHooks.scrollTop=Kb.propHooks.scrollLeft={set:function(a){a.elem.nodeType&&a.elem.parentNode&&(a.elem[a.prop]=a.now)}},n.easing={linear:function(a){return a},swing:function(a){return.5-Math.cos(a*Math.PI)/2}},n.fx=Kb.prototype.init,n.fx.step={};var Lb,Mb,Nb=/^(?:toggle|show|hide)$/,Ob=new RegExp("^(?:([+-])=|)("+Q+")([a-z%]*)$","i"),Pb=/queueHooks$/,Qb=[Vb],Rb={"*":[function(a,b){var c=this.createTween(a,b),d=c.cur(),e=Ob.exec(b),f=e&&e[3]||(n.cssNumber[a]?"":"px"),g=(n.cssNumber[a]||"px"!==f&&+d)&&Ob.exec(n.css(c.elem,a)),h=1,i=20;if(g&&g[3]!==f){f=f||g[3],e=e||[],g=+d||1;do h=h||".5",g/=h,n.style(c.elem,a,g+f);while(h!==(h=c.cur()/d)&&1!==h&&--i)}return e&&(g=c.start=+g||+d||0,c.unit=f,c.end=e[1]?g+(e[1]+1)*e[2]:+e[2]),c}]};function Sb(){return setTimeout(function(){Lb=void 0}),Lb=n.now()}function Tb(a,b){var c,d=0,e={height:a};for(b=b?1:0;4>d;d+=2-b)c=R[d],e["margin"+c]=e["padding"+c]=a;return b&&(e.opacity=e.width=a),e}function Ub(a,b,c){for(var d,e=(Rb[b]||[]).concat(Rb["*"]),f=0,g=e.length;g>f;f++)if(d=e[f].call(c,b,a))return d}function Vb(a,b,c){var d,e,f,g,h,i,j,k,l=this,m={},o=a.style,p=a.nodeType&&S(a),q=L.get(a,"fxshow");c.queue||(h=n._queueHooks(a,"fx"),null==h.unqueued&&(h.unqueued=0,i=h.empty.fire,h.empty.fire=function(){h.unqueued||i()}),h.unqueued++,l.always(function(){l.always(function(){h.unqueued--,n.queue(a,"fx").length||h.empty.fire()})})),1===a.nodeType&&("height"in b||"width"in b)&&(c.overflow=[o.overflow,o.overflowX,o.overflowY],j=n.css(a,"display"),k="none"===j?L.get(a,"olddisplay")||tb(a.nodeName):j,"inline"===k&&"none"===n.css(a,"float")&&(o.display="inline-block")),c.overflow&&(o.overflow="hidden",l.always(function(){o.overflow=c.overflow[0],o.overflowX=c.overflow[1],o.overflowY=c.overflow[2]}));for(d in b)if(e=b[d],Nb.exec(e)){if(delete b[d],f=f||"toggle"===e,e===(p?"hide":"show")){if("show"!==e||!q||void 0===q[d])continue;p=!0}m[d]=q&&q[d]||n.style(a,d)}else j=void 0;if(n.isEmptyObject(m))"inline"===("none"===j?tb(a.nodeName):j)&&(o.display=j);else{q?"hidden"in q&&(p=q.hidden):q=L.access(a,"fxshow",{}),f&&(q.hidden=!p),p?n(a).show():l.done(function(){n(a).hide()}),l.done(function(){var b;L.remove(a,"fxshow");for(b in m)n.style(a,b,m[b])});for(d in m)g=Ub(p?q[d]:0,d,l),d in q||(q[d]=g.start,p&&(g.end=g.start,g.start="width"===d||"height"===d?1:0))}}function Wb(a,b){var c,d,e,f,g;for(c in a)if(d=n.camelCase(c),e=b[d],f=a[c],n.isArray(f)&&(e=f[1],f=a[c]=f[0]),c!==d&&(a[d]=f,delete a[c]),g=n.cssHooks[d],g&&"expand"in g){f=g.expand(f),delete a[d];for(c in f)c in a||(a[c]=f[c],b[c]=e)}else b[d]=e}function Xb(a,b,c){var d,e,f=0,g=Qb.length,h=n.Deferred().always(function(){delete i.elem}),i=function(){if(e)return!1;for(var b=Lb||Sb(),c=Math.max(0,j.startTime+j.duration-b),d=c/j.duration||0,f=1-d,g=0,i=j.tweens.length;i>g;g++)j.tweens[g].run(f);return h.notifyWith(a,[j,f,c]),1>f&&i?c:(h.resolveWith(a,[j]),!1)},j=h.promise({elem:a,props:n.extend({},b),opts:n.extend(!0,{specialEasing:{}},c),originalProperties:b,originalOptions:c,startTime:Lb||Sb(),duration:c.duration,tweens:[],createTween:function(b,c){var d=n.Tween(a,j.opts,b,c,j.opts.specialEasing[b]||j.opts.easing);return j.tweens.push(d),d},stop:function(b){var c=0,d=b?j.tweens.length:0;if(e)return this;for(e=!0;d>c;c++)j.tweens[c].run(1);return b?h.resolveWith(a,[j,b]):h.rejectWith(a,[j,b]),this}}),k=j.props;for(Wb(k,j.opts.specialEasing);g>f;f++)if(d=Qb[f].call(j,a,k,j.opts))return d;return n.map(k,Ub,j),n.isFunction(j.opts.start)&&j.opts.start.call(a,j),n.fx.timer(n.extend(i,{elem:a,anim:j,queue:j.opts.queue})),j.progress(j.opts.progress).done(j.opts.done,j.opts.complete).fail(j.opts.fail).always(j.opts.always)}n.Animation=n.extend(Xb,{tweener:function(a,b){n.isFunction(a)?(b=a,a=["*"]):a=a.split(" ");for(var c,d=0,e=a.length;e>d;d++)c=a[d],Rb[c]=Rb[c]||[],Rb[c].unshift(b)},prefilter:function(a,b){b?Qb.unshift(a):Qb.push(a)}}),n.speed=function(a,b,c){var d=a&&"object"==typeof a?n.extend({},a):{complete:c||!c&&b||n.isFunction(a)&&a,duration:a,easing:c&&b||b&&!n.isFunction(b)&&b};return d.duration=n.fx.off?0:"number"==typeof d.duration?d.duration:d.duration in n.fx.speeds?n.fx.speeds[d.duration]:n.fx.speeds._default,(null==d.queue||d.queue===!0)&&(d.queue="fx"),d.old=d.complete,d.complete=function(){n.isFunction(d.old)&&d.old.call(this),d.queue&&n.dequeue(this,d.queue)},d},n.fn.extend({fadeTo:function(a,b,c,d){return this.filter(S).css("opacity",0).show().end().animate({opacity:b},a,c,d)},animate:function(a,b,c,d){var e=n.isEmptyObject(a),f=n.speed(b,c,d),g=function(){var b=Xb(this,n.extend({},a),f);(e||L.get(this,"finish"))&&b.stop(!0)};return g.finish=g,e||f.queue===!1?this.each(g):this.queue(f.queue,g)},stop:function(a,b,c){var d=function(a){var b=a.stop;delete a.stop,b(c)};return"string"!=typeof a&&(c=b,b=a,a=void 0),b&&a!==!1&&this.queue(a||"fx",[]),this.each(function(){var b=!0,e=null!=a&&a+"queueHooks",f=n.timers,g=L.get(this);if(e)g[e]&&g[e].stop&&d(g[e]);else for(e in g)g[e]&&g[e].stop&&Pb.test(e)&&d(g[e]);for(e=f.length;e--;)f[e].elem!==this||null!=a&&f[e].queue!==a||(f[e].anim.stop(c),b=!1,f.splice(e,1));(b||!c)&&n.dequeue(this,a)})},finish:function(a){return a!==!1&&(a=a||"fx"),this.each(function(){var b,c=L.get(this),d=c[a+"queue"],e=c[a+"queueHooks"],f=n.timers,g=d?d.length:0;for(c.finish=!0,n.queue(this,a,[]),e&&e.stop&&e.stop.call(this,!0),b=f.length;b--;)f[b].elem===this&&f[b].queue===a&&(f[b].anim.stop(!0),f.splice(b,1));for(b=0;g>b;b++)d[b]&&d[b].finish&&d[b].finish.call(this);delete c.finish})}}),n.each(["toggle","show","hide"],function(a,b){var c=n.fn[b];n.fn[b]=function(a,d,e){return null==a||"boolean"==typeof a?c.apply(this,arguments):this.animate(Tb(b,!0),a,d,e)}}),n.each({slideDown:Tb("show"),slideUp:Tb("hide"),slideToggle:Tb("toggle"),fadeIn:{opacity:"show"},fadeOut:{opacity:"hide"},fadeToggle:{opacity:"toggle"}},function(a,b){n.fn[a]=function(a,c,d){return this.animate(b,a,c,d)}}),n.timers=[],n.fx.tick=function(){var a,b=0,c=n.timers;for(Lb=n.now();b<c.length;b++)a=c[b],a()||c[b]!==a||c.splice(b--,1);c.length||n.fx.stop(),Lb=void 0},n.fx.timer=function(a){n.timers.push(a),a()?n.fx.start():n.timers.pop()},n.fx.interval=13,n.fx.start=function(){Mb||(Mb=setInterval(n.fx.tick,n.fx.interval))},n.fx.stop=function(){clearInterval(Mb),Mb=null},n.fx.speeds={slow:600,fast:200,_default:400},n.fn.delay=function(a,b){return a=n.fx?n.fx.speeds[a]||a:a,b=b||"fx",this.queue(b,function(b,c){var d=setTimeout(b,a);c.stop=function(){clearTimeout(d)}})},function(){var a=l.createElement("input"),b=l.createElement("select"),c=b.appendChild(l.createElement("option"));a.type="checkbox",k.checkOn=""!==a.value,k.optSelected=c.selected,b.disabled=!0,k.optDisabled=!c.disabled,a=l.createElement("input"),a.value="t",a.type="radio",k.radioValue="t"===a.value}();var Yb,Zb,$b=n.expr.attrHandle;n.fn.extend({attr:function(a,b){return J(this,n.attr,a,b,arguments.length>1)},removeAttr:function(a){return this.each(function(){n.removeAttr(this,a)})}}),n.extend({attr:function(a,b,c){var d,e,f=a.nodeType;if(a&&3!==f&&8!==f&&2!==f)return typeof a.getAttribute===U?n.prop(a,b,c):(1===f&&n.isXMLDoc(a)||(b=b.toLowerCase(),d=n.attrHooks[b]||(n.expr.match.bool.test(b)?Zb:Yb)),void 0===c?d&&"get"in d&&null!==(e=d.get(a,b))?e:(e=n.find.attr(a,b),null==e?void 0:e):null!==c?d&&"set"in d&&void 0!==(e=d.set(a,c,b))?e:(a.setAttribute(b,c+""),c):void n.removeAttr(a,b)) +},removeAttr:function(a,b){var c,d,e=0,f=b&&b.match(E);if(f&&1===a.nodeType)while(c=f[e++])d=n.propFix[c]||c,n.expr.match.bool.test(c)&&(a[d]=!1),a.removeAttribute(c)},attrHooks:{type:{set:function(a,b){if(!k.radioValue&&"radio"===b&&n.nodeName(a,"input")){var c=a.value;return a.setAttribute("type",b),c&&(a.value=c),b}}}}}),Zb={set:function(a,b,c){return b===!1?n.removeAttr(a,c):a.setAttribute(c,c),c}},n.each(n.expr.match.bool.source.match(/\w+/g),function(a,b){var c=$b[b]||n.find.attr;$b[b]=function(a,b,d){var e,f;return d||(f=$b[b],$b[b]=e,e=null!=c(a,b,d)?b.toLowerCase():null,$b[b]=f),e}});var _b=/^(?:input|select|textarea|button)$/i;n.fn.extend({prop:function(a,b){return J(this,n.prop,a,b,arguments.length>1)},removeProp:function(a){return this.each(function(){delete this[n.propFix[a]||a]})}}),n.extend({propFix:{"for":"htmlFor","class":"className"},prop:function(a,b,c){var d,e,f,g=a.nodeType;if(a&&3!==g&&8!==g&&2!==g)return f=1!==g||!n.isXMLDoc(a),f&&(b=n.propFix[b]||b,e=n.propHooks[b]),void 0!==c?e&&"set"in e&&void 0!==(d=e.set(a,c,b))?d:a[b]=c:e&&"get"in e&&null!==(d=e.get(a,b))?d:a[b]},propHooks:{tabIndex:{get:function(a){return a.hasAttribute("tabindex")||_b.test(a.nodeName)||a.href?a.tabIndex:-1}}}}),k.optSelected||(n.propHooks.selected={get:function(a){var b=a.parentNode;return b&&b.parentNode&&b.parentNode.selectedIndex,null}}),n.each(["tabIndex","readOnly","maxLength","cellSpacing","cellPadding","rowSpan","colSpan","useMap","frameBorder","contentEditable"],function(){n.propFix[this.toLowerCase()]=this});var ac=/[\t\r\n\f]/g;n.fn.extend({addClass:function(a){var b,c,d,e,f,g,h="string"==typeof a&&a,i=0,j=this.length;if(n.isFunction(a))return this.each(function(b){n(this).addClass(a.call(this,b,this.className))});if(h)for(b=(a||"").match(E)||[];j>i;i++)if(c=this[i],d=1===c.nodeType&&(c.className?(" "+c.className+" ").replace(ac," "):" ")){f=0;while(e=b[f++])d.indexOf(" "+e+" ")<0&&(d+=e+" ");g=n.trim(d),c.className!==g&&(c.className=g)}return this},removeClass:function(a){var b,c,d,e,f,g,h=0===arguments.length||"string"==typeof a&&a,i=0,j=this.length;if(n.isFunction(a))return this.each(function(b){n(this).removeClass(a.call(this,b,this.className))});if(h)for(b=(a||"").match(E)||[];j>i;i++)if(c=this[i],d=1===c.nodeType&&(c.className?(" "+c.className+" ").replace(ac," "):"")){f=0;while(e=b[f++])while(d.indexOf(" "+e+" ")>=0)d=d.replace(" "+e+" "," ");g=a?n.trim(d):"",c.className!==g&&(c.className=g)}return this},toggleClass:function(a,b){var c=typeof a;return"boolean"==typeof b&&"string"===c?b?this.addClass(a):this.removeClass(a):this.each(n.isFunction(a)?function(c){n(this).toggleClass(a.call(this,c,this.className,b),b)}:function(){if("string"===c){var b,d=0,e=n(this),f=a.match(E)||[];while(b=f[d++])e.hasClass(b)?e.removeClass(b):e.addClass(b)}else(c===U||"boolean"===c)&&(this.className&&L.set(this,"__className__",this.className),this.className=this.className||a===!1?"":L.get(this,"__className__")||"")})},hasClass:function(a){for(var b=" "+a+" ",c=0,d=this.length;d>c;c++)if(1===this[c].nodeType&&(" "+this[c].className+" ").replace(ac," ").indexOf(b)>=0)return!0;return!1}});var bc=/\r/g;n.fn.extend({val:function(a){var b,c,d,e=this[0];{if(arguments.length)return d=n.isFunction(a),this.each(function(c){var e;1===this.nodeType&&(e=d?a.call(this,c,n(this).val()):a,null==e?e="":"number"==typeof e?e+="":n.isArray(e)&&(e=n.map(e,function(a){return null==a?"":a+""})),b=n.valHooks[this.type]||n.valHooks[this.nodeName.toLowerCase()],b&&"set"in b&&void 0!==b.set(this,e,"value")||(this.value=e))});if(e)return b=n.valHooks[e.type]||n.valHooks[e.nodeName.toLowerCase()],b&&"get"in b&&void 0!==(c=b.get(e,"value"))?c:(c=e.value,"string"==typeof c?c.replace(bc,""):null==c?"":c)}}}),n.extend({valHooks:{option:{get:function(a){var b=n.find.attr(a,"value");return null!=b?b:n.trim(n.text(a))}},select:{get:function(a){for(var b,c,d=a.options,e=a.selectedIndex,f="select-one"===a.type||0>e,g=f?null:[],h=f?e+1:d.length,i=0>e?h:f?e:0;h>i;i++)if(c=d[i],!(!c.selected&&i!==e||(k.optDisabled?c.disabled:null!==c.getAttribute("disabled"))||c.parentNode.disabled&&n.nodeName(c.parentNode,"optgroup"))){if(b=n(c).val(),f)return b;g.push(b)}return g},set:function(a,b){var c,d,e=a.options,f=n.makeArray(b),g=e.length;while(g--)d=e[g],(d.selected=n.inArray(d.value,f)>=0)&&(c=!0);return c||(a.selectedIndex=-1),f}}}}),n.each(["radio","checkbox"],function(){n.valHooks[this]={set:function(a,b){return n.isArray(b)?a.checked=n.inArray(n(a).val(),b)>=0:void 0}},k.checkOn||(n.valHooks[this].get=function(a){return null===a.getAttribute("value")?"on":a.value})}),n.each("blur focus focusin focusout load resize scroll unload click dblclick mousedown mouseup mousemove mouseover mouseout mouseenter mouseleave change select submit keydown keypress keyup error contextmenu".split(" "),function(a,b){n.fn[b]=function(a,c){return arguments.length>0?this.on(b,null,a,c):this.trigger(b)}}),n.fn.extend({hover:function(a,b){return this.mouseenter(a).mouseleave(b||a)},bind:function(a,b,c){return this.on(a,null,b,c)},unbind:function(a,b){return this.off(a,null,b)},delegate:function(a,b,c,d){return this.on(b,a,c,d)},undelegate:function(a,b,c){return 1===arguments.length?this.off(a,"**"):this.off(b,a||"**",c)}});var cc=n.now(),dc=/\?/;n.parseJSON=function(a){return JSON.parse(a+"")},n.parseXML=function(a){var b,c;if(!a||"string"!=typeof a)return null;try{c=new DOMParser,b=c.parseFromString(a,"text/xml")}catch(d){b=void 0}return(!b||b.getElementsByTagName("parsererror").length)&&n.error("Invalid XML: "+a),b};var ec,fc,gc=/#.*$/,hc=/([?&])_=[^&]*/,ic=/^(.*?):[ \t]*([^\r\n]*)$/gm,jc=/^(?:about|app|app-storage|.+-extension|file|res|widget):$/,kc=/^(?:GET|HEAD)$/,lc=/^\/\//,mc=/^([\w.+-]+:)(?:\/\/(?:[^\/?#]*@|)([^\/?#:]*)(?::(\d+)|)|)/,nc={},oc={},pc="*/".concat("*");try{fc=location.href}catch(qc){fc=l.createElement("a"),fc.href="",fc=fc.href}ec=mc.exec(fc.toLowerCase())||[];function rc(a){return function(b,c){"string"!=typeof b&&(c=b,b="*");var d,e=0,f=b.toLowerCase().match(E)||[];if(n.isFunction(c))while(d=f[e++])"+"===d[0]?(d=d.slice(1)||"*",(a[d]=a[d]||[]).unshift(c)):(a[d]=a[d]||[]).push(c)}}function sc(a,b,c,d){var e={},f=a===oc;function g(h){var i;return e[h]=!0,n.each(a[h]||[],function(a,h){var j=h(b,c,d);return"string"!=typeof j||f||e[j]?f?!(i=j):void 0:(b.dataTypes.unshift(j),g(j),!1)}),i}return g(b.dataTypes[0])||!e["*"]&&g("*")}function tc(a,b){var c,d,e=n.ajaxSettings.flatOptions||{};for(c in b)void 0!==b[c]&&((e[c]?a:d||(d={}))[c]=b[c]);return d&&n.extend(!0,a,d),a}function uc(a,b,c){var d,e,f,g,h=a.contents,i=a.dataTypes;while("*"===i[0])i.shift(),void 0===d&&(d=a.mimeType||b.getResponseHeader("Content-Type"));if(d)for(e in h)if(h[e]&&h[e].test(d)){i.unshift(e);break}if(i[0]in c)f=i[0];else{for(e in c){if(!i[0]||a.converters[e+" "+i[0]]){f=e;break}g||(g=e)}f=f||g}return f?(f!==i[0]&&i.unshift(f),c[f]):void 0}function vc(a,b,c,d){var e,f,g,h,i,j={},k=a.dataTypes.slice();if(k[1])for(g in a.converters)j[g.toLowerCase()]=a.converters[g];f=k.shift();while(f)if(a.responseFields[f]&&(c[a.responseFields[f]]=b),!i&&d&&a.dataFilter&&(b=a.dataFilter(b,a.dataType)),i=f,f=k.shift())if("*"===f)f=i;else if("*"!==i&&i!==f){if(g=j[i+" "+f]||j["* "+f],!g)for(e in j)if(h=e.split(" "),h[1]===f&&(g=j[i+" "+h[0]]||j["* "+h[0]])){g===!0?g=j[e]:j[e]!==!0&&(f=h[0],k.unshift(h[1]));break}if(g!==!0)if(g&&a["throws"])b=g(b);else try{b=g(b)}catch(l){return{state:"parsererror",error:g?l:"No conversion from "+i+" to "+f}}}return{state:"success",data:b}}n.extend({active:0,lastModified:{},etag:{},ajaxSettings:{url:fc,type:"GET",isLocal:jc.test(ec[1]),global:!0,processData:!0,async:!0,contentType:"application/x-www-form-urlencoded; charset=UTF-8",accepts:{"*":pc,text:"text/plain",html:"text/html",xml:"application/xml, text/xml",json:"application/json, text/javascript"},contents:{xml:/xml/,html:/html/,json:/json/},responseFields:{xml:"responseXML",text:"responseText",json:"responseJSON"},converters:{"* text":String,"text html":!0,"text json":n.parseJSON,"text xml":n.parseXML},flatOptions:{url:!0,context:!0}},ajaxSetup:function(a,b){return b?tc(tc(a,n.ajaxSettings),b):tc(n.ajaxSettings,a)},ajaxPrefilter:rc(nc),ajaxTransport:rc(oc),ajax:function(a,b){"object"==typeof a&&(b=a,a=void 0),b=b||{};var c,d,e,f,g,h,i,j,k=n.ajaxSetup({},b),l=k.context||k,m=k.context&&(l.nodeType||l.jquery)?n(l):n.event,o=n.Deferred(),p=n.Callbacks("once memory"),q=k.statusCode||{},r={},s={},t=0,u="canceled",v={readyState:0,getResponseHeader:function(a){var b;if(2===t){if(!f){f={};while(b=ic.exec(e))f[b[1].toLowerCase()]=b[2]}b=f[a.toLowerCase()]}return null==b?null:b},getAllResponseHeaders:function(){return 2===t?e:null},setRequestHeader:function(a,b){var c=a.toLowerCase();return t||(a=s[c]=s[c]||a,r[a]=b),this},overrideMimeType:function(a){return t||(k.mimeType=a),this},statusCode:function(a){var b;if(a)if(2>t)for(b in a)q[b]=[q[b],a[b]];else v.always(a[v.status]);return this},abort:function(a){var b=a||u;return c&&c.abort(b),x(0,b),this}};if(o.promise(v).complete=p.add,v.success=v.done,v.error=v.fail,k.url=((a||k.url||fc)+"").replace(gc,"").replace(lc,ec[1]+"//"),k.type=b.method||b.type||k.method||k.type,k.dataTypes=n.trim(k.dataType||"*").toLowerCase().match(E)||[""],null==k.crossDomain&&(h=mc.exec(k.url.toLowerCase()),k.crossDomain=!(!h||h[1]===ec[1]&&h[2]===ec[2]&&(h[3]||("http:"===h[1]?"80":"443"))===(ec[3]||("http:"===ec[1]?"80":"443")))),k.data&&k.processData&&"string"!=typeof k.data&&(k.data=n.param(k.data,k.traditional)),sc(nc,k,b,v),2===t)return v;i=k.global,i&&0===n.active++&&n.event.trigger("ajaxStart"),k.type=k.type.toUpperCase(),k.hasContent=!kc.test(k.type),d=k.url,k.hasContent||(k.data&&(d=k.url+=(dc.test(d)?"&":"?")+k.data,delete k.data),k.cache===!1&&(k.url=hc.test(d)?d.replace(hc,"$1_="+cc++):d+(dc.test(d)?"&":"?")+"_="+cc++)),k.ifModified&&(n.lastModified[d]&&v.setRequestHeader("If-Modified-Since",n.lastModified[d]),n.etag[d]&&v.setRequestHeader("If-None-Match",n.etag[d])),(k.data&&k.hasContent&&k.contentType!==!1||b.contentType)&&v.setRequestHeader("Content-Type",k.contentType),v.setRequestHeader("Accept",k.dataTypes[0]&&k.accepts[k.dataTypes[0]]?k.accepts[k.dataTypes[0]]+("*"!==k.dataTypes[0]?", "+pc+"; q=0.01":""):k.accepts["*"]);for(j in k.headers)v.setRequestHeader(j,k.headers[j]);if(k.beforeSend&&(k.beforeSend.call(l,v,k)===!1||2===t))return v.abort();u="abort";for(j in{success:1,error:1,complete:1})v[j](k[j]);if(c=sc(oc,k,b,v)){v.readyState=1,i&&m.trigger("ajaxSend",[v,k]),k.async&&k.timeout>0&&(g=setTimeout(function(){v.abort("timeout")},k.timeout));try{t=1,c.send(r,x)}catch(w){if(!(2>t))throw w;x(-1,w)}}else x(-1,"No Transport");function x(a,b,f,h){var j,r,s,u,w,x=b;2!==t&&(t=2,g&&clearTimeout(g),c=void 0,e=h||"",v.readyState=a>0?4:0,j=a>=200&&300>a||304===a,f&&(u=uc(k,v,f)),u=vc(k,u,v,j),j?(k.ifModified&&(w=v.getResponseHeader("Last-Modified"),w&&(n.lastModified[d]=w),w=v.getResponseHeader("etag"),w&&(n.etag[d]=w)),204===a||"HEAD"===k.type?x="nocontent":304===a?x="notmodified":(x=u.state,r=u.data,s=u.error,j=!s)):(s=x,(a||!x)&&(x="error",0>a&&(a=0))),v.status=a,v.statusText=(b||x)+"",j?o.resolveWith(l,[r,x,v]):o.rejectWith(l,[v,x,s]),v.statusCode(q),q=void 0,i&&m.trigger(j?"ajaxSuccess":"ajaxError",[v,k,j?r:s]),p.fireWith(l,[v,x]),i&&(m.trigger("ajaxComplete",[v,k]),--n.active||n.event.trigger("ajaxStop")))}return v},getJSON:function(a,b,c){return n.get(a,b,c,"json")},getScript:function(a,b){return n.get(a,void 0,b,"script")}}),n.each(["get","post"],function(a,b){n[b]=function(a,c,d,e){return n.isFunction(c)&&(e=e||d,d=c,c=void 0),n.ajax({url:a,type:b,dataType:e,data:c,success:d})}}),n.each(["ajaxStart","ajaxStop","ajaxComplete","ajaxError","ajaxSuccess","ajaxSend"],function(a,b){n.fn[b]=function(a){return this.on(b,a)}}),n._evalUrl=function(a){return n.ajax({url:a,type:"GET",dataType:"script",async:!1,global:!1,"throws":!0})},n.fn.extend({wrapAll:function(a){var b;return n.isFunction(a)?this.each(function(b){n(this).wrapAll(a.call(this,b))}):(this[0]&&(b=n(a,this[0].ownerDocument).eq(0).clone(!0),this[0].parentNode&&b.insertBefore(this[0]),b.map(function(){var a=this;while(a.firstElementChild)a=a.firstElementChild;return a}).append(this)),this)},wrapInner:function(a){return this.each(n.isFunction(a)?function(b){n(this).wrapInner(a.call(this,b))}:function(){var b=n(this),c=b.contents();c.length?c.wrapAll(a):b.append(a)})},wrap:function(a){var b=n.isFunction(a);return this.each(function(c){n(this).wrapAll(b?a.call(this,c):a)})},unwrap:function(){return this.parent().each(function(){n.nodeName(this,"body")||n(this).replaceWith(this.childNodes)}).end()}}),n.expr.filters.hidden=function(a){return a.offsetWidth<=0&&a.offsetHeight<=0},n.expr.filters.visible=function(a){return!n.expr.filters.hidden(a)};var wc=/%20/g,xc=/\[\]$/,yc=/\r?\n/g,zc=/^(?:submit|button|image|reset|file)$/i,Ac=/^(?:input|select|textarea|keygen)/i;function Bc(a,b,c,d){var e;if(n.isArray(b))n.each(b,function(b,e){c||xc.test(a)?d(a,e):Bc(a+"["+("object"==typeof e?b:"")+"]",e,c,d)});else if(c||"object"!==n.type(b))d(a,b);else for(e in b)Bc(a+"["+e+"]",b[e],c,d)}n.param=function(a,b){var c,d=[],e=function(a,b){b=n.isFunction(b)?b():null==b?"":b,d[d.length]=encodeURIComponent(a)+"="+encodeURIComponent(b)};if(void 0===b&&(b=n.ajaxSettings&&n.ajaxSettings.traditional),n.isArray(a)||a.jquery&&!n.isPlainObject(a))n.each(a,function(){e(this.name,this.value)});else for(c in a)Bc(c,a[c],b,e);return d.join("&").replace(wc,"+")},n.fn.extend({serialize:function(){return n.param(this.serializeArray())},serializeArray:function(){return this.map(function(){var a=n.prop(this,"elements");return a?n.makeArray(a):this}).filter(function(){var a=this.type;return this.name&&!n(this).is(":disabled")&&Ac.test(this.nodeName)&&!zc.test(a)&&(this.checked||!T.test(a))}).map(function(a,b){var c=n(this).val();return null==c?null:n.isArray(c)?n.map(c,function(a){return{name:b.name,value:a.replace(yc,"\r\n")}}):{name:b.name,value:c.replace(yc,"\r\n")}}).get()}}),n.ajaxSettings.xhr=function(){try{return new XMLHttpRequest}catch(a){}};var Cc=0,Dc={},Ec={0:200,1223:204},Fc=n.ajaxSettings.xhr();a.ActiveXObject&&n(a).on("unload",function(){for(var a in Dc)Dc[a]()}),k.cors=!!Fc&&"withCredentials"in Fc,k.ajax=Fc=!!Fc,n.ajaxTransport(function(a){var b;return k.cors||Fc&&!a.crossDomain?{send:function(c,d){var e,f=a.xhr(),g=++Cc;if(f.open(a.type,a.url,a.async,a.username,a.password),a.xhrFields)for(e in a.xhrFields)f[e]=a.xhrFields[e];a.mimeType&&f.overrideMimeType&&f.overrideMimeType(a.mimeType),a.crossDomain||c["X-Requested-With"]||(c["X-Requested-With"]="XMLHttpRequest");for(e in c)f.setRequestHeader(e,c[e]);b=function(a){return function(){b&&(delete Dc[g],b=f.onload=f.onerror=null,"abort"===a?f.abort():"error"===a?d(f.status,f.statusText):d(Ec[f.status]||f.status,f.statusText,"string"==typeof f.responseText?{text:f.responseText}:void 0,f.getAllResponseHeaders()))}},f.onload=b(),f.onerror=b("error"),b=Dc[g]=b("abort");try{f.send(a.hasContent&&a.data||null)}catch(h){if(b)throw h}},abort:function(){b&&b()}}:void 0}),n.ajaxSetup({accepts:{script:"text/javascript, application/javascript, application/ecmascript, application/x-ecmascript"},contents:{script:/(?:java|ecma)script/},converters:{"text script":function(a){return n.globalEval(a),a}}}),n.ajaxPrefilter("script",function(a){void 0===a.cache&&(a.cache=!1),a.crossDomain&&(a.type="GET")}),n.ajaxTransport("script",function(a){if(a.crossDomain){var b,c;return{send:function(d,e){b=n("<script>").prop({async:!0,charset:a.scriptCharset,src:a.url}).on("load error",c=function(a){b.remove(),c=null,a&&e("error"===a.type?404:200,a.type)}),l.head.appendChild(b[0])},abort:function(){c&&c()}}}});var Gc=[],Hc=/(=)\?(?=&|$)|\?\?/;n.ajaxSetup({jsonp:"callback",jsonpCallback:function(){var a=Gc.pop()||n.expando+"_"+cc++;return this[a]=!0,a}}),n.ajaxPrefilter("json jsonp",function(b,c,d){var e,f,g,h=b.jsonp!==!1&&(Hc.test(b.url)?"url":"string"==typeof b.data&&!(b.contentType||"").indexOf("application/x-www-form-urlencoded")&&Hc.test(b.data)&&"data");return h||"jsonp"===b.dataTypes[0]?(e=b.jsonpCallback=n.isFunction(b.jsonpCallback)?b.jsonpCallback():b.jsonpCallback,h?b[h]=b[h].replace(Hc,"$1"+e):b.jsonp!==!1&&(b.url+=(dc.test(b.url)?"&":"?")+b.jsonp+"="+e),b.converters["script json"]=function(){return g||n.error(e+" was not called"),g[0]},b.dataTypes[0]="json",f=a[e],a[e]=function(){g=arguments},d.always(function(){a[e]=f,b[e]&&(b.jsonpCallback=c.jsonpCallback,Gc.push(e)),g&&n.isFunction(f)&&f(g[0]),g=f=void 0}),"script"):void 0}),n.parseHTML=function(a,b,c){if(!a||"string"!=typeof a)return null;"boolean"==typeof b&&(c=b,b=!1),b=b||l;var d=v.exec(a),e=!c&&[];return d?[b.createElement(d[1])]:(d=n.buildFragment([a],b,e),e&&e.length&&n(e).remove(),n.merge([],d.childNodes))};var Ic=n.fn.load;n.fn.load=function(a,b,c){if("string"!=typeof a&&Ic)return Ic.apply(this,arguments);var d,e,f,g=this,h=a.indexOf(" ");return h>=0&&(d=n.trim(a.slice(h)),a=a.slice(0,h)),n.isFunction(b)?(c=b,b=void 0):b&&"object"==typeof b&&(e="POST"),g.length>0&&n.ajax({url:a,type:e,dataType:"html",data:b}).done(function(a){f=arguments,g.html(d?n("<div>").append(n.parseHTML(a)).find(d):a)}).complete(c&&function(a,b){g.each(c,f||[a.responseText,b,a])}),this},n.expr.filters.animated=function(a){return n.grep(n.timers,function(b){return a===b.elem}).length};var Jc=a.document.documentElement;function Kc(a){return n.isWindow(a)?a:9===a.nodeType&&a.defaultView}n.offset={setOffset:function(a,b,c){var d,e,f,g,h,i,j,k=n.css(a,"position"),l=n(a),m={};"static"===k&&(a.style.position="relative"),h=l.offset(),f=n.css(a,"top"),i=n.css(a,"left"),j=("absolute"===k||"fixed"===k)&&(f+i).indexOf("auto")>-1,j?(d=l.position(),g=d.top,e=d.left):(g=parseFloat(f)||0,e=parseFloat(i)||0),n.isFunction(b)&&(b=b.call(a,c,h)),null!=b.top&&(m.top=b.top-h.top+g),null!=b.left&&(m.left=b.left-h.left+e),"using"in b?b.using.call(a,m):l.css(m)}},n.fn.extend({offset:function(a){if(arguments.length)return void 0===a?this:this.each(function(b){n.offset.setOffset(this,a,b)});var b,c,d=this[0],e={top:0,left:0},f=d&&d.ownerDocument;if(f)return b=f.documentElement,n.contains(b,d)?(typeof d.getBoundingClientRect!==U&&(e=d.getBoundingClientRect()),c=Kc(f),{top:e.top+c.pageYOffset-b.clientTop,left:e.left+c.pageXOffset-b.clientLeft}):e},position:function(){if(this[0]){var a,b,c=this[0],d={top:0,left:0};return"fixed"===n.css(c,"position")?b=c.getBoundingClientRect():(a=this.offsetParent(),b=this.offset(),n.nodeName(a[0],"html")||(d=a.offset()),d.top+=n.css(a[0],"borderTopWidth",!0),d.left+=n.css(a[0],"borderLeftWidth",!0)),{top:b.top-d.top-n.css(c,"marginTop",!0),left:b.left-d.left-n.css(c,"marginLeft",!0)}}},offsetParent:function(){return this.map(function(){var a=this.offsetParent||Jc;while(a&&!n.nodeName(a,"html")&&"static"===n.css(a,"position"))a=a.offsetParent;return a||Jc})}}),n.each({scrollLeft:"pageXOffset",scrollTop:"pageYOffset"},function(b,c){var d="pageYOffset"===c;n.fn[b]=function(e){return J(this,function(b,e,f){var g=Kc(b);return void 0===f?g?g[c]:b[e]:void(g?g.scrollTo(d?a.pageXOffset:f,d?f:a.pageYOffset):b[e]=f)},b,e,arguments.length,null)}}),n.each(["top","left"],function(a,b){n.cssHooks[b]=yb(k.pixelPosition,function(a,c){return c?(c=xb(a,b),vb.test(c)?n(a).position()[b]+"px":c):void 0})}),n.each({Height:"height",Width:"width"},function(a,b){n.each({padding:"inner"+a,content:b,"":"outer"+a},function(c,d){n.fn[d]=function(d,e){var f=arguments.length&&(c||"boolean"!=typeof d),g=c||(d===!0||e===!0?"margin":"border");return J(this,function(b,c,d){var e;return n.isWindow(b)?b.document.documentElement["client"+a]:9===b.nodeType?(e=b.documentElement,Math.max(b.body["scroll"+a],e["scroll"+a],b.body["offset"+a],e["offset"+a],e["client"+a])):void 0===d?n.css(b,c,g):n.style(b,c,d,g)},b,f?d:void 0,f,null)}})}),n.fn.size=function(){return this.length},n.fn.andSelf=n.fn.addBack,"function"==typeof define&&define.amd&&define("jquery",[],function(){return n});var Lc=a.jQuery,Mc=a.$;return n.noConflict=function(b){return a.$===n&&(a.$=Mc),b&&a.jQuery===n&&(a.jQuery=Lc),n},typeof b===U&&(a.jQuery=a.$=n),n}); +//# sourceMappingURL=jquery.min.map</script> + <script>/*! + * Bootstrap v3.3.1 (http://getbootstrap.com) + * Copyright 2011-2014 Twitter, Inc. + * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE) + */ +if("undefined"==typeof jQuery)throw new Error("Bootstrap's JavaScript requires jQuery");+function(a){var b=a.fn.jquery.split(" ")[0].split(".");if(b[0]<2&&b[1]<9||1==b[0]&&9==b[1]&&b[2]<1)throw new Error("Bootstrap's JavaScript requires jQuery version 1.9.1 or higher")}(jQuery),+function(a){"use strict";function b(){var a=document.createElement("bootstrap"),b={WebkitTransition:"webkitTransitionEnd",MozTransition:"transitionend",OTransition:"oTransitionEnd otransitionend",transition:"transitionend"};for(var c in b)if(void 0!==a.style[c])return{end:b[c]};return!1}a.fn.emulateTransitionEnd=function(b){var c=!1,d=this;a(this).one("bsTransitionEnd",function(){c=!0});var e=function(){c||a(d).trigger(a.support.transition.end)};return setTimeout(e,b),this},a(function(){a.support.transition=b(),a.support.transition&&(a.event.special.bsTransitionEnd={bindType:a.support.transition.end,delegateType:a.support.transition.end,handle:function(b){return a(b.target).is(this)?b.handleObj.handler.apply(this,arguments):void 0}})})}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var c=a(this),e=c.data("bs.alert");e||c.data("bs.alert",e=new d(this)),"string"==typeof b&&e[b].call(c)})}var c='[data-dismiss="alert"]',d=function(b){a(b).on("click",c,this.close)};d.VERSION="3.3.1",d.TRANSITION_DURATION=150,d.prototype.close=function(b){function c(){g.detach().trigger("closed.bs.alert").remove()}var e=a(this),f=e.attr("data-target");f||(f=e.attr("href"),f=f&&f.replace(/.*(?=#[^\s]*$)/,""));var g=a(f);b&&b.preventDefault(),g.length||(g=e.closest(".alert")),g.trigger(b=a.Event("close.bs.alert")),b.isDefaultPrevented()||(g.removeClass("in"),a.support.transition&&g.hasClass("fade")?g.one("bsTransitionEnd",c).emulateTransitionEnd(d.TRANSITION_DURATION):c())};var e=a.fn.alert;a.fn.alert=b,a.fn.alert.Constructor=d,a.fn.alert.noConflict=function(){return a.fn.alert=e,this},a(document).on("click.bs.alert.data-api",c,d.prototype.close)}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.button"),f="object"==typeof b&&b;e||d.data("bs.button",e=new c(this,f)),"toggle"==b?e.toggle():b&&e.setState(b)})}var c=function(b,d){this.$element=a(b),this.options=a.extend({},c.DEFAULTS,d),this.isLoading=!1};c.VERSION="3.3.1",c.DEFAULTS={loadingText:"loading..."},c.prototype.setState=function(b){var c="disabled",d=this.$element,e=d.is("input")?"val":"html",f=d.data();b+="Text",null==f.resetText&&d.data("resetText",d[e]()),setTimeout(a.proxy(function(){d[e](null==f[b]?this.options[b]:f[b]),"loadingText"==b?(this.isLoading=!0,d.addClass(c).attr(c,c)):this.isLoading&&(this.isLoading=!1,d.removeClass(c).removeAttr(c))},this),0)},c.prototype.toggle=function(){var a=!0,b=this.$element.closest('[data-toggle="buttons"]');if(b.length){var c=this.$element.find("input");"radio"==c.prop("type")&&(c.prop("checked")&&this.$element.hasClass("active")?a=!1:b.find(".active").removeClass("active")),a&&c.prop("checked",!this.$element.hasClass("active")).trigger("change")}else this.$element.attr("aria-pressed",!this.$element.hasClass("active"));a&&this.$element.toggleClass("active")};var d=a.fn.button;a.fn.button=b,a.fn.button.Constructor=c,a.fn.button.noConflict=function(){return a.fn.button=d,this},a(document).on("click.bs.button.data-api",'[data-toggle^="button"]',function(c){var d=a(c.target);d.hasClass("btn")||(d=d.closest(".btn")),b.call(d,"toggle"),c.preventDefault()}).on("focus.bs.button.data-api blur.bs.button.data-api",'[data-toggle^="button"]',function(b){a(b.target).closest(".btn").toggleClass("focus",/^focus(in)?$/.test(b.type))})}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.carousel"),f=a.extend({},c.DEFAULTS,d.data(),"object"==typeof b&&b),g="string"==typeof b?b:f.slide;e||d.data("bs.carousel",e=new c(this,f)),"number"==typeof b?e.to(b):g?e[g]():f.interval&&e.pause().cycle()})}var c=function(b,c){this.$element=a(b),this.$indicators=this.$element.find(".carousel-indicators"),this.options=c,this.paused=this.sliding=this.interval=this.$active=this.$items=null,this.options.keyboard&&this.$element.on("keydown.bs.carousel",a.proxy(this.keydown,this)),"hover"==this.options.pause&&!("ontouchstart"in document.documentElement)&&this.$element.on("mouseenter.bs.carousel",a.proxy(this.pause,this)).on("mouseleave.bs.carousel",a.proxy(this.cycle,this))};c.VERSION="3.3.1",c.TRANSITION_DURATION=600,c.DEFAULTS={interval:5e3,pause:"hover",wrap:!0,keyboard:!0},c.prototype.keydown=function(a){if(!/input|textarea/i.test(a.target.tagName)){switch(a.which){case 37:this.prev();break;case 39:this.next();break;default:return}a.preventDefault()}},c.prototype.cycle=function(b){return b||(this.paused=!1),this.interval&&clearInterval(this.interval),this.options.interval&&!this.paused&&(this.interval=setInterval(a.proxy(this.next,this),this.options.interval)),this},c.prototype.getItemIndex=function(a){return this.$items=a.parent().children(".item"),this.$items.index(a||this.$active)},c.prototype.getItemForDirection=function(a,b){var c="prev"==a?-1:1,d=this.getItemIndex(b),e=(d+c)%this.$items.length;return this.$items.eq(e)},c.prototype.to=function(a){var b=this,c=this.getItemIndex(this.$active=this.$element.find(".item.active"));return a>this.$items.length-1||0>a?void 0:this.sliding?this.$element.one("slid.bs.carousel",function(){b.to(a)}):c==a?this.pause().cycle():this.slide(a>c?"next":"prev",this.$items.eq(a))},c.prototype.pause=function(b){return b||(this.paused=!0),this.$element.find(".next, .prev").length&&a.support.transition&&(this.$element.trigger(a.support.transition.end),this.cycle(!0)),this.interval=clearInterval(this.interval),this},c.prototype.next=function(){return this.sliding?void 0:this.slide("next")},c.prototype.prev=function(){return this.sliding?void 0:this.slide("prev")},c.prototype.slide=function(b,d){var e=this.$element.find(".item.active"),f=d||this.getItemForDirection(b,e),g=this.interval,h="next"==b?"left":"right",i="next"==b?"first":"last",j=this;if(!f.length){if(!this.options.wrap)return;f=this.$element.find(".item")[i]()}if(f.hasClass("active"))return this.sliding=!1;var k=f[0],l=a.Event("slide.bs.carousel",{relatedTarget:k,direction:h});if(this.$element.trigger(l),!l.isDefaultPrevented()){if(this.sliding=!0,g&&this.pause(),this.$indicators.length){this.$indicators.find(".active").removeClass("active");var m=a(this.$indicators.children()[this.getItemIndex(f)]);m&&m.addClass("active")}var n=a.Event("slid.bs.carousel",{relatedTarget:k,direction:h});return a.support.transition&&this.$element.hasClass("slide")?(f.addClass(b),f[0].offsetWidth,e.addClass(h),f.addClass(h),e.one("bsTransitionEnd",function(){f.removeClass([b,h].join(" ")).addClass("active"),e.removeClass(["active",h].join(" ")),j.sliding=!1,setTimeout(function(){j.$element.trigger(n)},0)}).emulateTransitionEnd(c.TRANSITION_DURATION)):(e.removeClass("active"),f.addClass("active"),this.sliding=!1,this.$element.trigger(n)),g&&this.cycle(),this}};var d=a.fn.carousel;a.fn.carousel=b,a.fn.carousel.Constructor=c,a.fn.carousel.noConflict=function(){return a.fn.carousel=d,this};var e=function(c){var d,e=a(this),f=a(e.attr("data-target")||(d=e.attr("href"))&&d.replace(/.*(?=#[^\s]+$)/,""));if(f.hasClass("carousel")){var g=a.extend({},f.data(),e.data()),h=e.attr("data-slide-to");h&&(g.interval=!1),b.call(f,g),h&&f.data("bs.carousel").to(h),c.preventDefault()}};a(document).on("click.bs.carousel.data-api","[data-slide]",e).on("click.bs.carousel.data-api","[data-slide-to]",e),a(window).on("load",function(){a('[data-ride="carousel"]').each(function(){var c=a(this);b.call(c,c.data())})})}(jQuery),+function(a){"use strict";function b(b){var c,d=b.attr("data-target")||(c=b.attr("href"))&&c.replace(/.*(?=#[^\s]+$)/,"");return a(d)}function c(b){return this.each(function(){var c=a(this),e=c.data("bs.collapse"),f=a.extend({},d.DEFAULTS,c.data(),"object"==typeof b&&b);!e&&f.toggle&&"show"==b&&(f.toggle=!1),e||c.data("bs.collapse",e=new d(this,f)),"string"==typeof b&&e[b]()})}var d=function(b,c){this.$element=a(b),this.options=a.extend({},d.DEFAULTS,c),this.$trigger=a(this.options.trigger).filter('[href="#'+b.id+'"], [data-target="#'+b.id+'"]'),this.transitioning=null,this.options.parent?this.$parent=this.getParent():this.addAriaAndCollapsedClass(this.$element,this.$trigger),this.options.toggle&&this.toggle()};d.VERSION="3.3.1",d.TRANSITION_DURATION=350,d.DEFAULTS={toggle:!0,trigger:'[data-toggle="collapse"]'},d.prototype.dimension=function(){var a=this.$element.hasClass("width");return a?"width":"height"},d.prototype.show=function(){if(!this.transitioning&&!this.$element.hasClass("in")){var b,e=this.$parent&&this.$parent.find("> .panel").children(".in, .collapsing");if(!(e&&e.length&&(b=e.data("bs.collapse"),b&&b.transitioning))){var f=a.Event("show.bs.collapse");if(this.$element.trigger(f),!f.isDefaultPrevented()){e&&e.length&&(c.call(e,"hide"),b||e.data("bs.collapse",null));var g=this.dimension();this.$element.removeClass("collapse").addClass("collapsing")[g](0).attr("aria-expanded",!0),this.$trigger.removeClass("collapsed").attr("aria-expanded",!0),this.transitioning=1;var h=function(){this.$element.removeClass("collapsing").addClass("collapse in")[g](""),this.transitioning=0,this.$element.trigger("shown.bs.collapse")};if(!a.support.transition)return h.call(this);var i=a.camelCase(["scroll",g].join("-"));this.$element.one("bsTransitionEnd",a.proxy(h,this)).emulateTransitionEnd(d.TRANSITION_DURATION)[g](this.$element[0][i])}}}},d.prototype.hide=function(){if(!this.transitioning&&this.$element.hasClass("in")){var b=a.Event("hide.bs.collapse");if(this.$element.trigger(b),!b.isDefaultPrevented()){var c=this.dimension();this.$element[c](this.$element[c]())[0].offsetHeight,this.$element.addClass("collapsing").removeClass("collapse in").attr("aria-expanded",!1),this.$trigger.addClass("collapsed").attr("aria-expanded",!1),this.transitioning=1;var e=function(){this.transitioning=0,this.$element.removeClass("collapsing").addClass("collapse").trigger("hidden.bs.collapse")};return a.support.transition?void this.$element[c](0).one("bsTransitionEnd",a.proxy(e,this)).emulateTransitionEnd(d.TRANSITION_DURATION):e.call(this)}}},d.prototype.toggle=function(){this[this.$element.hasClass("in")?"hide":"show"]()},d.prototype.getParent=function(){return a(this.options.parent).find('[data-toggle="collapse"][data-parent="'+this.options.parent+'"]').each(a.proxy(function(c,d){var e=a(d);this.addAriaAndCollapsedClass(b(e),e)},this)).end()},d.prototype.addAriaAndCollapsedClass=function(a,b){var c=a.hasClass("in");a.attr("aria-expanded",c),b.toggleClass("collapsed",!c).attr("aria-expanded",c)};var e=a.fn.collapse;a.fn.collapse=c,a.fn.collapse.Constructor=d,a.fn.collapse.noConflict=function(){return a.fn.collapse=e,this},a(document).on("click.bs.collapse.data-api",'[data-toggle="collapse"]',function(d){var e=a(this);e.attr("data-target")||d.preventDefault();var f=b(e),g=f.data("bs.collapse"),h=g?"toggle":a.extend({},e.data(),{trigger:this});c.call(f,h)})}(jQuery),+function(a){"use strict";function b(b){b&&3===b.which||(a(e).remove(),a(f).each(function(){var d=a(this),e=c(d),f={relatedTarget:this};e.hasClass("open")&&(e.trigger(b=a.Event("hide.bs.dropdown",f)),b.isDefaultPrevented()||(d.attr("aria-expanded","false"),e.removeClass("open").trigger("hidden.bs.dropdown",f)))}))}function c(b){var c=b.attr("data-target");c||(c=b.attr("href"),c=c&&/#[A-Za-z]/.test(c)&&c.replace(/.*(?=#[^\s]*$)/,""));var d=c&&a(c);return d&&d.length?d:b.parent()}function d(b){return this.each(function(){var c=a(this),d=c.data("bs.dropdown");d||c.data("bs.dropdown",d=new g(this)),"string"==typeof b&&d[b].call(c)})}var e=".dropdown-backdrop",f='[data-toggle="dropdown"]',g=function(b){a(b).on("click.bs.dropdown",this.toggle)};g.VERSION="3.3.1",g.prototype.toggle=function(d){var e=a(this);if(!e.is(".disabled, :disabled")){var f=c(e),g=f.hasClass("open");if(b(),!g){"ontouchstart"in document.documentElement&&!f.closest(".navbar-nav").length&&a('<div class="dropdown-backdrop"/>').insertAfter(a(this)).on("click",b);var h={relatedTarget:this};if(f.trigger(d=a.Event("show.bs.dropdown",h)),d.isDefaultPrevented())return;e.trigger("focus").attr("aria-expanded","true"),f.toggleClass("open").trigger("shown.bs.dropdown",h)}return!1}},g.prototype.keydown=function(b){if(/(38|40|27|32)/.test(b.which)&&!/input|textarea/i.test(b.target.tagName)){var d=a(this);if(b.preventDefault(),b.stopPropagation(),!d.is(".disabled, :disabled")){var e=c(d),g=e.hasClass("open");if(!g&&27!=b.which||g&&27==b.which)return 27==b.which&&e.find(f).trigger("focus"),d.trigger("click");var h=" li:not(.divider):visible a",i=e.find('[role="menu"]'+h+', [role="listbox"]'+h);if(i.length){var j=i.index(b.target);38==b.which&&j>0&&j--,40==b.which&&j<i.length-1&&j++,~j||(j=0),i.eq(j).trigger("focus")}}}};var h=a.fn.dropdown;a.fn.dropdown=d,a.fn.dropdown.Constructor=g,a.fn.dropdown.noConflict=function(){return a.fn.dropdown=h,this},a(document).on("click.bs.dropdown.data-api",b).on("click.bs.dropdown.data-api",".dropdown form",function(a){a.stopPropagation()}).on("click.bs.dropdown.data-api",f,g.prototype.toggle).on("keydown.bs.dropdown.data-api",f,g.prototype.keydown).on("keydown.bs.dropdown.data-api",'[role="menu"]',g.prototype.keydown).on("keydown.bs.dropdown.data-api",'[role="listbox"]',g.prototype.keydown)}(jQuery),+function(a){"use strict";function b(b,d){return this.each(function(){var e=a(this),f=e.data("bs.modal"),g=a.extend({},c.DEFAULTS,e.data(),"object"==typeof b&&b);f||e.data("bs.modal",f=new c(this,g)),"string"==typeof b?f[b](d):g.show&&f.show(d)})}var c=function(b,c){this.options=c,this.$body=a(document.body),this.$element=a(b),this.$backdrop=this.isShown=null,this.scrollbarWidth=0,this.options.remote&&this.$element.find(".modal-content").load(this.options.remote,a.proxy(function(){this.$element.trigger("loaded.bs.modal")},this))};c.VERSION="3.3.1",c.TRANSITION_DURATION=300,c.BACKDROP_TRANSITION_DURATION=150,c.DEFAULTS={backdrop:!0,keyboard:!0,show:!0},c.prototype.toggle=function(a){return this.isShown?this.hide():this.show(a)},c.prototype.show=function(b){var d=this,e=a.Event("show.bs.modal",{relatedTarget:b});this.$element.trigger(e),this.isShown||e.isDefaultPrevented()||(this.isShown=!0,this.checkScrollbar(),this.setScrollbar(),this.$body.addClass("modal-open"),this.escape(),this.resize(),this.$element.on("click.dismiss.bs.modal",'[data-dismiss="modal"]',a.proxy(this.hide,this)),this.backdrop(function(){var e=a.support.transition&&d.$element.hasClass("fade");d.$element.parent().length||d.$element.appendTo(d.$body),d.$element.show().scrollTop(0),d.options.backdrop&&d.adjustBackdrop(),d.adjustDialog(),e&&d.$element[0].offsetWidth,d.$element.addClass("in").attr("aria-hidden",!1),d.enforceFocus();var f=a.Event("shown.bs.modal",{relatedTarget:b});e?d.$element.find(".modal-dialog").one("bsTransitionEnd",function(){d.$element.trigger("focus").trigger(f)}).emulateTransitionEnd(c.TRANSITION_DURATION):d.$element.trigger("focus").trigger(f)}))},c.prototype.hide=function(b){b&&b.preventDefault(),b=a.Event("hide.bs.modal"),this.$element.trigger(b),this.isShown&&!b.isDefaultPrevented()&&(this.isShown=!1,this.escape(),this.resize(),a(document).off("focusin.bs.modal"),this.$element.removeClass("in").attr("aria-hidden",!0).off("click.dismiss.bs.modal"),a.support.transition&&this.$element.hasClass("fade")?this.$element.one("bsTransitionEnd",a.proxy(this.hideModal,this)).emulateTransitionEnd(c.TRANSITION_DURATION):this.hideModal())},c.prototype.enforceFocus=function(){a(document).off("focusin.bs.modal").on("focusin.bs.modal",a.proxy(function(a){this.$element[0]===a.target||this.$element.has(a.target).length||this.$element.trigger("focus")},this))},c.prototype.escape=function(){this.isShown&&this.options.keyboard?this.$element.on("keydown.dismiss.bs.modal",a.proxy(function(a){27==a.which&&this.hide()},this)):this.isShown||this.$element.off("keydown.dismiss.bs.modal")},c.prototype.resize=function(){this.isShown?a(window).on("resize.bs.modal",a.proxy(this.handleUpdate,this)):a(window).off("resize.bs.modal")},c.prototype.hideModal=function(){var a=this;this.$element.hide(),this.backdrop(function(){a.$body.removeClass("modal-open"),a.resetAdjustments(),a.resetScrollbar(),a.$element.trigger("hidden.bs.modal")})},c.prototype.removeBackdrop=function(){this.$backdrop&&this.$backdrop.remove(),this.$backdrop=null},c.prototype.backdrop=function(b){var d=this,e=this.$element.hasClass("fade")?"fade":"";if(this.isShown&&this.options.backdrop){var f=a.support.transition&&e;if(this.$backdrop=a('<div class="modal-backdrop '+e+'" />').prependTo(this.$element).on("click.dismiss.bs.modal",a.proxy(function(a){a.target===a.currentTarget&&("static"==this.options.backdrop?this.$element[0].focus.call(this.$element[0]):this.hide.call(this))},this)),f&&this.$backdrop[0].offsetWidth,this.$backdrop.addClass("in"),!b)return;f?this.$backdrop.one("bsTransitionEnd",b).emulateTransitionEnd(c.BACKDROP_TRANSITION_DURATION):b()}else if(!this.isShown&&this.$backdrop){this.$backdrop.removeClass("in");var g=function(){d.removeBackdrop(),b&&b()};a.support.transition&&this.$element.hasClass("fade")?this.$backdrop.one("bsTransitionEnd",g).emulateTransitionEnd(c.BACKDROP_TRANSITION_DURATION):g()}else b&&b()},c.prototype.handleUpdate=function(){this.options.backdrop&&this.adjustBackdrop(),this.adjustDialog()},c.prototype.adjustBackdrop=function(){this.$backdrop.css("height",0).css("height",this.$element[0].scrollHeight)},c.prototype.adjustDialog=function(){var a=this.$element[0].scrollHeight>document.documentElement.clientHeight;this.$element.css({paddingLeft:!this.bodyIsOverflowing&&a?this.scrollbarWidth:"",paddingRight:this.bodyIsOverflowing&&!a?this.scrollbarWidth:""})},c.prototype.resetAdjustments=function(){this.$element.css({paddingLeft:"",paddingRight:""})},c.prototype.checkScrollbar=function(){this.bodyIsOverflowing=document.body.scrollHeight>document.documentElement.clientHeight,this.scrollbarWidth=this.measureScrollbar()},c.prototype.setScrollbar=function(){var a=parseInt(this.$body.css("padding-right")||0,10);this.bodyIsOverflowing&&this.$body.css("padding-right",a+this.scrollbarWidth)},c.prototype.resetScrollbar=function(){this.$body.css("padding-right","")},c.prototype.measureScrollbar=function(){var a=document.createElement("div");a.className="modal-scrollbar-measure",this.$body.append(a);var b=a.offsetWidth-a.clientWidth;return this.$body[0].removeChild(a),b};var d=a.fn.modal;a.fn.modal=b,a.fn.modal.Constructor=c,a.fn.modal.noConflict=function(){return a.fn.modal=d,this},a(document).on("click.bs.modal.data-api",'[data-toggle="modal"]',function(c){var d=a(this),e=d.attr("href"),f=a(d.attr("data-target")||e&&e.replace(/.*(?=#[^\s]+$)/,"")),g=f.data("bs.modal")?"toggle":a.extend({remote:!/#/.test(e)&&e},f.data(),d.data());d.is("a")&&c.preventDefault(),f.one("show.bs.modal",function(a){a.isDefaultPrevented()||f.one("hidden.bs.modal",function(){d.is(":visible")&&d.trigger("focus")})}),b.call(f,g,this)})}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.tooltip"),f="object"==typeof b&&b,g=f&&f.selector;(e||"destroy"!=b)&&(g?(e||d.data("bs.tooltip",e={}),e[g]||(e[g]=new c(this,f))):e||d.data("bs.tooltip",e=new c(this,f)),"string"==typeof b&&e[b]())})}var c=function(a,b){this.type=this.options=this.enabled=this.timeout=this.hoverState=this.$element=null,this.init("tooltip",a,b)};c.VERSION="3.3.1",c.TRANSITION_DURATION=150,c.DEFAULTS={animation:!0,placement:"top",selector:!1,template:'<div class="tooltip" role="tooltip"><div class="tooltip-arrow"></div><div class="tooltip-inner"></div></div>',trigger:"hover focus",title:"",delay:0,html:!1,container:!1,viewport:{selector:"body",padding:0}},c.prototype.init=function(b,c,d){this.enabled=!0,this.type=b,this.$element=a(c),this.options=this.getOptions(d),this.$viewport=this.options.viewport&&a(this.options.viewport.selector||this.options.viewport);for(var e=this.options.trigger.split(" "),f=e.length;f--;){var g=e[f];if("click"==g)this.$element.on("click."+this.type,this.options.selector,a.proxy(this.toggle,this));else if("manual"!=g){var h="hover"==g?"mouseenter":"focusin",i="hover"==g?"mouseleave":"focusout";this.$element.on(h+"."+this.type,this.options.selector,a.proxy(this.enter,this)),this.$element.on(i+"."+this.type,this.options.selector,a.proxy(this.leave,this))}}this.options.selector?this._options=a.extend({},this.options,{trigger:"manual",selector:""}):this.fixTitle()},c.prototype.getDefaults=function(){return c.DEFAULTS},c.prototype.getOptions=function(b){return b=a.extend({},this.getDefaults(),this.$element.data(),b),b.delay&&"number"==typeof b.delay&&(b.delay={show:b.delay,hide:b.delay}),b},c.prototype.getDelegateOptions=function(){var b={},c=this.getDefaults();return this._options&&a.each(this._options,function(a,d){c[a]!=d&&(b[a]=d)}),b},c.prototype.enter=function(b){var c=b instanceof this.constructor?b:a(b.currentTarget).data("bs."+this.type);return c&&c.$tip&&c.$tip.is(":visible")?void(c.hoverState="in"):(c||(c=new this.constructor(b.currentTarget,this.getDelegateOptions()),a(b.currentTarget).data("bs."+this.type,c)),clearTimeout(c.timeout),c.hoverState="in",c.options.delay&&c.options.delay.show?void(c.timeout=setTimeout(function(){"in"==c.hoverState&&c.show()},c.options.delay.show)):c.show())},c.prototype.leave=function(b){var c=b instanceof this.constructor?b:a(b.currentTarget).data("bs."+this.type);return c||(c=new this.constructor(b.currentTarget,this.getDelegateOptions()),a(b.currentTarget).data("bs."+this.type,c)),clearTimeout(c.timeout),c.hoverState="out",c.options.delay&&c.options.delay.hide?void(c.timeout=setTimeout(function(){"out"==c.hoverState&&c.hide()},c.options.delay.hide)):c.hide()},c.prototype.show=function(){var b=a.Event("show.bs."+this.type);if(this.hasContent()&&this.enabled){this.$element.trigger(b);var d=a.contains(this.$element[0].ownerDocument.documentElement,this.$element[0]);if(b.isDefaultPrevented()||!d)return;var e=this,f=this.tip(),g=this.getUID(this.type);this.setContent(),f.attr("id",g),this.$element.attr("aria-describedby",g),this.options.animation&&f.addClass("fade");var h="function"==typeof this.options.placement?this.options.placement.call(this,f[0],this.$element[0]):this.options.placement,i=/\s?auto?\s?/i,j=i.test(h);j&&(h=h.replace(i,"")||"top"),f.detach().css({top:0,left:0,display:"block"}).addClass(h).data("bs."+this.type,this),this.options.container?f.appendTo(this.options.container):f.insertAfter(this.$element);var k=this.getPosition(),l=f[0].offsetWidth,m=f[0].offsetHeight;if(j){var n=h,o=this.options.container?a(this.options.container):this.$element.parent(),p=this.getPosition(o);h="bottom"==h&&k.bottom+m>p.bottom?"top":"top"==h&&k.top-m<p.top?"bottom":"right"==h&&k.right+l>p.width?"left":"left"==h&&k.left-l<p.left?"right":h,f.removeClass(n).addClass(h)}var q=this.getCalculatedOffset(h,k,l,m);this.applyPlacement(q,h);var r=function(){var a=e.hoverState;e.$element.trigger("shown.bs."+e.type),e.hoverState=null,"out"==a&&e.leave(e)};a.support.transition&&this.$tip.hasClass("fade")?f.one("bsTransitionEnd",r).emulateTransitionEnd(c.TRANSITION_DURATION):r()}},c.prototype.applyPlacement=function(b,c){var d=this.tip(),e=d[0].offsetWidth,f=d[0].offsetHeight,g=parseInt(d.css("margin-top"),10),h=parseInt(d.css("margin-left"),10);isNaN(g)&&(g=0),isNaN(h)&&(h=0),b.top=b.top+g,b.left=b.left+h,a.offset.setOffset(d[0],a.extend({using:function(a){d.css({top:Math.round(a.top),left:Math.round(a.left)})}},b),0),d.addClass("in");var i=d[0].offsetWidth,j=d[0].offsetHeight;"top"==c&&j!=f&&(b.top=b.top+f-j);var k=this.getViewportAdjustedDelta(c,b,i,j);k.left?b.left+=k.left:b.top+=k.top;var l=/top|bottom/.test(c),m=l?2*k.left-e+i:2*k.top-f+j,n=l?"offsetWidth":"offsetHeight";d.offset(b),this.replaceArrow(m,d[0][n],l)},c.prototype.replaceArrow=function(a,b,c){this.arrow().css(c?"left":"top",50*(1-a/b)+"%").css(c?"top":"left","")},c.prototype.setContent=function(){var a=this.tip(),b=this.getTitle();a.find(".tooltip-inner")[this.options.html?"html":"text"](b),a.removeClass("fade in top bottom left right")},c.prototype.hide=function(b){function d(){"in"!=e.hoverState&&f.detach(),e.$element.removeAttr("aria-describedby").trigger("hidden.bs."+e.type),b&&b()}var e=this,f=this.tip(),g=a.Event("hide.bs."+this.type);return this.$element.trigger(g),g.isDefaultPrevented()?void 0:(f.removeClass("in"),a.support.transition&&this.$tip.hasClass("fade")?f.one("bsTransitionEnd",d).emulateTransitionEnd(c.TRANSITION_DURATION):d(),this.hoverState=null,this)},c.prototype.fixTitle=function(){var a=this.$element;(a.attr("title")||"string"!=typeof a.attr("data-original-title"))&&a.attr("data-original-title",a.attr("title")||"").attr("title","")},c.prototype.hasContent=function(){return this.getTitle()},c.prototype.getPosition=function(b){b=b||this.$element;var c=b[0],d="BODY"==c.tagName,e=c.getBoundingClientRect();null==e.width&&(e=a.extend({},e,{width:e.right-e.left,height:e.bottom-e.top}));var f=d?{top:0,left:0}:b.offset(),g={scroll:d?document.documentElement.scrollTop||document.body.scrollTop:b.scrollTop()},h=d?{width:a(window).width(),height:a(window).height()}:null;return a.extend({},e,g,h,f)},c.prototype.getCalculatedOffset=function(a,b,c,d){return"bottom"==a?{top:b.top+b.height,left:b.left+b.width/2-c/2}:"top"==a?{top:b.top-d,left:b.left+b.width/2-c/2}:"left"==a?{top:b.top+b.height/2-d/2,left:b.left-c}:{top:b.top+b.height/2-d/2,left:b.left+b.width}},c.prototype.getViewportAdjustedDelta=function(a,b,c,d){var e={top:0,left:0};if(!this.$viewport)return e;var f=this.options.viewport&&this.options.viewport.padding||0,g=this.getPosition(this.$viewport);if(/right|left/.test(a)){var h=b.top-f-g.scroll,i=b.top+f-g.scroll+d;h<g.top?e.top=g.top-h:i>g.top+g.height&&(e.top=g.top+g.height-i)}else{var j=b.left-f,k=b.left+f+c;j<g.left?e.left=g.left-j:k>g.width&&(e.left=g.left+g.width-k)}return e},c.prototype.getTitle=function(){var a,b=this.$element,c=this.options;return a=b.attr("data-original-title")||("function"==typeof c.title?c.title.call(b[0]):c.title)},c.prototype.getUID=function(a){do a+=~~(1e6*Math.random());while(document.getElementById(a));return a},c.prototype.tip=function(){return this.$tip=this.$tip||a(this.options.template)},c.prototype.arrow=function(){return this.$arrow=this.$arrow||this.tip().find(".tooltip-arrow")},c.prototype.enable=function(){this.enabled=!0},c.prototype.disable=function(){this.enabled=!1},c.prototype.toggleEnabled=function(){this.enabled=!this.enabled},c.prototype.toggle=function(b){var c=this;b&&(c=a(b.currentTarget).data("bs."+this.type),c||(c=new this.constructor(b.currentTarget,this.getDelegateOptions()),a(b.currentTarget).data("bs."+this.type,c))),c.tip().hasClass("in")?c.leave(c):c.enter(c)},c.prototype.destroy=function(){var a=this;clearTimeout(this.timeout),this.hide(function(){a.$element.off("."+a.type).removeData("bs."+a.type)})};var d=a.fn.tooltip;a.fn.tooltip=b,a.fn.tooltip.Constructor=c,a.fn.tooltip.noConflict=function(){return a.fn.tooltip=d,this}}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.popover"),f="object"==typeof b&&b,g=f&&f.selector;(e||"destroy"!=b)&&(g?(e||d.data("bs.popover",e={}),e[g]||(e[g]=new c(this,f))):e||d.data("bs.popover",e=new c(this,f)),"string"==typeof b&&e[b]())})}var c=function(a,b){this.init("popover",a,b)};if(!a.fn.tooltip)throw new Error("Popover requires tooltip.js");c.VERSION="3.3.1",c.DEFAULTS=a.extend({},a.fn.tooltip.Constructor.DEFAULTS,{placement:"right",trigger:"click",content:"",template:'<div class="popover" role="tooltip"><div class="arrow"></div><h3 class="popover-title"></h3><div class="popover-content"></div></div>'}),c.prototype=a.extend({},a.fn.tooltip.Constructor.prototype),c.prototype.constructor=c,c.prototype.getDefaults=function(){return c.DEFAULTS},c.prototype.setContent=function(){var a=this.tip(),b=this.getTitle(),c=this.getContent();a.find(".popover-title")[this.options.html?"html":"text"](b),a.find(".popover-content").children().detach().end()[this.options.html?"string"==typeof c?"html":"append":"text"](c),a.removeClass("fade top bottom left right in"),a.find(".popover-title").html()||a.find(".popover-title").hide()},c.prototype.hasContent=function(){return this.getTitle()||this.getContent()},c.prototype.getContent=function(){var a=this.$element,b=this.options;return a.attr("data-content")||("function"==typeof b.content?b.content.call(a[0]):b.content)},c.prototype.arrow=function(){return this.$arrow=this.$arrow||this.tip().find(".arrow")},c.prototype.tip=function(){return this.$tip||(this.$tip=a(this.options.template)),this.$tip};var d=a.fn.popover;a.fn.popover=b,a.fn.popover.Constructor=c,a.fn.popover.noConflict=function(){return a.fn.popover=d,this}}(jQuery),+function(a){"use strict";function b(c,d){var e=a.proxy(this.process,this);this.$body=a("body"),this.$scrollElement=a(a(c).is("body")?window:c),this.options=a.extend({},b.DEFAULTS,d),this.selector=(this.options.target||"")+" .nav li > a",this.offsets=[],this.targets=[],this.activeTarget=null,this.scrollHeight=0,this.$scrollElement.on("scroll.bs.scrollspy",e),this.refresh(),this.process()}function c(c){return this.each(function(){var d=a(this),e=d.data("bs.scrollspy"),f="object"==typeof c&&c;e||d.data("bs.scrollspy",e=new b(this,f)),"string"==typeof c&&e[c]()})}b.VERSION="3.3.1",b.DEFAULTS={offset:10},b.prototype.getScrollHeight=function(){return this.$scrollElement[0].scrollHeight||Math.max(this.$body[0].scrollHeight,document.documentElement.scrollHeight)},b.prototype.refresh=function(){var b="offset",c=0;a.isWindow(this.$scrollElement[0])||(b="position",c=this.$scrollElement.scrollTop()),this.offsets=[],this.targets=[],this.scrollHeight=this.getScrollHeight();var d=this;this.$body.find(this.selector).map(function(){var d=a(this),e=d.data("target")||d.attr("href"),f=/^#./.test(e)&&a(e);return f&&f.length&&f.is(":visible")&&[[f[b]().top+c,e]]||null}).sort(function(a,b){return a[0]-b[0]}).each(function(){d.offsets.push(this[0]),d.targets.push(this[1])})},b.prototype.process=function(){var a,b=this.$scrollElement.scrollTop()+this.options.offset,c=this.getScrollHeight(),d=this.options.offset+c-this.$scrollElement.height(),e=this.offsets,f=this.targets,g=this.activeTarget;if(this.scrollHeight!=c&&this.refresh(),b>=d)return g!=(a=f[f.length-1])&&this.activate(a);if(g&&b<e[0])return this.activeTarget=null,this.clear();for(a=e.length;a--;)g!=f[a]&&b>=e[a]&&(!e[a+1]||b<=e[a+1])&&this.activate(f[a])},b.prototype.activate=function(b){this.activeTarget=b,this.clear();var c=this.selector+'[data-target="'+b+'"],'+this.selector+'[href="'+b+'"]',d=a(c).parents("li").addClass("active");d.parent(".dropdown-menu").length&&(d=d.closest("li.dropdown").addClass("active")),d.trigger("activate.bs.scrollspy")},b.prototype.clear=function(){a(this.selector).parentsUntil(this.options.target,".active").removeClass("active")};var d=a.fn.scrollspy;a.fn.scrollspy=c,a.fn.scrollspy.Constructor=b,a.fn.scrollspy.noConflict=function(){return a.fn.scrollspy=d,this},a(window).on("load.bs.scrollspy.data-api",function(){a('[data-spy="scroll"]').each(function(){var b=a(this);c.call(b,b.data())})})}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.tab");e||d.data("bs.tab",e=new c(this)),"string"==typeof b&&e[b]()})}var c=function(b){this.element=a(b)};c.VERSION="3.3.1",c.TRANSITION_DURATION=150,c.prototype.show=function(){var b=this.element,c=b.closest("ul:not(.dropdown-menu)"),d=b.data("target");if(d||(d=b.attr("href"),d=d&&d.replace(/.*(?=#[^\s]*$)/,"")),!b.parent("li").hasClass("active")){var e=c.find(".active:last a"),f=a.Event("hide.bs.tab",{relatedTarget:b[0]}),g=a.Event("show.bs.tab",{relatedTarget:e[0]});if(e.trigger(f),b.trigger(g),!g.isDefaultPrevented()&&!f.isDefaultPrevented()){var h=a(d);this.activate(b.closest("li"),c),this.activate(h,h.parent(),function(){e.trigger({type:"hidden.bs.tab",relatedTarget:b[0]}),b.trigger({type:"shown.bs.tab",relatedTarget:e[0]}) +})}}},c.prototype.activate=function(b,d,e){function f(){g.removeClass("active").find("> .dropdown-menu > .active").removeClass("active").end().find('[data-toggle="tab"]').attr("aria-expanded",!1),b.addClass("active").find('[data-toggle="tab"]').attr("aria-expanded",!0),h?(b[0].offsetWidth,b.addClass("in")):b.removeClass("fade"),b.parent(".dropdown-menu")&&b.closest("li.dropdown").addClass("active").end().find('[data-toggle="tab"]').attr("aria-expanded",!0),e&&e()}var g=d.find("> .active"),h=e&&a.support.transition&&(g.length&&g.hasClass("fade")||!!d.find("> .fade").length);g.length&&h?g.one("bsTransitionEnd",f).emulateTransitionEnd(c.TRANSITION_DURATION):f(),g.removeClass("in")};var d=a.fn.tab;a.fn.tab=b,a.fn.tab.Constructor=c,a.fn.tab.noConflict=function(){return a.fn.tab=d,this};var e=function(c){c.preventDefault(),b.call(a(this),"show")};a(document).on("click.bs.tab.data-api",'[data-toggle="tab"]',e).on("click.bs.tab.data-api",'[data-toggle="pill"]',e)}(jQuery),+function(a){"use strict";function b(b){return this.each(function(){var d=a(this),e=d.data("bs.affix"),f="object"==typeof b&&b;e||d.data("bs.affix",e=new c(this,f)),"string"==typeof b&&e[b]()})}var c=function(b,d){this.options=a.extend({},c.DEFAULTS,d),this.$target=a(this.options.target).on("scroll.bs.affix.data-api",a.proxy(this.checkPosition,this)).on("click.bs.affix.data-api",a.proxy(this.checkPositionWithEventLoop,this)),this.$element=a(b),this.affixed=this.unpin=this.pinnedOffset=null,this.checkPosition()};c.VERSION="3.3.1",c.RESET="affix affix-top affix-bottom",c.DEFAULTS={offset:0,target:window},c.prototype.getState=function(a,b,c,d){var e=this.$target.scrollTop(),f=this.$element.offset(),g=this.$target.height();if(null!=c&&"top"==this.affixed)return c>e?"top":!1;if("bottom"==this.affixed)return null!=c?e+this.unpin<=f.top?!1:"bottom":a-d>=e+g?!1:"bottom";var h=null==this.affixed,i=h?e:f.top,j=h?g:b;return null!=c&&c>=i?"top":null!=d&&i+j>=a-d?"bottom":!1},c.prototype.getPinnedOffset=function(){if(this.pinnedOffset)return this.pinnedOffset;this.$element.removeClass(c.RESET).addClass("affix");var a=this.$target.scrollTop(),b=this.$element.offset();return this.pinnedOffset=b.top-a},c.prototype.checkPositionWithEventLoop=function(){setTimeout(a.proxy(this.checkPosition,this),1)},c.prototype.checkPosition=function(){if(this.$element.is(":visible")){var b=this.$element.height(),d=this.options.offset,e=d.top,f=d.bottom,g=a("body").height();"object"!=typeof d&&(f=e=d),"function"==typeof e&&(e=d.top(this.$element)),"function"==typeof f&&(f=d.bottom(this.$element));var h=this.getState(g,b,e,f);if(this.affixed!=h){null!=this.unpin&&this.$element.css("top","");var i="affix"+(h?"-"+h:""),j=a.Event(i+".bs.affix");if(this.$element.trigger(j),j.isDefaultPrevented())return;this.affixed=h,this.unpin="bottom"==h?this.getPinnedOffset():null,this.$element.removeClass(c.RESET).addClass(i).trigger(i.replace("affix","affixed")+".bs.affix")}"bottom"==h&&this.$element.offset({top:g-b-f})}};var d=a.fn.affix;a.fn.affix=b,a.fn.affix.Constructor=c,a.fn.affix.noConflict=function(){return a.fn.affix=d,this},a(window).on("load",function(){a('[data-spy="affix"]').each(function(){var c=a(this),d=c.data();d.offset=d.offset||{},null!=d.offsetBottom&&(d.offset.bottom=d.offsetBottom),null!=d.offsetTop&&(d.offset.top=d.offsetTop),b.call(c,d)})})}(jQuery);</script> + <script> +var renderTestResults = function(testData) { + var summary = testData["summary"]; + var numTests = summary["num_tests"]; + var numProblems = summary["num_errors"] + summary["num_failures"] + summary["num_skips"]; + var $overview = $("#overview-content"); + var $progress = $(".progress"); + if(numTests == 0) { + $overview.addClass("alert").addClass("alert-danger").text("No tests were executed."); + $progress.append($('<div class="progress-bar progress-bar-warning" role="progressbar" style="width: 100%" />')); + } else if(numProblems > 0) { + $overview.addClass("alert").addClass("alert-danger").text("There were problems with " + numProblems + " test(s) out of " + numTests + "."); + var problemPercent = (numProblems/(1.0 * numTests)) * 100.0; + var successPercent = 100.0 - problemPercent; + $progress.append($('<div class="progress-bar progress-bar-success" role="progressbar" style="width: ' + successPercent + '%" />')); + $progress.append($('<div class="progress-bar progress-bar-danger" role="progressbar" style="width: ' + problemPercent + '%" />')); + } else { + $overview.addClass("alert").addClass("alert-success").text("All " + numTests + " test(s) successfully executed."); + $progress.append($('<div class="progress-bar progress-bar-success" role="progressbar" style="width: 100%" />')); + } + + var $sidebar = $("#nav-sidebar-tests"); + for(var index in testData["tests"]) { + var test = testData["tests"][index]; + var testResult = new TestResult(test); + var rawId = testResult.rawId; + + var panelType = testResult.passed ? "panel-success panel-success-custom" : "panel-danger panel-danger-custom"; + var $panel = $('<div class="panel">'); + $panel.addClass(panelType); + + var $panelHeading = $('<div class="panel-heading">'); + var $panelTitle = $('<div class="panel-title">'); + var $a = $('<a class="collapsed" data-toggle="collapse">'); + $a.attr("id", rawId); + $a.attr("data-target", "#collapse" + index); + var testName = testResult.toolName + " (Test #" + (testResult.testIndex + 1) + (testResult.passed ? "" : ", Failed") + ")"; + $a.text(testName); + var $navLink = $('<a>').attr('href', '#' + rawId).text(testName) + if(!testResult.passed) { + $navLink.addClass("text-danger text-danger-custom"); + } else { + $navLink.addClass("text-success text-success-custom"); + } + $sidebar.append($('<li>').append( $navLink ) ); + $panelTitle.append($a) + $panelHeading.append($panelTitle); + + var $panelBody = $('<div class="panel-body panel-collapse collapse" >'); + $panelBody.attr("id", "collapse" + index); + + var $status = $('<div>').text("status: " + testResult.status); + $panelBody.append($status); + if(testResult.problems.length > 0) { + var $problemsLabel = $('<div>').text("problems: "); + var $problemsDiv = $('<div style="margin-left:10px;">'); + var $problemsUl = $('<ul>'); + for(var problemIndex in testResult.problems) { + $problemsUl.append($('<li>').append($('<pre>').text(testResult.problems[problemIndex]))); + } + $problemsDiv.append($problemsUl); + $panelBody.append($problemsLabel).append($problemsDiv); + } + var $commandLabel = $('<div>command:</div>'); + var $stdoutLabel = $('<div>job standard output:</div>'); + var $stderrLabel = $('<div>job standard error:</div>'); + var $command; + if(testResult.command !== null) { + $command = $('<pre class="pre-scrollable" style="margin-left:10px;">').text(testResult.command); + } else { + $command = $('<div class="alert alert-warning" style="margin-left:10px;">').text("No command recorded."); + } + var $stdout; + if(testResult.stdout !== null) { + $stdout = $('<pre class="pre-scrollable" style="margin-left:10px;">').text(testResult.stdout); + } else { + $stdout = $('<div class="alert alert-warning" style="margin-left:10px;">').text("No standard output recorded."); + } + var $stderr; + if(testResult.stderr !== null) { + $stderr = $('<pre class="pre-scrollable" style="margin-left:10px;">').text(testResult.stderr); + } else { + $stderr = $('<div class="alert alert-warning" style="margin-left:10px;">').text("No standard error recorded."); + } + $panelBody + .append($commandLabel) + .append($command) + .append($stdoutLabel) + .append($stdout) + .append($stderrLabel) + .append($stderr); + if(!testResult.passed) { + var $logLabel = $('<div>log:</div>'); + var $log = $('<pre class="pre-scrollable" style="margin-left: 10px;">').text(testResult.problemLog); + $panelBody.append($logLabel).append($log); + } + + $panel.append($panelHeading).append($panelBody); + $(".main").append($panel); + } +} + +var TestResult = function(data) { + this.rawId = data["id"]; + + var testMethod = this.rawId.split("TestForTool_")[1]; + var toolName = testMethod.split(".test_tool_")[0]; + var testIndex = testMethod.split(".test_tool_")[1]; + this.toolName = toolName; + this.testIndex = parseInt(testIndex); + console.log(data); + this.status = data["data"]["status"]; + var job = data["data"]["job"]; + if(job) { + this.stdout = data["data"]["job"]["stdout"]; + this.stderr = data["data"]["job"]["stderr"]; + this.command = data["data"]["job"]["command_line"]; + } else { + this.stdout = null; + this.stderr = null; + this.command = null; + } + this.problems = []; + var outputProblems = data["data"]["output_problems"] || []; + var executionProblem = data["data"]["execution_problem"]; + this.problems.push.apply(this.problems, outputProblems); + if(executionProblem) { + this.problems.push(executionProblem); + } + this.problemLog = data["data"]["problem_log"]; + this.passed = (this.status == "success"); +} + + +// http://stackoverflow.com/questions/19491336/get-url-parameter-jquery +function getUrlParameter(sParam) +{ + var sPageURL = window.location.search.substring(1); + var sURLVariables = sPageURL.split('&'); + for (var i = 0; i < sURLVariables.length; i++) + { + var sParameterName = sURLVariables[i].split('='); + if (sParameterName[0] == sParam) + { + return sParameterName[1]; + } + } +} +</script> + <script> + var testDataUrl = getUrlParameter("test_data_url"); + if(testDataUrl) { + $.ajax( + {'url': testDataUrl, + 'type': 'GET', + } + ) + .success(function(content) { renderTestResults( $.parseJSON(content) ); }) + .failure(function() { alert("Failed to load test data.")} ); + } else { + var test_data = {"tests": [{"data": {"status": "failure", "inputs": {"use_reference|reference_source|ref_file": {"src": "hda", "id": "5729865256bc2525"}, "use_reference|reference_source|reference_source_selector": "history", "use_reference|use_ref_selector": "yes", "input_file": {"src": "hda", "id": "2891970512fa2d5a"}}, "output_problems": ["History item different than expected, difference (using diff):\n( /Users/marten/devel/git/tools-devteam/tool_collections/samtools/samtools_stats/test-data/samtools_stats_out1.tab v. /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpVPmlQNsamtools_stats_out1.tab )\n--- local_file\n+++ history_data\n@@ -1,5 +1,5 @@\n-# This file was produced by samtools stats (1.2+htslib-1.2.1) and can be plotted using plot-bamstats\n-# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /Users/anton/galaxy-git/database/files/000/dataset_9.dat /Users/anton/galaxy-git/database/files/000/dataset_10.dat\n+# This file was produced by samtools stats (1.2+htslib-1.2) and can be plotted using plot-bamstats\n+# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_1.dat\n # CHK, Checksum\t[2]Read Names\t[3]Sequences\t[4]Qualities\n # CHK, CRC32 of reads which passed filtering followed by addition (32bit overflow)\n CHK\t1bd20fd8\t58ad2167\t29883386\n"], "job": {"inputs": {"ref_file": {"src": "hda", "id": "5729865256bc2525"}, "input_file": {"src": "hda", "id": "2891970512fa2d5a"}}, "update_time": "2015-04-21T21:45:40.695226", "tool_id": "samtools_stats", "outputs": {"output": {"src": "hda", "id": "54f2a3a23292eb07"}}, "stdout": "", "command_line": "ln -s \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat\" && samtools faidx `basename \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat\"` && samtools stats \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_1.dat\" --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat\" > \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_3.dat\"", "exit_code": 0, "state": "ok", "create_time": "2015-04-21T21:45:29.298433", "params": {"coverage_max": "\"1000\"", "gc_depth": "\"20000.0\"", "insert_size": "\"8000\"", "most_inserts": "\"0.99\"", "coverage_step": "\"1\"", "dbkey": "\"hg17\"", "coverage_min": "\"1\"", "read_length": "\"0\"", "trim_quality": "\"0\"", "filter_by_flags": "{\"filter_flags\": \"nofilter\", \"__current_case__\": 1}", "split_output": "{\"split_output_selector\": \"no\", \"__current_case__\": 0}", "use_reference": "{\"reference_source\": {\"ref_file\": 2, \"reference_source_selector\": \"history\", \"__current_case__\": 1}, \"use_ref_selector\": \"yes\", \"__current_case__\": 0}", "chromInfo": "\"/Users/marten/devel/git/galaxy/tool-data/shared/ucsc/chrom/hg17.len\"", "remove_dups": "\"False\""}, "stderr": "[fai_load] build FASTA index.\n", "job_metrics": [], "model_class": "Job", "external_id": "64545", "id": "54f2a3a23292eb07", "user_email": "test@bx.psu.edu"}, "problem_log": "Traceback (most recent call last):\n File \"/System/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/unittest/case.py\", line 331, in run\n testMethod()\n File \"/Users/marten/devel/git/galaxy/test/functional/test_toolbox.py\", line 268, in test_tool\n self.do_it( td )\n File \"/Users/marten/devel/git/galaxy/test/functional/test_toolbox.py\", line 67, in do_it\n raise e\nJobOutputsError: History item different than expected, difference (using diff):\n( /Users/marten/devel/git/tools-devteam/tool_collections/samtools/samtools_stats/test-data/samtools_stats_out1.tab v. /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpVPmlQNsamtools_stats_out1.tab )\n--- local_file\n+++ history_data\n@@ -1,5 +1,5 @@\n-# This file was produced by samtools stats (1.2+htslib-1.2.1) and can be plotted using plot-bamstats\n-# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /Users/anton/galaxy-git/database/files/000/dataset_9.dat /Users/anton/galaxy-git/database/files/000/dataset_10.dat\n+# This file was produced by samtools stats (1.2+htslib-1.2) and can be plotted using plot-bamstats\n+# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_1.dat\n # CHK, Checksum\t[2]Read Names\t[3]Sequences\t[4]Qualities\n # CHK, CRC32 of reads which passed filtering followed by addition (32bit overflow)\n CHK\t1bd20fd8\t58ad2167\t29883386\n\n-------------------- >> begin captured logging << --------------------\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.web.framework.webapp: INFO: Session authenticated using Galaxy master api key\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/users?key=test_key HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.web.framework.webapp: INFO: Session authenticated using Galaxy master api key\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/users HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.web.framework.webapp: INFO: Session authenticated using Galaxy master api key\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/users/2891970512fa2d5a/api_key HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/histories HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.tools.actions.upload_common: INFO: tool upload1 created job id 1\ngalaxy.tools.execute: DEBUG: Tool [upload1] created job [1] (721.369 ms)\ngalaxy.jobs: DEBUG: (1) Working directory for job is: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1\ngalaxy.jobs.handler: DEBUG: (1) Dispatching to local runner\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/tools HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs: DEBUG: (1) Persisting job destination (destination id: local:///)\ngalaxy.jobs.runners: DEBUG: Job [1] queued (3701.848 ms)\ngalaxy.jobs.handler: INFO: (1) Job dispatched\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs.runners: DEBUG: (1) command is: python /Users/marten/devel/git/galaxy/tools/data_source/upload.py /Users/marten/devel/git/galaxy /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpzTLxF3 1:/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/dataset_1_files:/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_1.dat; return_code=$?; python /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/set_metadata_aC_Epn.py /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/galaxy.json /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/metadata_in_HistoryDatasetAssociation_1_2YHWg0,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/metadata_kwds_HistoryDatasetAssociation_1_xxSWvK,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/metadata_out_HistoryDatasetAssociation_1_gpHI_B,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/metadata_results_HistoryDatasetAssociation_1_bOBqlz,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_1.dat,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/metadata_override_HistoryDatasetAssociation_1_chT4qY; sh -c \"exit $return_code\"\ngalaxy.jobs.runners.local: DEBUG: (1) executing job script: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/galaxy_1.sh\ngalaxy.jobs: DEBUG: (1) Persisting job destination (destination id: local:///)\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\ngalaxy.jobs.runners.local: DEBUG: execution finished: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/1/galaxy_1.sh\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs: DEBUG: job 1 ended (finish() executed in (3319.682 ms))\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.tools.actions.upload_common: INFO: tool upload1 created job id 2\ngalaxy.tools.execute: DEBUG: Tool [upload1] created job [2] (1436.682 ms)\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/tools HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs: DEBUG: (2) Working directory for job is: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2\ngalaxy.jobs.handler: DEBUG: (2) Dispatching to local runner\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs: DEBUG: (2) Persisting job destination (destination id: local:///)\ngalaxy.jobs.runners: DEBUG: Job [2] queued (2933.918 ms)\ngalaxy.jobs.handler: INFO: (2) Job dispatched\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs.runners: DEBUG: (2) command is: python /Users/marten/devel/git/galaxy/tools/data_source/upload.py /Users/marten/devel/git/galaxy /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpQj7Vtj 2:/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/dataset_2_files:/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat; return_code=$?; python /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/set_metadata_EnSKJC.py /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/galaxy.json /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/metadata_in_HistoryDatasetAssociation_2_EbkTIH,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/metadata_kwds_HistoryDatasetAssociation_2_A_ZJxl,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/metadata_out_HistoryDatasetAssociation_2_rYAxQD,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/metadata_results_HistoryDatasetAssociation_2_1V3qgk,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/metadata_override_HistoryDatasetAssociation_2_LI0aVu; sh -c \"exit $return_code\"\ngalaxy.jobs.runners.local: DEBUG: (2) executing job script: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/galaxy_2.sh\ngalaxy.jobs: DEBUG: (2) Persisting job destination (destination id: local:///)\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs.runners.local: DEBUG: execution finished: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/2/galaxy_2.sh\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs: DEBUG: job 2 ended (finish() executed in (5509.688 ms))\ngalaxy.tools.actions: INFO: Handled output (77.015 ms)\ngalaxy.tools.actions: INFO: Verified access to datasets (55.049 ms)\ngalaxy.tools.execute: DEBUG: Tool [samtools_stats] created job [3] (665.725 ms)\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/tools HTTP/1.1\" 200 None\ngalaxy.jobs: DEBUG: (3) Working directory for job is: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs.handler: DEBUG: (3) Dispatching to local runner\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/54f2a3a23292eb07?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\ngalaxy.jobs: DEBUG: (3) Persisting job destination (destination id: local:///)\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs.runners: DEBUG: Job [3] queued (1882.584 ms)\ngalaxy.jobs.handler: INFO: (3) Job dispatched\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/54f2a3a23292eb07?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/54f2a3a23292eb07?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\ngalaxy.jobs.runners: DEBUG: (3) command is: samtools --version | head -n 1 | awk '{ print $2 }' > /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/GALAXY_VERSION_STRING_3 2>&1; ln -s \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat\" && samtools faidx `basename \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat\"` && samtools stats \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_1.dat\" --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_2.dat\" > \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_3.dat\"; return_code=$?; python /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3/set_metadata_Zey9XK.py /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3/galaxy.json /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3/metadata_in_HistoryDatasetAssociation_3_c241v6,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3/metadata_kwds_HistoryDatasetAssociation_3_TUAqpX,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3/metadata_out_HistoryDatasetAssociation_3_fh3HTD,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3/metadata_results_HistoryDatasetAssociation_3_y4t5DA,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_3.dat,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3/metadata_override_HistoryDatasetAssociation_3_3rhcZs; sh -c \"exit $return_code\"\ngalaxy.jobs.runners.local: DEBUG: (3) executing job script: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3/galaxy_3.sh\ngalaxy.jobs: DEBUG: (3) Persisting job destination (destination id: local:///)\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/54f2a3a23292eb07?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\ngalaxy.jobs.runners.local: DEBUG: execution finished: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/3/galaxy_3.sh\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/54f2a3a23292eb07?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\ngalaxy.jobs: DEBUG: job 3 ended (finish() executed in (2080.708 ms))\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/54f2a3a23292eb07?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/54f2a3a23292eb07?full=true&key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/54f2a3a23292eb07?key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/2891970512fa2d5a/contents/54f2a3a23292eb07/display?raw=true&key=9b3be0c093fde28daf0ffc1ec9b125ca HTTP/1.1\" 200 None\nbase.twilltestcase: DEBUG: keepoutdir: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/jobfiles, ofn: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/jobfiles/samtools_stats_out1.tab\nbase.twilltestcase: DEBUG: ## GALAXY_TEST_SAVE=/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/jobfiles. saved /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/jobfiles/samtools_stats_out1.tab\nbase.twilltestcase: INFO: ## files diff on /Users/marten/devel/git/tools-devteam/tool_collections/samtools/samtools_stats/test-data/samtools_stats_out1.tab and /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpVPmlQNsamtools_stats_out1.tab lines_diff=2, found diff = 4\n--------------------- >> end captured logging << ---------------------\n", "problem_type": "functional.test_toolbox.JobOutputsError"}, "id": "functional.test_toolbox.TestForTool_samtools_stats.test_tool_000000", "has_data": true}, {"data": {"status": "failure", "inputs": {"use_reference|reference_source|reference_source_selector": "history", "input_file": {"src": "hda", "id": "8155e4b4bf1581ff"}, "split_output|split_output_selector": "yes", "split_output|generate_tables": ["sn", "mpc", "gcc"], "use_reference|use_ref_selector": "yes", "use_reference|reference_source|ref_file": {"src": "hda", "id": "7b55dbb89df8f4e5"}}, "output_problems": ["History item different than expected, difference (using diff):\n( /Users/marten/devel/git/tools-devteam/tool_collections/samtools/samtools_stats/test-data/samtools_stats_out2.tab v. /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpYr1M8Csamtools_stats_out2.tab )\n--- local_file\n+++ history_data\n@@ -1,5 +1,5 @@\n-# This file was produced by samtools stats (1.2+htslib-1.2.1) and can be plotted using plot-bamstats\n-# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /Users/anton/galaxy-git/database/files/000/dataset_9.dat /Users/anton/galaxy-git/database/files/000/dataset_10.dat\n+# This file was produced by samtools stats (1.2+htslib-1.2) and can be plotted using plot-bamstats\n+# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_4.dat\n # CHK, Checksum\t[2]Read Names\t[3]Sequences\t[4]Qualities\n # CHK, CRC32 of reads which passed filtering followed by addition (32bit overflow)\n CHK\t1bd20fd8\t58ad2167\t29883386\n"], "job": {"inputs": {"ref_file": {"src": "hda", "id": "7b55dbb89df8f4e5"}, "input_file": {"src": "hda", "id": "8155e4b4bf1581ff"}}, "update_time": "2015-04-21T21:46:44.081337", "tool_id": "samtools_stats", "outputs": {"__new_primary_file_output|Mismatches per cycle__": {"src": "hda", "id": "a90a30fafe298e1e"}, "__new_primary_file_output|Summary numbers__": {"src": "hda", "id": "b842d972534ccb3e"}, "__new_primary_file_output|ACGT content per cycle__": {"src": "hda", "id": "683bc220e21425bb"}, "output": {"src": "hda", "id": "fa6d20d0fb68383f"}}, "stdout": "sn,mpc,gcc\n", "command_line": "ln -s \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat\" && samtools faidx `basename \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat\"` && samtools stats \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_4.dat\" --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat\" > \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" && mkdir split && echo sn,mpc,gcc && echo \"# Summary Numbers\\n\" > \"split/Summary numbers.tab\" && grep -q ^SN \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" ; if [ $? = 0 ] ; then grep ^SN \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" | cut -f 2- >> \"split/Summary numbers.tab\" ; fi && echo \"# Columns correspond to qualities, rows to cycles. First column is the cycle number, second is the number of N's and the rest is the number of mismatches\" > \"split/Mismatches per cycle.tab\" && grep -q ^MPC \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" ; if [ $? = 0 ] ; then grep ^MPC \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" | cut -f 2- >> \"split/Mismatches per cycle.tab\" ; fi && echo \"# ACGT content per cycle. The columns are: cycle, and A,C,G,T counts (percent)\" > \"split/ACGT content per cycle.tab\" && grep -q ^GCC \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" ; if [ $? = 0 ] ; then grep ^GCC \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" | cut -f 2- >> \"split/ACGT content per cycle.tab\" ; fi && true", "exit_code": 0, "state": "ok", "create_time": "2015-04-21T21:46:23.415078", "params": {"coverage_max": "\"1000\"", "gc_depth": "\"20000.0\"", "insert_size": "\"8000\"", "most_inserts": "\"0.99\"", "coverage_step": "\"1\"", "dbkey": "\"hg17\"", "coverage_min": "\"1\"", "read_length": "\"0\"", "trim_quality": "\"0\"", "filter_by_flags": "{\"filter_flags\": \"nofilter\", \"__current_case__\": 1}", "split_output": "{\"generate_tables\": [\"sn\", \"mpc\", \"gcc\"], \"split_output_selector\": \"yes\", \"__current_case__\": 1}", "use_reference": "{\"reference_source\": {\"ref_file\": 5, \"reference_source_selector\": \"history\", \"__current_case__\": 1}, \"use_ref_selector\": \"yes\", \"__current_case__\": 0}", "chromInfo": "\"/Users/marten/devel/git/galaxy/tool-data/shared/ucsc/chrom/hg17.len\"", "remove_dups": "\"False\""}, "stderr": "[fai_load] build FASTA index.\n", "job_metrics": [], "model_class": "Job", "external_id": "64605", "id": "fa6d20d0fb68383f", "user_email": "test@bx.psu.edu"}, "problem_log": "Traceback (most recent call last):\n File \"/System/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/unittest/case.py\", line 331, in run\n testMethod()\n File \"/Users/marten/devel/git/galaxy/test/functional/test_toolbox.py\", line 268, in test_tool\n self.do_it( td )\n File \"/Users/marten/devel/git/galaxy/test/functional/test_toolbox.py\", line 67, in do_it\n raise e\nJobOutputsError: History item different than expected, difference (using diff):\n( /Users/marten/devel/git/tools-devteam/tool_collections/samtools/samtools_stats/test-data/samtools_stats_out2.tab v. /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpYr1M8Csamtools_stats_out2.tab )\n--- local_file\n+++ history_data\n@@ -1,5 +1,5 @@\n-# This file was produced by samtools stats (1.2+htslib-1.2.1) and can be plotted using plot-bamstats\n-# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /Users/anton/galaxy-git/database/files/000/dataset_9.dat /Users/anton/galaxy-git/database/files/000/dataset_10.dat\n+# This file was produced by samtools stats (1.2+htslib-1.2) and can be plotted using plot-bamstats\n+# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_4.dat\n # CHK, Checksum\t[2]Read Names\t[3]Sequences\t[4]Qualities\n # CHK, CRC32 of reads which passed filtering followed by addition (32bit overflow)\n CHK\t1bd20fd8\t58ad2167\t29883386\n\n-------------------- >> begin captured logging << --------------------\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.web.framework.webapp: INFO: Session authenticated using Galaxy master api key\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/users?key=test_key HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.web.framework.webapp: INFO: Session authenticated using Galaxy master api key\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/users/2891970512fa2d5a/api_key HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/histories HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.tools.actions.upload_common: INFO: tool upload1 created job id 4\ngalaxy.tools.execute: DEBUG: Tool [upload1] created job [4] (488.979 ms)\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/tools HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs: DEBUG: (4) Working directory for job is: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs.handler: DEBUG: (4) Dispatching to local runner\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs: DEBUG: (4) Persisting job destination (destination id: local:///)\ngalaxy.jobs.runners: DEBUG: Job [4] queued (3770.035 ms)\ngalaxy.jobs.handler: INFO: (4) Job dispatched\ngalaxy.jobs.runners: DEBUG: (4) command is: python /Users/marten/devel/git/galaxy/tools/data_source/upload.py /Users/marten/devel/git/galaxy /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpovV4Rg 4:/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/dataset_4_files:/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_4.dat; return_code=$?; python /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/set_metadata_pDUWU1.py /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/galaxy.json /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/metadata_in_HistoryDatasetAssociation_4_KJFVUK,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/metadata_kwds_HistoryDatasetAssociation_4_eC_v98,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/metadata_out_HistoryDatasetAssociation_4_PVfJHp,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/metadata_results_HistoryDatasetAssociation_4_JUuyR2,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_4.dat,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/metadata_override_HistoryDatasetAssociation_4_OMLQxN; sh -c \"exit $return_code\"\ngalaxy.jobs.runners.local: DEBUG: (4) executing job script: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/galaxy_4.sh\ngalaxy.jobs: DEBUG: (4) Persisting job destination (destination id: local:///)\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\ngalaxy.jobs.runners.local: DEBUG: execution finished: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/4/galaxy_4.sh\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs: DEBUG: job 4 ended (finish() executed in (7314.557 ms))\ngalaxy.tools.actions.upload_common: INFO: tool upload1 created job id 5\ngalaxy.tools.execute: DEBUG: Tool [upload1] created job [5] (380.201 ms)\ngalaxy.jobs: DEBUG: (5) Working directory for job is: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/tools HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs.handler: DEBUG: (5) Dispatching to local runner\ngalaxy.jobs: DEBUG: (5) Persisting job destination (destination id: local:///)\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs.runners: DEBUG: Job [5] queued (2761.054 ms)\ngalaxy.jobs.handler: INFO: (5) Job dispatched\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs.runners: DEBUG: (5) command is: python /Users/marten/devel/git/galaxy/tools/data_source/upload.py /Users/marten/devel/git/galaxy /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpx_FyDt 5:/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/dataset_5_files:/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat; return_code=$?; python /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/set_metadata_ErwZWr.py /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/galaxy.json /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/metadata_in_HistoryDatasetAssociation_5_bf6GWj,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/metadata_kwds_HistoryDatasetAssociation_5_qdTYxt,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/metadata_out_HistoryDatasetAssociation_5_nILjxU,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/metadata_results_HistoryDatasetAssociation_5_nF9gHk,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/metadata_override_HistoryDatasetAssociation_5_xELsea; sh -c \"exit $return_code\"\ngalaxy.jobs.runners.local: DEBUG: (5) executing job script: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/galaxy_5.sh\ngalaxy.jobs: DEBUG: (5) Persisting job destination (destination id: local:///)\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\ngalaxy.jobs.runners.local: DEBUG: execution finished: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/5/galaxy_5.sh\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.tools.actions: INFO: Handled output (619.072 ms)\nsqlalchemy.pool.NullPool: ERROR: Exception during reset or similar\nTraceback (most recent call last):\n File \"build/bdist.macosx-10.6-intel/egg/sqlalchemy/pool.py\", line 567, in _finalize_fairy\n fairy._reset(pool)\n File \"build/bdist.macosx-10.6-intel/egg/sqlalchemy/pool.py\", line 701, in _reset\n pool._dialect.do_rollback(self)\n File \"build/bdist.macosx-10.6-intel/egg/sqlalchemy/engine/default.py\", line 412, in do_rollback\n dbapi_connection.rollback()\nProgrammingError: SQLite objects created in a thread can only be used in that same thread.The object was created in thread id 4568608768 and this is thread id 4471201792\nsqlalchemy.pool.NullPool: ERROR: Exception closing connection <pysqlite2.dbapi2.Connection object at 0x111207ce0>\nTraceback (most recent call last):\n File \"build/bdist.macosx-10.6-intel/egg/sqlalchemy/pool.py\", line 251, in _close_connection\n self._dialect.do_close(connection)\n File \"build/bdist.macosx-10.6-intel/egg/sqlalchemy/engine/default.py\", line 418, in do_close\n dbapi_connection.close()\nProgrammingError: SQLite objects created in a thread can only be used in that same thread.The object was created in thread id 4568608768 and this is thread id 4471201792\ngalaxy.jobs: DEBUG: job 5 ended (finish() executed in (6572.427 ms))\ngalaxy.tools.actions: INFO: Verified access to datasets (340.159 ms)\ngalaxy.tools.execute: DEBUG: Tool [samtools_stats] created job [6] (4823.769 ms)\ngalaxy.jobs: DEBUG: (6) Working directory for job is: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6\ngalaxy.jobs.handler: DEBUG: (6) Dispatching to local runner\nrequests.packages.urllib3.connectionpool: DEBUG: \"POST /api/tools HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\ngalaxy.jobs: DEBUG: (6) Persisting job destination (destination id: local:///)\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/fa6d20d0fb68383f?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\ngalaxy.jobs.runners: DEBUG: Job [6] queued (3581.802 ms)\ngalaxy.jobs.handler: INFO: (6) Job dispatched\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/fa6d20d0fb68383f?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/fa6d20d0fb68383f?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/fa6d20d0fb68383f?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\ngalaxy.jobs.runners: DEBUG: (6) command is: samtools --version | head -n 1 | awk '{ print $2 }' > /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/GALAXY_VERSION_STRING_6 2>&1; ln -s \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat\" && samtools faidx `basename \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat\"` && samtools stats \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_4.dat\" --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_5.dat\" > \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" && mkdir split && echo sn,mpc,gcc && echo \"# Summary Numbers\\n\" > \"split/Summary numbers.tab\" && grep -q ^SN \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" ; if [ $? = 0 ] ; then grep ^SN \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" | cut -f 2- >> \"split/Summary numbers.tab\" ; fi && echo \"# Columns correspond to qualities, rows to cycles. First column is the cycle number, second is the number of N's and the rest is the number of mismatches\" > \"split/Mismatches per cycle.tab\" && grep -q ^MPC \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" ; if [ $? = 0 ] ; then grep ^MPC \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" | cut -f 2- >> \"split/Mismatches per cycle.tab\" ; fi && echo \"# ACGT content per cycle. The columns are: cycle, and A,C,G,T counts (percent)\" > \"split/ACGT content per cycle.tab\" && grep -q ^GCC \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" ; if [ $? = 0 ] ; then grep ^GCC \"/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat\" | cut -f 2- >> \"split/ACGT content per cycle.tab\" ; fi && true; return_code=$?; python /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6/set_metadata_LSTtun.py /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpcOV73W /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6/galaxy.json /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6/metadata_in_HistoryDatasetAssociation_6_uh9zmy,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6/metadata_kwds_HistoryDatasetAssociation_6_6GLt0N,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6/metadata_out_HistoryDatasetAssociation_6_OK7DHx,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6/metadata_results_HistoryDatasetAssociation_6_GeXlkW,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/files/000/dataset_6.dat,/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6/metadata_override_HistoryDatasetAssociation_6_ZyuaJN; sh -c \"exit $return_code\"\ngalaxy.jobs.runners.local: DEBUG: (6) executing job script: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6/galaxy_6.sh\ngalaxy.jobs: DEBUG: (6) Persisting job destination (destination id: local:///)\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/fa6d20d0fb68383f?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\ngalaxy.jobs.runners.local: DEBUG: execution finished: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/job_working_directory/000/6/galaxy_6.sh\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/fa6d20d0fb68383f?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\ngalaxy.jobs: DEBUG: job 6 ended (finish() executed in (6680.679 ms))\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/fa6d20d0fb68383f?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/fa6d20d0fb68383f?full=true&key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/jobs/fa6d20d0fb68383f?key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nrequests.packages.urllib3.connectionpool: INFO: Starting new HTTP connection (1): localhost\nrequests.packages.urllib3.connectionpool: DEBUG: \"GET /api/histories/5729865256bc2525/contents/fa6d20d0fb68383f/display?raw=true&key=73391df1185a0911acd55c3f7fae680e HTTP/1.1\" 200 None\nbase.twilltestcase: DEBUG: keepoutdir: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/jobfiles, ofn: /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/jobfiles/samtools_stats_out2.tab\nbase.twilltestcase: DEBUG: ## GALAXY_TEST_SAVE=/var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/jobfiles. saved /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/jobfiles/samtools_stats_out2.tab\nbase.twilltestcase: INFO: ## files diff on /Users/marten/devel/git/tools-devteam/tool_collections/samtools/samtools_stats/test-data/samtools_stats_out2.tab and /var/folders/2z/ntdb9g2n7tq6_bcq4dj9hj9r0000gn/T/tmp69oNhW/tmp/tmpYr1M8Csamtools_stats_out2.tab lines_diff=2, found diff = 4\n--------------------- >> end captured logging << ---------------------\n", "problem_type": "functional.test_toolbox.JobOutputsError"}, "id": "functional.test_toolbox.TestForTool_samtools_stats.test_tool_000001", "has_data": true}], "version": "0.1", "summary": {"num_skips": 0, "num_errors": 0, "num_failures": 2, "num_tests": 2}}; + renderTestResults(test_data); + } + </script> + </body> +</html>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/samtools_stats_out1.tab Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,1137 @@ +# This file was produced by samtools stats (1.2+htslib-1.2.1) and can be plotted using plot-bamstats +# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /Users/anton/galaxy-git/database/files/000/dataset_9.dat /Users/anton/galaxy-git/database/files/000/dataset_10.dat +# CHK, Checksum [2]Read Names [3]Sequences [4]Qualities +# CHK, CRC32 of reads which passed filtering followed by addition (32bit overflow) +CHK 1bd20fd8 58ad2167 29883386 +# Summary Numbers. Use `grep ^SN | cut -f 2-` to extract this part. +SN raw total sequences: 200 +SN filtered sequences: 0 +SN sequences: 200 +SN is sorted: 1 +SN 1st fragments: 100 +SN last fragments: 100 +SN reads mapped: 25 +SN reads mapped and paired: 0 # paired-end technology bit set + both mates mapped +SN reads unmapped: 175 +SN reads properly paired: 0 # proper-pair bit set +SN reads paired: 200 # paired-end technology bit set +SN reads duplicated: 0 # PCR or optical duplicate bit set +SN reads MQ0: 6 # mapped and MQ=0 +SN reads QC failed: 0 +SN non-primary alignments: 0 +SN total length: 50200 # ignores clipping +SN bases mapped: 6275 # ignores clipping +SN bases mapped (cigar): 6275 # more accurate +SN bases trimmed: 0 +SN bases duplicated: 0 +SN mismatches: 591 # from NM fields +SN error rate: 9.418327e-02 # mismatches / bases mapped (cigar) +SN average length: 251 +SN maximum length: 251 +SN average quality: 34.7 +SN insert size average: 0.0 +SN insert size standard deviation: 0.0 +SN inward oriented pairs: 0 +SN outward oriented pairs: 0 +SN pairs with other orientation: 0 +SN pairs on different chromosomes: 0 +# First Fragment Qualitites. Use `grep ^FFQ | cut -f 2-` to extract this part. +# Columns correspond to qualities and rows to cycles. First column is the cycle number. +FFQ 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 3 2 0 20 38 32 1 0 0 0 0 0 0 +FFQ 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 3 0 0 18 36 36 6 0 0 0 0 0 0 +FFQ 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 14 31 46 5 0 0 0 0 0 0 +FFQ 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 8 36 42 11 0 0 0 0 0 0 +FFQ 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 12 35 43 6 0 0 0 0 0 0 +FFQ 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 7 8 0 0 81 0 0 0 0 +FFQ 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 13 1 0 76 0 0 0 0 +FFQ 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 11 15 4 0 69 0 0 0 0 +FFQ 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 6 20 3 0 68 0 0 0 0 +FFQ 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 11 5 0 75 0 0 0 0 +FFQ 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 6 16 6 0 70 0 0 0 0 +FFQ 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 8 2 0 86 0 0 0 0 +FFQ 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 3 92 0 0 0 +FFQ 14 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 2 1 0 3 89 0 0 0 +FFQ 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 4 91 0 0 0 +FFQ 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 96 0 0 0 +FFQ 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 3 94 0 0 0 +FFQ 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 2 93 0 0 0 +FFQ 19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 93 0 0 0 +FFQ 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 4 91 0 0 0 +FFQ 21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 3 94 0 0 0 +FFQ 22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 97 0 0 0 +FFQ 23 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 18 74 0 0 +FFQ 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 19 76 0 0 +FFQ 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 4 15 76 0 0 +FFQ 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 2 18 75 0 0 +FFQ 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 12 84 0 0 +FFQ 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 5 16 74 0 0 +FFQ 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 6 19 73 0 0 +FFQ 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 12 17 67 0 0 +FFQ 31 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 0 1 2 15 77 0 0 +FFQ 32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 7 22 68 0 0 +FFQ 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 0 1 3 18 73 0 0 +FFQ 34 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 7 19 72 0 0 +FFQ 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 2 23 71 0 0 +FFQ 36 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 26 69 0 0 +FFQ 37 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 3 0 6 23 65 0 0 +FFQ 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 31 63 0 0 +FFQ 39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 5 33 56 0 0 +FFQ 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 3 1 1 7 25 60 0 0 +FFQ 41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 1 7 19 67 0 0 +FFQ 42 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 7 21 68 0 0 +FFQ 43 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 4 5 28 56 0 0 +FFQ 44 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 2 13 29 49 0 0 +FFQ 45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 7 31 57 0 0 +FFQ 46 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 4 2 8 34 49 0 0 +FFQ 47 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 1 1 0 8 22 63 0 0 +FFQ 48 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 7 24 64 0 0 +FFQ 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 9 28 58 0 0 +FFQ 50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 1 6 12 76 0 0 +FFQ 51 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 4 2 28 63 0 0 +FFQ 52 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 6 27 62 0 0 +FFQ 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 2 8 27 58 0 0 +FFQ 54 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 21 73 0 0 +FFQ 55 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 8 18 68 0 0 +FFQ 56 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 6 9 18 63 0 0 +FFQ 57 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 1 9 18 69 0 0 +FFQ 58 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 4 6 17 69 2 0 +FFQ 59 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 4 2 22 65 1 0 +FFQ 60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 3 6 19 64 1 0 +FFQ 61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 6 28 61 0 0 +FFQ 62 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 3 4 6 23 59 2 0 +FFQ 63 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 4 9 31 51 2 0 +FFQ 64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 4 8 29 53 0 0 +FFQ 65 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 1 7 5 26 57 0 0 +FFQ 66 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 1 2 2 3 20 64 2 0 +FFQ 67 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 2 0 3 10 25 56 0 0 +FFQ 68 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 1 1 2 5 6 19 61 0 0 +FFQ 69 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 8 19 63 0 0 +FFQ 70 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 7 4 25 58 0 0 +FFQ 71 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 9 28 55 0 0 +FFQ 72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 1 0 0 0 1 0 2 2 0 0 6 7 24 54 0 0 +FFQ 73 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 5 8 25 57 0 0 +FFQ 74 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 2 0 2 0 1 1 4 10 24 52 0 0 +FFQ 75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 1 9 11 21 52 0 0 +FFQ 76 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 4 1 0 3 1 0 7 6 22 52 0 0 +FFQ 77 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 2 2 0 1 10 12 23 47 0 0 +FFQ 78 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 5 8 37 44 0 0 +FFQ 79 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 3 10 27 56 0 0 +FFQ 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 0 1 1 0 3 12 30 48 0 0 +FFQ 81 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 7 7 33 46 0 0 +FFQ 82 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 3 0 7 7 22 56 0 0 +FFQ 83 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 5 2 3 8 25 52 0 0 +FFQ 84 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 1 0 3 1 0 4 11 32 45 0 0 +FFQ 85 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 2 2 0 1 4 0 1 12 22 54 0 0 +FFQ 86 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 4 5 12 28 46 0 0 +FFQ 87 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 1 5 9 29 47 0 0 +FFQ 88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 2 2 0 1 2 15 38 38 0 0 +FFQ 89 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 0 1 0 3 11 34 46 0 0 +FFQ 90 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 1 4 11 31 47 0 0 +FFQ 91 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 2 0 1 0 2 6 32 53 0 0 +FFQ 92 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 3 10 23 60 0 0 +FFQ 93 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 4 10 32 50 0 0 +FFQ 94 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 3 0 0 0 5 7 29 54 0 0 +FFQ 95 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 3 8 26 56 0 0 +FFQ 96 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 4 8 21 61 0 0 +FFQ 97 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 5 0 2 6 5 23 56 0 0 +FFQ 98 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 5 10 21 57 0 0 +FFQ 99 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 3 1 4 6 33 48 0 0 +FFQ 100 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 1 2 0 2 2 0 3 5 23 56 0 0 +FFQ 101 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 9 36 44 0 0 +FFQ 102 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 7 5 34 47 0 0 +FFQ 103 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 2 1 1 3 8 35 48 0 0 +FFQ 104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 5 7 36 49 0 0 +FFQ 105 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 5 9 32 48 0 0 +FFQ 106 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 3 5 4 9 23 52 0 0 +FFQ 107 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 5 9 33 43 0 0 +FFQ 108 0 0 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 3 3 13 23 51 0 0 +FFQ 109 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 2 1 6 12 39 35 0 0 +FFQ 110 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 1 1 0 0 0 0 0 1 0 0 0 0 1 1 0 2 0 3 2 8 36 40 0 0 +FFQ 111 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 1 1 3 3 1 2 3 8 30 44 0 0 +FFQ 112 0 0 1 0 0 0 0 0 0 0 0 0 2 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 3 0 4 14 28 42 0 0 +FFQ 113 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 1 0 3 0 2 1 5 10 31 43 0 0 +FFQ 114 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 2 3 4 10 29 44 0 0 +FFQ 115 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 3 4 3 7 9 37 32 0 0 +FFQ 116 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 2 0 0 0 0 0 1 0 0 0 0 0 2 0 1 1 3 5 1 12 35 34 0 0 +FFQ 117 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 1 0 0 0 0 1 3 1 1 1 1 1 2 9 34 42 0 0 +FFQ 118 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 3 1 2 2 1 9 33 43 0 0 +FFQ 119 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 1 2 3 13 38 36 0 0 +FFQ 120 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 1 3 3 4 13 26 44 0 0 +FFQ 121 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 2 0 0 1 0 0 0 0 0 1 1 3 3 7 26 53 0 0 +FFQ 122 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 3 1 3 7 28 52 0 0 +FFQ 123 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 2 0 0 1 5 4 4 12 18 50 0 0 +FFQ 124 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 6 2 2 13 35 37 0 0 +FFQ 125 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 3 0 1 0 4 2 3 14 34 34 0 0 +FFQ 126 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 2 1 4 3 2 11 39 33 0 0 +FFQ 127 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 1 2 2 2 9 35 43 0 0 +FFQ 128 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 2 0 0 1 0 0 2 0 0 1 8 1 1 8 36 37 0 0 +FFQ 129 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 1 5 2 4 12 30 40 0 0 +FFQ 130 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 2 1 2 1 3 13 23 47 0 0 +FFQ 131 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 1 0 1 4 3 3 12 27 45 0 0 +FFQ 132 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 4 5 14 25 44 0 0 +FFQ 133 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 2 1 6 5 3 7 34 36 0 0 +FFQ 134 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 3 1 4 8 2 10 32 34 0 0 +FFQ 135 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 1 3 5 3 13 35 31 0 0 +FFQ 136 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 2 2 4 2 3 6 2 15 35 25 0 0 +FFQ 137 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 2 0 1 7 2 3 15 29 35 0 0 +FFQ 138 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 2 2 3 5 9 33 35 0 0 +FFQ 139 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 0 0 0 0 0 0 0 0 2 0 0 0 1 0 1 0 2 1 6 4 1 20 25 32 0 0 +FFQ 140 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 1 2 1 0 0 1 0 1 0 3 3 3 20 32 30 0 0 +FFQ 141 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 1 1 0 1 2 1 2 0 3 2 1 19 36 27 0 0 +FFQ 142 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 4 2 5 3 4 23 34 17 0 0 +FFQ 143 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 1 1 0 0 0 0 0 0 0 0 1 1 0 1 2 1 2 3 8 2 3 21 25 25 0 0 +FFQ 144 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 1 0 0 1 0 0 0 0 0 3 0 0 2 0 1 2 1 2 4 1 4 3 16 33 22 0 0 +FFQ 145 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 2 2 5 3 4 4 4 16 21 32 0 0 +FFQ 146 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 1 3 0 0 0 0 0 0 0 0 0 1 3 0 0 3 1 6 1 4 2 2 16 31 21 0 0 +FFQ 147 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 2 0 4 2 6 5 5 16 29 27 0 0 +FFQ 148 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 4 5 1 1 3 22 30 28 0 0 +FFQ 149 0 0 0 0 0 0 0 0 0 0 0 0 2 0 3 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 3 2 3 4 3 24 36 18 0 0 +FFQ 150 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 0 0 0 0 0 0 0 2 0 0 2 0 0 0 0 0 1 4 3 4 25 30 24 0 0 +FFQ 151 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 0 5 4 4 22 27 29 0 0 +FFQ 152 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 2 1 0 0 0 0 0 0 0 1 0 2 2 0 0 2 0 2 5 2 6 5 22 25 20 0 0 +FFQ 153 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 0 0 0 0 0 0 0 0 1 0 0 3 1 1 1 1 4 2 4 3 3 32 24 14 0 0 +FFQ 154 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 1 0 0 0 0 0 0 0 0 0 0 2 2 0 1 0 0 5 4 3 8 6 23 21 20 0 0 +FFQ 155 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 2 1 1 1 3 7 5 28 26 17 0 0 +FFQ 156 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 3 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 5 3 5 3 31 20 24 0 0 +FFQ 157 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 2 1 5 3 2 2 31 20 28 0 0 +FFQ 158 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 2 1 0 0 0 0 0 0 0 2 0 0 2 1 0 1 0 1 3 4 5 4 34 7 30 0 0 +FFQ 159 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 2 0 1 0 0 0 0 0 0 0 2 0 0 0 1 0 0 4 1 4 8 3 42 15 14 0 0 +FFQ 160 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 2 0 1 0 2 5 1 3 2 7 4 1 37 17 14 0 0 +FFQ 161 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 1 0 0 0 0 0 0 0 1 0 2 2 1 0 2 1 1 3 11 3 2 34 14 18 0 0 +FFQ 162 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 0 0 0 0 0 0 1 3 1 0 0 0 3 3 4 9 4 6 36 12 14 0 0 +FFQ 163 0 0 0 0 0 0 0 0 0 0 0 0 2 1 4 0 0 0 0 0 0 0 0 0 0 1 2 1 0 0 1 1 3 1 6 5 3 38 17 14 0 0 +FFQ 164 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 1 0 1 2 0 0 1 1 3 1 9 5 4 39 16 13 0 0 +FFQ 165 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 1 1 2 5 0 6 8 2 39 15 15 0 0 +FFQ 166 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 3 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 3 3 3 0 6 43 13 22 0 0 +FFQ 167 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 3 1 0 0 0 0 0 0 0 0 3 2 0 0 0 2 0 0 4 5 3 10 36 13 16 0 0 +FFQ 168 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 1 0 0 0 0 0 0 0 0 0 2 1 1 0 1 2 1 3 3 10 2 4 37 11 16 0 0 +FFQ 169 0 0 0 0 0 0 0 0 0 0 0 0 6 6 3 1 1 0 0 0 0 0 0 0 0 4 3 0 1 0 2 3 3 4 3 0 2 35 9 14 0 0 +FFQ 170 0 0 0 0 0 0 0 0 0 0 0 0 2 6 1 0 0 0 0 0 0 0 0 0 0 5 5 0 0 2 1 2 2 6 5 3 3 39 8 10 0 0 +FFQ 171 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 0 0 0 0 0 0 0 0 0 0 3 2 0 0 0 3 3 2 5 8 5 7 36 10 11 0 0 +FFQ 172 0 0 0 0 0 0 0 0 0 0 0 0 6 5 0 1 0 0 0 0 0 0 0 0 0 0 3 1 0 0 3 0 3 4 5 6 4 32 15 12 0 0 +FFQ 173 0 0 0 0 0 0 0 0 0 0 0 0 4 1 1 0 0 0 0 0 0 0 0 0 1 0 4 0 0 0 0 0 6 4 4 5 4 37 18 11 0 0 +FFQ 174 0 0 0 0 0 0 0 0 0 0 0 0 4 2 1 1 0 0 0 0 0 0 0 0 1 1 2 1 0 0 0 3 3 4 7 3 5 36 12 14 0 0 +FFQ 175 0 0 0 0 0 0 0 0 0 0 0 0 4 2 0 2 0 0 0 0 0 0 0 0 0 2 2 1 0 0 3 3 6 3 10 3 4 30 13 12 0 0 +FFQ 176 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 5 0 0 0 0 0 0 0 0 0 1 4 1 1 3 2 1 2 3 4 3 2 42 7 14 0 0 +FFQ 177 0 0 0 0 0 0 0 0 0 0 0 0 3 3 2 4 0 0 0 0 0 0 0 0 1 2 2 0 0 1 2 1 1 5 5 7 3 33 11 14 0 0 +FFQ 178 0 0 0 0 0 0 0 0 0 0 0 0 1 3 1 3 0 0 0 0 0 0 0 0 1 3 1 0 0 0 0 0 3 6 9 2 8 39 10 10 0 0 +FFQ 179 0 0 0 0 0 0 0 0 0 0 0 0 2 4 2 3 0 0 0 0 0 0 0 0 1 1 2 0 0 0 1 1 1 7 8 2 6 36 10 13 0 0 +FFQ 180 0 0 0 0 0 0 0 0 0 0 0 0 1 4 3 3 0 0 0 0 0 0 0 0 3 1 1 0 0 0 3 0 4 3 4 2 8 41 13 6 0 0 +FFQ 181 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 2 0 0 0 0 0 0 0 0 1 1 2 0 0 0 2 1 6 10 5 5 4 39 10 8 0 0 +FFQ 182 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 1 0 0 0 0 0 0 0 0 5 1 2 0 0 0 2 1 2 5 4 2 3 46 19 3 0 0 +FFQ 183 0 0 0 0 0 0 0 0 0 0 0 0 4 1 0 3 0 0 0 0 0 0 0 0 1 0 0 1 0 2 1 0 1 8 6 4 7 43 14 4 0 0 +FFQ 184 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2 1 1 0 1 0 0 3 3 4 6 3 5 55 8 2 0 0 +FFQ 185 0 0 0 0 0 0 0 0 0 0 0 0 3 2 1 3 0 0 0 0 0 0 0 0 0 1 2 0 1 1 1 1 2 7 2 4 8 47 9 5 0 0 +FFQ 186 0 0 0 0 0 0 0 0 0 0 0 0 1 1 4 6 0 0 0 0 0 0 0 0 2 0 5 0 0 0 1 1 3 11 5 5 4 37 11 3 0 0 +FFQ 187 0 0 0 0 0 0 0 0 0 0 0 0 4 1 3 3 0 0 0 0 0 0 0 0 5 1 1 0 2 0 1 1 6 10 3 2 3 41 10 3 0 0 +FFQ 188 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 3 0 0 0 0 0 0 0 0 2 4 7 0 1 0 3 2 7 7 6 3 4 34 9 2 0 0 +FFQ 189 0 0 0 0 0 0 0 0 0 0 0 0 3 4 3 4 0 0 0 0 0 0 0 0 4 0 5 2 0 0 5 0 6 8 3 8 8 30 6 1 0 0 +FFQ 190 0 0 0 0 0 0 0 0 0 0 0 0 5 5 3 6 0 0 0 0 0 0 0 0 2 1 3 0 1 0 2 2 7 11 1 8 3 34 6 0 0 0 +FFQ 191 0 0 0 0 0 0 0 0 0 0 0 0 5 7 2 4 0 0 0 0 0 0 0 0 3 0 3 0 0 0 1 0 4 5 9 6 12 33 6 0 0 0 +FFQ 192 0 0 0 0 0 0 0 0 0 0 0 0 3 3 2 6 0 0 0 0 0 0 0 0 3 3 6 0 1 0 0 1 5 9 4 4 5 38 7 0 0 0 +FFQ 193 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 7 0 0 0 0 0 0 0 0 4 3 3 0 0 0 0 0 5 10 4 2 11 43 4 0 0 0 +FFQ 194 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 6 0 0 0 0 0 0 0 0 5 1 8 0 1 0 1 0 4 8 2 7 3 43 8 0 0 0 +FFQ 195 0 0 0 0 0 0 0 0 0 0 0 0 4 1 2 8 0 0 0 0 0 0 0 0 0 0 4 0 1 0 3 0 2 13 1 4 8 39 10 0 0 0 +FFQ 196 0 0 0 0 0 0 0 0 0 0 0 0 1 6 1 3 0 0 0 0 0 0 0 0 1 1 3 0 2 0 1 1 4 11 2 1 9 43 10 0 0 0 +FFQ 197 0 0 0 0 0 0 0 0 0 0 0 0 2 0 2 10 0 0 0 0 0 0 0 0 3 0 1 0 0 0 2 1 6 10 2 0 4 47 10 0 0 0 +FFQ 198 0 0 0 0 0 0 0 0 0 0 0 0 2 4 4 7 0 0 0 0 0 0 0 0 1 0 5 1 2 1 0 0 1 7 4 2 4 47 8 0 0 0 +FFQ 199 0 0 0 0 0 0 0 0 0 0 0 0 1 4 5 6 0 0 0 0 0 0 0 0 3 2 7 0 0 0 1 0 3 7 3 3 7 39 9 0 0 0 +FFQ 200 0 0 0 0 0 0 0 0 0 0 0 0 0 5 2 8 0 0 0 0 0 0 0 0 5 1 1 0 1 0 2 0 5 12 5 5 3 40 5 0 0 0 +FFQ 201 0 0 0 0 0 0 0 0 0 0 0 0 2 1 6 7 0 0 0 0 0 0 0 0 5 0 4 0 0 0 1 1 7 8 1 0 4 47 6 0 0 0 +FFQ 202 0 0 0 0 0 0 0 0 0 0 0 0 6 7 3 8 0 0 0 0 0 0 0 0 3 3 1 0 0 0 1 0 4 12 2 3 2 34 11 0 0 0 +FFQ 203 0 0 0 0 0 0 0 0 0 0 0 0 8 5 2 5 0 0 0 0 0 0 0 0 2 0 4 0 1 0 1 1 4 9 7 2 2 37 10 0 0 0 +FFQ 204 0 0 0 0 0 0 0 0 0 0 0 0 2 5 1 6 0 0 0 0 0 0 0 0 4 3 5 0 0 0 0 0 5 11 3 3 5 41 6 0 0 0 +FFQ 205 0 0 0 0 0 0 0 0 0 0 0 0 5 11 1 5 0 0 0 0 0 0 0 0 3 0 3 0 0 0 2 0 4 18 2 4 4 33 5 0 0 0 +FFQ 206 0 0 0 0 0 0 0 0 0 0 0 0 3 7 2 5 0 0 0 0 0 0 0 0 4 5 7 0 0 0 0 0 2 13 0 3 4 37 8 0 0 0 +FFQ 207 0 0 0 0 0 0 0 0 0 0 0 0 1 6 5 6 0 0 0 0 0 0 0 0 4 2 4 0 2 0 4 1 3 10 4 2 3 36 7 0 0 0 +FFQ 208 0 0 0 0 0 0 0 0 0 0 0 0 1 4 3 4 0 0 0 0 0 0 0 0 6 4 4 0 0 0 1 0 9 11 2 5 3 36 7 0 0 0 +FFQ 209 0 0 0 0 0 0 0 0 0 0 0 0 2 7 4 8 0 0 0 0 0 0 0 0 3 2 4 0 0 0 3 0 8 14 2 1 2 33 7 0 0 0 +FFQ 210 0 0 0 0 0 0 0 0 0 0 0 0 1 5 6 7 0 0 0 0 0 0 0 0 4 3 3 0 0 0 3 0 6 6 0 3 5 43 5 0 0 0 +FFQ 211 0 0 0 0 0 0 0 0 0 0 0 0 2 5 6 4 0 0 0 0 0 0 0 0 6 3 5 0 0 0 0 2 5 11 4 3 3 35 6 0 0 0 +FFQ 212 0 0 0 0 0 0 0 0 0 0 0 0 0 3 6 7 0 0 0 0 0 0 0 0 3 4 8 0 0 0 0 0 5 17 1 1 4 35 6 0 0 0 +FFQ 213 0 0 0 0 0 0 0 0 0 0 0 0 6 6 10 5 0 0 0 0 0 0 0 0 5 3 1 0 0 0 0 1 4 7 1 5 2 43 1 0 0 0 +FFQ 214 0 0 0 0 0 0 0 0 0 0 0 0 4 9 4 10 0 0 0 0 0 0 0 0 4 1 6 0 2 0 1 1 3 9 0 2 3 39 2 0 0 0 +FFQ 215 0 0 0 0 0 0 0 0 0 0 0 0 5 6 5 6 0 0 0 0 0 0 0 0 5 5 8 0 0 0 1 2 5 12 0 0 4 34 2 0 0 0 +FFQ 216 0 0 0 0 0 0 0 0 0 0 0 0 3 3 6 5 0 0 0 0 0 0 0 0 3 6 5 1 3 0 1 0 5 15 1 3 2 37 1 0 0 0 +FFQ 217 0 0 0 0 0 0 0 0 0 0 0 0 3 7 6 4 0 0 0 0 0 0 0 0 4 1 2 0 0 1 1 0 10 15 1 3 2 39 1 0 0 0 +FFQ 218 0 0 0 0 0 0 0 0 0 0 0 0 2 4 7 2 0 0 0 0 0 0 0 0 6 4 10 0 0 0 1 0 3 13 1 5 3 35 4 0 0 0 +FFQ 219 0 0 0 0 0 0 0 0 0 0 0 0 2 5 4 4 0 0 0 0 0 0 0 0 5 1 5 0 0 1 0 0 4 13 1 6 3 45 1 0 0 0 +FFQ 220 0 0 0 0 0 0 0 0 0 0 0 0 2 4 9 4 0 0 0 0 0 0 0 0 4 2 2 0 0 0 0 2 5 14 1 1 2 47 1 0 0 0 +FFQ 221 0 0 0 0 0 0 0 0 0 0 0 0 3 4 6 4 0 0 0 0 0 0 0 0 1 4 6 0 0 0 0 0 2 10 1 3 3 53 0 0 0 0 +FFQ 222 0 0 0 0 0 0 0 0 0 0 0 0 3 5 8 6 0 0 0 0 0 0 0 0 5 2 6 0 0 0 0 0 2 6 1 3 4 49 0 0 0 0 +FFQ 223 0 0 0 0 0 0 0 0 0 0 0 0 5 8 6 8 0 0 0 0 0 0 0 0 3 3 5 1 1 0 1 0 0 13 1 0 2 43 0 0 0 0 +FFQ 224 0 0 0 0 0 0 0 0 0 0 0 0 2 9 11 6 0 0 0 0 0 0 0 0 4 3 3 0 0 0 0 1 2 15 1 0 1 42 0 0 0 0 +FFQ 225 0 0 0 0 0 0 0 0 0 0 0 0 4 8 2 4 0 0 0 0 0 0 0 0 7 3 10 0 2 0 0 0 3 10 1 2 5 39 0 0 0 0 +FFQ 226 0 0 0 0 0 0 0 0 0 0 0 0 5 9 3 7 0 0 0 0 0 0 0 0 8 5 5 0 1 0 2 1 3 13 0 2 3 33 0 0 0 0 +FFQ 227 0 0 0 0 0 0 0 0 0 0 0 0 10 8 4 5 0 0 0 0 0 0 0 0 3 2 3 0 0 0 2 3 5 17 0 3 2 33 0 0 0 0 +FFQ 228 0 0 0 0 0 0 0 0 0 0 0 0 10 8 6 2 0 0 0 0 0 0 0 0 6 1 6 0 1 2 1 1 4 13 1 2 1 35 0 0 0 0 +FFQ 229 0 0 0 0 0 0 0 0 0 0 0 0 4 11 6 6 0 0 0 0 0 0 0 0 1 3 5 0 0 0 0 2 6 13 0 3 5 35 0 0 0 0 +FFQ 230 0 0 0 0 0 0 0 0 0 0 0 0 4 11 10 7 0 0 0 0 0 0 0 0 2 3 4 0 0 0 1 2 9 10 0 1 1 35 0 0 0 0 +FFQ 231 0 0 0 0 0 0 0 0 0 0 0 0 6 7 6 6 0 0 0 0 0 0 0 0 4 5 4 0 1 0 1 0 4 13 1 5 5 32 0 0 0 0 +FFQ 232 0 0 0 0 0 0 0 0 0 0 0 0 3 7 10 4 0 0 0 0 0 0 0 0 6 4 7 0 0 0 0 0 3 12 0 1 3 40 0 0 0 0 +FFQ 233 0 0 0 0 0 0 0 0 0 0 0 0 7 7 9 8 0 0 0 0 0 0 0 0 5 5 3 1 1 0 0 0 6 10 1 1 4 32 0 0 0 0 +FFQ 234 0 0 0 0 0 0 0 0 0 0 0 0 9 6 10 5 0 0 0 0 0 0 0 0 5 5 3 1 0 0 0 1 5 11 0 1 4 34 0 0 0 0 +FFQ 235 0 0 0 0 0 0 0 0 0 0 0 0 4 10 13 7 0 0 0 0 0 0 0 0 5 1 4 0 0 0 2 1 5 7 0 0 4 37 0 0 0 0 +FFQ 236 0 0 0 0 0 0 0 0 0 0 0 0 7 8 15 6 0 0 0 0 0 0 0 0 7 3 5 1 0 0 0 1 6 8 0 1 1 31 0 0 0 0 +FFQ 237 0 0 0 0 0 0 0 0 0 0 0 0 2 9 13 6 0 0 0 0 0 0 0 0 6 4 7 1 0 0 0 1 3 12 0 1 1 34 0 0 0 0 +FFQ 238 0 0 0 0 0 0 0 0 0 0 0 0 2 10 16 6 0 0 0 0 0 0 0 0 9 2 3 0 0 0 0 0 5 9 0 2 3 33 0 0 0 0 +FFQ 239 0 0 0 0 0 0 0 0 0 0 0 0 4 5 17 9 0 0 0 0 0 0 0 0 7 3 1 0 0 0 1 1 2 15 0 1 3 31 0 0 0 0 +FFQ 240 0 0 0 0 0 0 0 0 0 0 0 0 0 10 19 6 0 0 0 0 0 0 0 0 6 4 4 0 0 1 3 0 2 13 0 1 1 30 0 0 0 0 +FFQ 241 0 0 0 0 0 0 0 0 0 0 0 0 1 4 23 9 0 0 0 0 0 0 0 0 7 5 8 1 0 0 2 1 1 8 0 1 3 26 0 0 0 0 +FFQ 242 0 0 0 0 0 0 0 0 0 0 0 0 3 10 19 10 0 0 0 0 0 0 0 0 2 5 4 1 0 0 0 1 2 10 0 0 2 31 0 0 0 0 +FFQ 243 0 0 0 0 0 0 0 0 0 0 0 0 2 2 17 14 0 0 0 0 0 0 0 0 6 5 5 0 0 0 0 0 6 13 0 2 3 25 0 0 0 0 +FFQ 244 0 0 0 0 0 0 0 0 0 0 0 0 1 3 18 11 0 0 0 0 0 0 0 0 6 5 5 1 0 0 1 0 2 12 0 5 1 29 0 0 0 0 +FFQ 245 0 0 0 0 0 0 0 0 0 0 0 0 1 8 14 11 0 0 0 0 0 0 0 0 8 5 3 1 0 0 1 0 1 15 1 1 3 27 0 0 0 0 +FFQ 246 0 0 0 0 0 0 0 0 0 0 0 0 4 6 15 12 0 0 0 0 0 0 0 0 5 2 8 1 0 1 1 0 1 13 0 2 1 28 0 0 0 0 +FFQ 247 0 0 0 0 0 0 0 0 0 0 0 0 8 3 16 14 0 0 0 0 0 0 0 0 10 4 6 0 0 0 0 0 2 15 1 2 2 17 0 0 0 0 +FFQ 248 0 0 0 0 0 0 0 0 0 0 0 0 5 6 21 8 0 0 0 0 0 0 0 0 7 8 6 2 0 0 0 1 1 14 0 2 2 17 0 0 0 0 +FFQ 249 0 0 0 0 0 0 0 0 0 0 0 0 5 6 20 8 0 0 0 0 0 0 0 0 5 7 10 0 1 0 0 0 1 15 0 2 0 20 0 0 0 0 +FFQ 250 0 0 0 0 0 0 0 0 0 0 0 0 2 10 15 10 0 0 0 0 0 0 0 0 9 5 8 1 0 0 0 2 6 10 0 0 2 20 0 0 0 0 +FFQ 251 0 0 0 0 0 0 0 0 0 0 0 0 7 20 21 17 0 0 0 0 0 0 0 0 7 7 6 0 0 0 0 1 2 4 0 0 0 8 0 0 0 0 +FFQ 252 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +# Last Fragment Qualitites. Use `grep ^LFQ | cut -f 2-` to extract this part. +# Columns correspond to qualities and rows to cycles. First column is the cycle number. +LFQ 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 3 2 0 20 38 32 1 0 0 0 0 0 0 +LFQ 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 3 0 0 18 36 36 6 0 0 0 0 0 0 +LFQ 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 14 31 46 5 0 0 0 0 0 0 +LFQ 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 8 36 42 11 0 0 0 0 0 0 +LFQ 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 12 35 43 6 0 0 0 0 0 0 +LFQ 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 7 8 0 0 81 0 0 0 0 +LFQ 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 13 1 0 76 0 0 0 0 +LFQ 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 11 15 4 0 69 0 0 0 0 +LFQ 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 6 20 3 0 68 0 0 0 0 +LFQ 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 11 5 0 75 0 0 0 0 +LFQ 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 6 16 6 0 70 0 0 0 0 +LFQ 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 8 2 0 86 0 0 0 0 +LFQ 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 3 92 0 0 0 +LFQ 14 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 2 1 0 3 89 0 0 0 +LFQ 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 4 91 0 0 0 +LFQ 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 96 0 0 0 +LFQ 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 3 94 0 0 0 +LFQ 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 2 93 0 0 0 +LFQ 19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 93 0 0 0 +LFQ 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 4 91 0 0 0 +LFQ 21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 3 94 0 0 0 +LFQ 22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 97 0 0 0 +LFQ 23 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 18 74 0 0 +LFQ 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 19 76 0 0 +LFQ 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 4 15 76 0 0 +LFQ 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 2 18 75 0 0 +LFQ 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 12 84 0 0 +LFQ 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 5 16 74 0 0 +LFQ 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 6 19 73 0 0 +LFQ 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 12 17 67 0 0 +LFQ 31 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 0 1 2 15 77 0 0 +LFQ 32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 7 22 68 0 0 +LFQ 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 0 1 3 18 73 0 0 +LFQ 34 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 7 19 72 0 0 +LFQ 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 2 23 71 0 0 +LFQ 36 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 26 69 0 0 +LFQ 37 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 3 0 6 23 65 0 0 +LFQ 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 31 63 0 0 +LFQ 39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 5 33 56 0 0 +LFQ 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 3 1 1 7 25 60 0 0 +LFQ 41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 1 7 19 67 0 0 +LFQ 42 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 7 21 68 0 0 +LFQ 43 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 4 5 28 56 0 0 +LFQ 44 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 2 13 29 49 0 0 +LFQ 45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 7 31 57 0 0 +LFQ 46 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 4 2 8 34 49 0 0 +LFQ 47 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 1 1 0 8 22 63 0 0 +LFQ 48 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 7 24 64 0 0 +LFQ 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 9 28 58 0 0 +LFQ 50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 1 6 12 76 0 0 +LFQ 51 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 4 2 28 63 0 0 +LFQ 52 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 6 27 62 0 0 +LFQ 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 2 8 27 58 0 0 +LFQ 54 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 21 73 0 0 +LFQ 55 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 8 18 68 0 0 +LFQ 56 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 6 9 18 63 0 0 +LFQ 57 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 1 9 18 69 0 0 +LFQ 58 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 4 6 17 69 2 0 +LFQ 59 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 4 2 22 65 1 0 +LFQ 60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 3 6 19 64 1 0 +LFQ 61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 6 28 61 0 0 +LFQ 62 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 3 4 6 23 59 2 0 +LFQ 63 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 4 9 31 51 2 0 +LFQ 64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 4 8 29 53 0 0 +LFQ 65 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 1 7 5 26 57 0 0 +LFQ 66 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 1 2 2 3 20 64 2 0 +LFQ 67 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 2 0 3 10 25 56 0 0 +LFQ 68 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 1 1 2 5 6 19 61 0 0 +LFQ 69 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 8 19 63 0 0 +LFQ 70 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 7 4 25 58 0 0 +LFQ 71 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 9 28 55 0 0 +LFQ 72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 1 0 0 0 1 0 2 2 0 0 6 7 24 54 0 0 +LFQ 73 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 5 8 25 57 0 0 +LFQ 74 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 2 0 2 0 1 1 4 10 24 52 0 0 +LFQ 75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 1 9 11 21 52 0 0 +LFQ 76 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 4 1 0 3 1 0 7 6 22 52 0 0 +LFQ 77 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 2 2 0 1 10 12 23 47 0 0 +LFQ 78 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 5 8 37 44 0 0 +LFQ 79 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 3 10 27 56 0 0 +LFQ 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 0 1 1 0 3 12 30 48 0 0 +LFQ 81 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 7 7 33 46 0 0 +LFQ 82 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 3 0 7 7 22 56 0 0 +LFQ 83 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 5 2 3 8 25 52 0 0 +LFQ 84 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 1 0 3 1 0 4 11 32 45 0 0 +LFQ 85 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 2 2 0 1 4 0 1 12 22 54 0 0 +LFQ 86 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 4 5 12 28 46 0 0 +LFQ 87 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 1 5 9 29 47 0 0 +LFQ 88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 2 2 0 1 2 15 38 38 0 0 +LFQ 89 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 0 1 0 3 11 34 46 0 0 +LFQ 90 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 1 4 11 31 47 0 0 +LFQ 91 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 2 0 1 0 2 6 32 53 0 0 +LFQ 92 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 3 10 23 60 0 0 +LFQ 93 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 4 10 32 50 0 0 +LFQ 94 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 3 0 0 0 5 7 29 54 0 0 +LFQ 95 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 3 8 26 56 0 0 +LFQ 96 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 4 8 21 61 0 0 +LFQ 97 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 5 0 2 6 5 23 56 0 0 +LFQ 98 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 5 10 21 57 0 0 +LFQ 99 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 3 1 4 6 33 48 0 0 +LFQ 100 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 1 2 0 2 2 0 3 5 23 56 0 0 +LFQ 101 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 9 36 44 0 0 +LFQ 102 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 7 5 34 47 0 0 +LFQ 103 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 2 1 1 3 8 35 48 0 0 +LFQ 104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 5 7 36 49 0 0 +LFQ 105 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 5 9 32 48 0 0 +LFQ 106 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 3 5 4 9 23 52 0 0 +LFQ 107 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 5 9 33 43 0 0 +LFQ 108 0 0 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 3 3 13 23 51 0 0 +LFQ 109 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 2 1 6 12 39 35 0 0 +LFQ 110 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 1 1 0 0 0 0 0 1 0 0 0 0 1 1 0 2 0 3 2 8 36 40 0 0 +LFQ 111 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 1 1 3 3 1 2 3 8 30 44 0 0 +LFQ 112 0 0 1 0 0 0 0 0 0 0 0 0 2 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 3 0 4 14 28 42 0 0 +LFQ 113 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 1 0 3 0 2 1 5 10 31 43 0 0 +LFQ 114 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 2 3 4 10 29 44 0 0 +LFQ 115 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 3 4 3 7 9 37 32 0 0 +LFQ 116 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 2 0 0 0 0 0 1 0 0 0 0 0 2 0 1 1 3 5 1 12 35 34 0 0 +LFQ 117 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 1 0 0 0 0 1 3 1 1 1 1 1 2 9 34 42 0 0 +LFQ 118 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 3 1 2 2 1 9 33 43 0 0 +LFQ 119 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 1 2 3 13 38 36 0 0 +LFQ 120 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 1 3 3 4 13 26 44 0 0 +LFQ 121 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 2 0 0 1 0 0 0 0 0 1 1 3 3 7 26 53 0 0 +LFQ 122 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 3 1 3 7 28 52 0 0 +LFQ 123 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 2 0 0 1 5 4 4 12 18 50 0 0 +LFQ 124 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 6 2 2 13 35 37 0 0 +LFQ 125 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 3 0 1 0 4 2 3 14 34 34 0 0 +LFQ 126 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 2 1 4 3 2 11 39 33 0 0 +LFQ 127 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 1 2 2 2 9 35 43 0 0 +LFQ 128 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 2 0 0 1 0 0 2 0 0 1 8 1 1 8 36 37 0 0 +LFQ 129 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 1 5 2 4 12 30 40 0 0 +LFQ 130 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 2 1 2 1 3 13 23 47 0 0 +LFQ 131 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 1 0 1 4 3 3 12 27 45 0 0 +LFQ 132 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 4 5 14 25 44 0 0 +LFQ 133 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 2 1 6 5 3 7 34 36 0 0 +LFQ 134 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 3 1 4 8 2 10 32 34 0 0 +LFQ 135 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 1 3 5 3 13 35 31 0 0 +LFQ 136 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 2 2 4 2 3 6 2 15 35 25 0 0 +LFQ 137 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 2 0 1 7 2 3 15 29 35 0 0 +LFQ 138 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 2 2 3 5 9 33 35 0 0 +LFQ 139 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 0 0 0 0 0 0 0 0 2 0 0 0 1 0 1 0 2 1 6 4 1 20 25 32 0 0 +LFQ 140 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 1 2 1 0 0 1 0 1 0 3 3 3 20 32 30 0 0 +LFQ 141 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 1 1 0 1 2 1 2 0 3 2 1 19 36 27 0 0 +LFQ 142 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 4 2 5 3 4 23 34 17 0 0 +LFQ 143 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 1 1 0 0 0 0 0 0 0 0 1 1 0 1 2 1 2 3 8 2 3 21 25 25 0 0 +LFQ 144 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 1 0 0 1 0 0 0 0 0 3 0 0 2 0 1 2 1 2 4 1 4 3 16 33 22 0 0 +LFQ 145 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 2 2 5 3 4 4 4 16 21 32 0 0 +LFQ 146 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 1 3 0 0 0 0 0 0 0 0 0 1 3 0 0 3 1 6 1 4 2 2 16 31 21 0 0 +LFQ 147 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 2 0 4 2 6 5 5 16 29 27 0 0 +LFQ 148 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 4 5 1 1 3 22 30 28 0 0 +LFQ 149 0 0 0 0 0 0 0 0 0 0 0 0 2 0 3 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 3 2 3 4 3 24 36 18 0 0 +LFQ 150 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 0 0 0 0 0 0 0 2 0 0 2 0 0 0 0 0 1 4 3 4 25 30 24 0 0 +LFQ 151 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 0 5 4 4 22 27 29 0 0 +LFQ 152 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 2 1 0 0 0 0 0 0 0 1 0 2 2 0 0 2 0 2 5 2 6 5 22 25 20 0 0 +LFQ 153 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 0 0 0 0 0 0 0 0 1 0 0 3 1 1 1 1 4 2 4 3 3 32 24 14 0 0 +LFQ 154 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 1 0 0 0 0 0 0 0 0 0 0 2 2 0 1 0 0 5 4 3 8 6 23 21 20 0 0 +LFQ 155 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 2 1 1 1 3 7 5 28 26 17 0 0 +LFQ 156 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 3 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 5 3 5 3 31 20 24 0 0 +LFQ 157 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 2 1 5 3 2 2 31 20 28 0 0 +LFQ 158 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 2 1 0 0 0 0 0 0 0 2 0 0 2 1 0 1 0 1 3 4 5 4 34 7 30 0 0 +LFQ 159 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 2 0 1 0 0 0 0 0 0 0 2 0 0 0 1 0 0 4 1 4 8 3 42 15 14 0 0 +LFQ 160 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 2 0 1 0 2 5 1 3 2 7 4 1 37 17 14 0 0 +LFQ 161 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 1 0 0 0 0 0 0 0 1 0 2 2 1 0 2 1 1 3 11 3 2 34 14 18 0 0 +LFQ 162 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 0 0 0 0 0 0 1 3 1 0 0 0 3 3 4 9 4 6 36 12 14 0 0 +LFQ 163 0 0 0 0 0 0 0 0 0 0 0 0 2 1 4 0 0 0 0 0 0 0 0 0 0 1 2 1 0 0 1 1 3 1 6 5 3 38 17 14 0 0 +LFQ 164 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 1 0 1 2 0 0 1 1 3 1 9 5 4 39 16 13 0 0 +LFQ 165 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 1 1 2 5 0 6 8 2 39 15 15 0 0 +LFQ 166 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 3 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 3 3 3 0 6 43 13 22 0 0 +LFQ 167 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 3 1 0 0 0 0 0 0 0 0 3 2 0 0 0 2 0 0 4 5 3 10 36 13 16 0 0 +LFQ 168 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 1 0 0 0 0 0 0 0 0 0 2 1 1 0 1 2 1 3 3 10 2 4 37 11 16 0 0 +LFQ 169 0 0 0 0 0 0 0 0 0 0 0 0 6 6 3 1 1 0 0 0 0 0 0 0 0 4 3 0 1 0 2 3 3 4 3 0 2 35 9 14 0 0 +LFQ 170 0 0 0 0 0 0 0 0 0 0 0 0 2 6 1 0 0 0 0 0 0 0 0 0 0 5 5 0 0 2 1 2 2 6 5 3 3 39 8 10 0 0 +LFQ 171 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 0 0 0 0 0 0 0 0 0 0 3 2 0 0 0 3 3 2 5 8 5 7 36 10 11 0 0 +LFQ 172 0 0 0 0 0 0 0 0 0 0 0 0 6 5 0 1 0 0 0 0 0 0 0 0 0 0 3 1 0 0 3 0 3 4 5 6 4 32 15 12 0 0 +LFQ 173 0 0 0 0 0 0 0 0 0 0 0 0 4 1 1 0 0 0 0 0 0 0 0 0 1 0 4 0 0 0 0 0 6 4 4 5 4 37 18 11 0 0 +LFQ 174 0 0 0 0 0 0 0 0 0 0 0 0 4 2 1 1 0 0 0 0 0 0 0 0 1 1 2 1 0 0 0 3 3 4 7 3 5 36 12 14 0 0 +LFQ 175 0 0 0 0 0 0 0 0 0 0 0 0 4 2 0 2 0 0 0 0 0 0 0 0 0 2 2 1 0 0 3 3 6 3 10 3 4 30 13 12 0 0 +LFQ 176 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 5 0 0 0 0 0 0 0 0 0 1 4 1 1 3 2 1 2 3 4 3 2 42 7 14 0 0 +LFQ 177 0 0 0 0 0 0 0 0 0 0 0 0 3 3 2 4 0 0 0 0 0 0 0 0 1 2 2 0 0 1 2 1 1 5 5 7 3 33 11 14 0 0 +LFQ 178 0 0 0 0 0 0 0 0 0 0 0 0 1 3 1 3 0 0 0 0 0 0 0 0 1 3 1 0 0 0 0 0 3 6 9 2 8 39 10 10 0 0 +LFQ 179 0 0 0 0 0 0 0 0 0 0 0 0 2 4 2 3 0 0 0 0 0 0 0 0 1 1 2 0 0 0 1 1 1 7 8 2 6 36 10 13 0 0 +LFQ 180 0 0 0 0 0 0 0 0 0 0 0 0 1 4 3 3 0 0 0 0 0 0 0 0 3 1 1 0 0 0 3 0 4 3 4 2 8 41 13 6 0 0 +LFQ 181 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 2 0 0 0 0 0 0 0 0 1 1 2 0 0 0 2 1 6 10 5 5 4 39 10 8 0 0 +LFQ 182 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 1 0 0 0 0 0 0 0 0 5 1 2 0 0 0 2 1 2 5 4 2 3 46 19 3 0 0 +LFQ 183 0 0 0 0 0 0 0 0 0 0 0 0 4 1 0 3 0 0 0 0 0 0 0 0 1 0 0 1 0 2 1 0 1 8 6 4 7 43 14 4 0 0 +LFQ 184 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2 1 1 0 1 0 0 3 3 4 6 3 5 55 8 2 0 0 +LFQ 185 0 0 0 0 0 0 0 0 0 0 0 0 3 2 1 3 0 0 0 0 0 0 0 0 0 1 2 0 1 1 1 1 2 7 2 4 8 47 9 5 0 0 +LFQ 186 0 0 0 0 0 0 0 0 0 0 0 0 1 1 4 6 0 0 0 0 0 0 0 0 2 0 5 0 0 0 1 1 3 11 5 5 4 37 11 3 0 0 +LFQ 187 0 0 0 0 0 0 0 0 0 0 0 0 4 1 3 3 0 0 0 0 0 0 0 0 5 1 1 0 2 0 1 1 6 10 3 2 3 41 10 3 0 0 +LFQ 188 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 3 0 0 0 0 0 0 0 0 2 4 7 0 1 0 3 2 7 7 6 3 4 34 9 2 0 0 +LFQ 189 0 0 0 0 0 0 0 0 0 0 0 0 3 4 3 4 0 0 0 0 0 0 0 0 4 0 5 2 0 0 5 0 6 8 3 8 8 30 6 1 0 0 +LFQ 190 0 0 0 0 0 0 0 0 0 0 0 0 5 5 3 6 0 0 0 0 0 0 0 0 2 1 3 0 1 0 2 2 7 11 1 8 3 34 6 0 0 0 +LFQ 191 0 0 0 0 0 0 0 0 0 0 0 0 5 7 2 4 0 0 0 0 0 0 0 0 3 0 3 0 0 0 1 0 4 5 9 6 12 33 6 0 0 0 +LFQ 192 0 0 0 0 0 0 0 0 0 0 0 0 3 3 2 6 0 0 0 0 0 0 0 0 3 3 6 0 1 0 0 1 5 9 4 4 5 38 7 0 0 0 +LFQ 193 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 7 0 0 0 0 0 0 0 0 4 3 3 0 0 0 0 0 5 10 4 2 11 43 4 0 0 0 +LFQ 194 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 6 0 0 0 0 0 0 0 0 5 1 8 0 1 0 1 0 4 8 2 7 3 43 8 0 0 0 +LFQ 195 0 0 0 0 0 0 0 0 0 0 0 0 4 1 2 8 0 0 0 0 0 0 0 0 0 0 4 0 1 0 3 0 2 13 1 4 8 39 10 0 0 0 +LFQ 196 0 0 0 0 0 0 0 0 0 0 0 0 1 6 1 3 0 0 0 0 0 0 0 0 1 1 3 0 2 0 1 1 4 11 2 1 9 43 10 0 0 0 +LFQ 197 0 0 0 0 0 0 0 0 0 0 0 0 2 0 2 10 0 0 0 0 0 0 0 0 3 0 1 0 0 0 2 1 6 10 2 0 4 47 10 0 0 0 +LFQ 198 0 0 0 0 0 0 0 0 0 0 0 0 2 4 4 7 0 0 0 0 0 0 0 0 1 0 5 1 2 1 0 0 1 7 4 2 4 47 8 0 0 0 +LFQ 199 0 0 0 0 0 0 0 0 0 0 0 0 1 4 5 6 0 0 0 0 0 0 0 0 3 2 7 0 0 0 1 0 3 7 3 3 7 39 9 0 0 0 +LFQ 200 0 0 0 0 0 0 0 0 0 0 0 0 0 5 2 8 0 0 0 0 0 0 0 0 5 1 1 0 1 0 2 0 5 12 5 5 3 40 5 0 0 0 +LFQ 201 0 0 0 0 0 0 0 0 0 0 0 0 2 1 6 7 0 0 0 0 0 0 0 0 5 0 4 0 0 0 1 1 7 8 1 0 4 47 6 0 0 0 +LFQ 202 0 0 0 0 0 0 0 0 0 0 0 0 6 7 3 8 0 0 0 0 0 0 0 0 3 3 1 0 0 0 1 0 4 12 2 3 2 34 11 0 0 0 +LFQ 203 0 0 0 0 0 0 0 0 0 0 0 0 8 5 2 5 0 0 0 0 0 0 0 0 2 0 4 0 1 0 1 1 4 9 7 2 2 37 10 0 0 0 +LFQ 204 0 0 0 0 0 0 0 0 0 0 0 0 2 5 1 6 0 0 0 0 0 0 0 0 4 3 5 0 0 0 0 0 5 11 3 3 5 41 6 0 0 0 +LFQ 205 0 0 0 0 0 0 0 0 0 0 0 0 5 11 1 5 0 0 0 0 0 0 0 0 3 0 3 0 0 0 2 0 4 18 2 4 4 33 5 0 0 0 +LFQ 206 0 0 0 0 0 0 0 0 0 0 0 0 3 7 2 5 0 0 0 0 0 0 0 0 4 5 7 0 0 0 0 0 2 13 0 3 4 37 8 0 0 0 +LFQ 207 0 0 0 0 0 0 0 0 0 0 0 0 1 6 5 6 0 0 0 0 0 0 0 0 4 2 4 0 2 0 4 1 3 10 4 2 3 36 7 0 0 0 +LFQ 208 0 0 0 0 0 0 0 0 0 0 0 0 1 4 3 4 0 0 0 0 0 0 0 0 6 4 4 0 0 0 1 0 9 11 2 5 3 36 7 0 0 0 +LFQ 209 0 0 0 0 0 0 0 0 0 0 0 0 2 7 4 8 0 0 0 0 0 0 0 0 3 2 4 0 0 0 3 0 8 14 2 1 2 33 7 0 0 0 +LFQ 210 0 0 0 0 0 0 0 0 0 0 0 0 1 5 6 7 0 0 0 0 0 0 0 0 4 3 3 0 0 0 3 0 6 6 0 3 5 43 5 0 0 0 +LFQ 211 0 0 0 0 0 0 0 0 0 0 0 0 2 5 6 4 0 0 0 0 0 0 0 0 6 3 5 0 0 0 0 2 5 11 4 3 3 35 6 0 0 0 +LFQ 212 0 0 0 0 0 0 0 0 0 0 0 0 0 3 6 7 0 0 0 0 0 0 0 0 3 4 8 0 0 0 0 0 5 17 1 1 4 35 6 0 0 0 +LFQ 213 0 0 0 0 0 0 0 0 0 0 0 0 6 6 10 5 0 0 0 0 0 0 0 0 5 3 1 0 0 0 0 1 4 7 1 5 2 43 1 0 0 0 +LFQ 214 0 0 0 0 0 0 0 0 0 0 0 0 4 9 4 10 0 0 0 0 0 0 0 0 4 1 6 0 2 0 1 1 3 9 0 2 3 39 2 0 0 0 +LFQ 215 0 0 0 0 0 0 0 0 0 0 0 0 5 6 5 6 0 0 0 0 0 0 0 0 5 5 8 0 0 0 1 2 5 12 0 0 4 34 2 0 0 0 +LFQ 216 0 0 0 0 0 0 0 0 0 0 0 0 3 3 6 5 0 0 0 0 0 0 0 0 3 6 5 1 3 0 1 0 5 15 1 3 2 37 1 0 0 0 +LFQ 217 0 0 0 0 0 0 0 0 0 0 0 0 3 7 6 4 0 0 0 0 0 0 0 0 4 1 2 0 0 1 1 0 10 15 1 3 2 39 1 0 0 0 +LFQ 218 0 0 0 0 0 0 0 0 0 0 0 0 2 4 7 2 0 0 0 0 0 0 0 0 6 4 10 0 0 0 1 0 3 13 1 5 3 35 4 0 0 0 +LFQ 219 0 0 0 0 0 0 0 0 0 0 0 0 2 5 4 4 0 0 0 0 0 0 0 0 5 1 5 0 0 1 0 0 4 13 1 6 3 45 1 0 0 0 +LFQ 220 0 0 0 0 0 0 0 0 0 0 0 0 2 4 9 4 0 0 0 0 0 0 0 0 4 2 2 0 0 0 0 2 5 14 1 1 2 47 1 0 0 0 +LFQ 221 0 0 0 0 0 0 0 0 0 0 0 0 3 4 6 4 0 0 0 0 0 0 0 0 1 4 6 0 0 0 0 0 2 10 1 3 3 53 0 0 0 0 +LFQ 222 0 0 0 0 0 0 0 0 0 0 0 0 3 5 8 6 0 0 0 0 0 0 0 0 5 2 6 0 0 0 0 0 2 6 1 3 4 49 0 0 0 0 +LFQ 223 0 0 0 0 0 0 0 0 0 0 0 0 5 8 6 8 0 0 0 0 0 0 0 0 3 3 5 1 1 0 1 0 0 13 1 0 2 43 0 0 0 0 +LFQ 224 0 0 0 0 0 0 0 0 0 0 0 0 2 9 11 6 0 0 0 0 0 0 0 0 4 3 3 0 0 0 0 1 2 15 1 0 1 42 0 0 0 0 +LFQ 225 0 0 0 0 0 0 0 0 0 0 0 0 4 8 2 4 0 0 0 0 0 0 0 0 7 3 10 0 2 0 0 0 3 10 1 2 5 39 0 0 0 0 +LFQ 226 0 0 0 0 0 0 0 0 0 0 0 0 5 9 3 7 0 0 0 0 0 0 0 0 8 5 5 0 1 0 2 1 3 13 0 2 3 33 0 0 0 0 +LFQ 227 0 0 0 0 0 0 0 0 0 0 0 0 10 8 4 5 0 0 0 0 0 0 0 0 3 2 3 0 0 0 2 3 5 17 0 3 2 33 0 0 0 0 +LFQ 228 0 0 0 0 0 0 0 0 0 0 0 0 10 8 6 2 0 0 0 0 0 0 0 0 6 1 6 0 1 2 1 1 4 13 1 2 1 35 0 0 0 0 +LFQ 229 0 0 0 0 0 0 0 0 0 0 0 0 4 11 6 6 0 0 0 0 0 0 0 0 1 3 5 0 0 0 0 2 6 13 0 3 5 35 0 0 0 0 +LFQ 230 0 0 0 0 0 0 0 0 0 0 0 0 4 11 10 7 0 0 0 0 0 0 0 0 2 3 4 0 0 0 1 2 9 10 0 1 1 35 0 0 0 0 +LFQ 231 0 0 0 0 0 0 0 0 0 0 0 0 6 7 6 6 0 0 0 0 0 0 0 0 4 5 4 0 1 0 1 0 4 13 1 5 5 32 0 0 0 0 +LFQ 232 0 0 0 0 0 0 0 0 0 0 0 0 3 7 10 4 0 0 0 0 0 0 0 0 6 4 7 0 0 0 0 0 3 12 0 1 3 40 0 0 0 0 +LFQ 233 0 0 0 0 0 0 0 0 0 0 0 0 7 7 9 8 0 0 0 0 0 0 0 0 5 5 3 1 1 0 0 0 6 10 1 1 4 32 0 0 0 0 +LFQ 234 0 0 0 0 0 0 0 0 0 0 0 0 9 6 10 5 0 0 0 0 0 0 0 0 5 5 3 1 0 0 0 1 5 11 0 1 4 34 0 0 0 0 +LFQ 235 0 0 0 0 0 0 0 0 0 0 0 0 4 10 13 7 0 0 0 0 0 0 0 0 5 1 4 0 0 0 2 1 5 7 0 0 4 37 0 0 0 0 +LFQ 236 0 0 0 0 0 0 0 0 0 0 0 0 7 8 15 6 0 0 0 0 0 0 0 0 7 3 5 1 0 0 0 1 6 8 0 1 1 31 0 0 0 0 +LFQ 237 0 0 0 0 0 0 0 0 0 0 0 0 2 9 13 6 0 0 0 0 0 0 0 0 6 4 7 1 0 0 0 1 3 12 0 1 1 34 0 0 0 0 +LFQ 238 0 0 0 0 0 0 0 0 0 0 0 0 2 10 16 6 0 0 0 0 0 0 0 0 9 2 3 0 0 0 0 0 5 9 0 2 3 33 0 0 0 0 +LFQ 239 0 0 0 0 0 0 0 0 0 0 0 0 4 5 17 9 0 0 0 0 0 0 0 0 7 3 1 0 0 0 1 1 2 15 0 1 3 31 0 0 0 0 +LFQ 240 0 0 0 0 0 0 0 0 0 0 0 0 0 10 19 6 0 0 0 0 0 0 0 0 6 4 4 0 0 1 3 0 2 13 0 1 1 30 0 0 0 0 +LFQ 241 0 0 0 0 0 0 0 0 0 0 0 0 1 4 23 9 0 0 0 0 0 0 0 0 7 5 8 1 0 0 2 1 1 8 0 1 3 26 0 0 0 0 +LFQ 242 0 0 0 0 0 0 0 0 0 0 0 0 3 10 19 10 0 0 0 0 0 0 0 0 2 5 4 1 0 0 0 1 2 10 0 0 2 31 0 0 0 0 +LFQ 243 0 0 0 0 0 0 0 0 0 0 0 0 2 2 17 14 0 0 0 0 0 0 0 0 6 5 5 0 0 0 0 0 6 13 0 2 3 25 0 0 0 0 +LFQ 244 0 0 0 0 0 0 0 0 0 0 0 0 1 3 18 11 0 0 0 0 0 0 0 0 6 5 5 1 0 0 1 0 2 12 0 5 1 29 0 0 0 0 +LFQ 245 0 0 0 0 0 0 0 0 0 0 0 0 1 8 14 11 0 0 0 0 0 0 0 0 8 5 3 1 0 0 1 0 1 15 1 1 3 27 0 0 0 0 +LFQ 246 0 0 0 0 0 0 0 0 0 0 0 0 4 6 15 12 0 0 0 0 0 0 0 0 5 2 8 1 0 1 1 0 1 13 0 2 1 28 0 0 0 0 +LFQ 247 0 0 0 0 0 0 0 0 0 0 0 0 8 3 16 14 0 0 0 0 0 0 0 0 10 4 6 0 0 0 0 0 2 15 1 2 2 17 0 0 0 0 +LFQ 248 0 0 0 0 0 0 0 0 0 0 0 0 5 6 21 8 0 0 0 0 0 0 0 0 7 8 6 2 0 0 0 1 1 14 0 2 2 17 0 0 0 0 +LFQ 249 0 0 0 0 0 0 0 0 0 0 0 0 5 6 20 8 0 0 0 0 0 0 0 0 5 7 10 0 1 0 0 0 1 15 0 2 0 20 0 0 0 0 +LFQ 250 0 0 0 0 0 0 0 0 0 0 0 0 2 10 15 10 0 0 0 0 0 0 0 0 9 5 8 1 0 0 0 2 6 10 0 0 2 20 0 0 0 0 +LFQ 251 0 0 0 0 0 0 0 0 0 0 0 0 7 20 21 17 0 0 0 0 0 0 0 0 7 7 6 0 0 0 0 1 2 4 0 0 0 8 0 0 0 0 +LFQ 252 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +# Mismatches per cycle and quality. Use `grep ^MPC | cut -f 2-` to extract this part. +# Columns correspond to qualities, rows to cycles. First column is the cycle number, second +# is the number of N's and the rest is the number of mismatches +MPC 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 +MPC 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 +MPC 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 +MPC 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 +MPC 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 23 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 31 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 34 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 36 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 37 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 42 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 43 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 44 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 46 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 47 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 48 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 51 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 52 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 54 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 55 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 56 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 57 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 58 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 59 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 62 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 63 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 65 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 66 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 67 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 68 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 69 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 70 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 71 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 73 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 74 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 76 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 +MPC 77 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 78 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 79 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 81 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 82 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 83 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 84 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 85 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 86 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 87 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 89 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 90 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 91 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 92 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 93 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 94 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 95 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 96 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 97 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 98 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 99 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 100 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 101 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 102 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 103 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 105 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 106 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 107 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 108 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 +MPC 109 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 110 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 111 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 112 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 113 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 114 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 115 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 116 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 117 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 118 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 119 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 120 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 121 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 122 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 123 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 124 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 125 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 126 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 127 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 128 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 129 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 130 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 131 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 132 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 133 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 134 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 135 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 136 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 137 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 138 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 139 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 140 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 141 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 +MPC 142 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 143 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 144 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 145 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 146 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 147 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 148 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 149 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 150 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 +MPC 151 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 152 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 153 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 154 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 155 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 156 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 0 +MPC 157 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 +MPC 158 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 159 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 160 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 161 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 +MPC 162 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 163 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 164 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 165 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 166 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 +MPC 167 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 168 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 +MPC 169 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 +MPC 170 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 171 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 172 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 173 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 174 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 175 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 176 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 177 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 178 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 179 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 +MPC 180 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 181 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 182 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 183 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 184 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 185 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 186 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 187 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 188 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 189 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 190 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 191 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 192 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 193 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 194 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 195 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 196 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 197 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 198 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 199 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 200 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 201 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 202 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 203 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 204 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 205 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 206 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 207 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 208 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 209 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 210 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 211 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 212 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 213 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 214 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 215 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 216 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 217 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 218 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 219 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 220 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 221 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 222 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 223 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 224 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 225 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 226 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 227 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 228 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 229 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 230 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 231 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 232 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 +MPC 233 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 234 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 235 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 236 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 237 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 238 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 239 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 240 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 241 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 242 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 243 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 244 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 245 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 246 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 247 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 +MPC 248 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 2 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 2 0 0 0 3 0 0 0 +MPC 249 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 2 0 5 0 0 0 0 0 0 2 0 0 0 0 0 0 0 +MPC 250 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 2 0 0 0 2 0 0 0 +MPC 251 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 2 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 3 0 0 0 +MPC 252 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +# GC Content of first fragments. Use `grep ^GCF | cut -f 2-` to extract this part. +GCF 21.86 0 +GCF 44.22 2 +GCF 44.97 8 +GCF 45.48 4 +GCF 45.98 3 +GCF 46.48 5 +GCF 46.98 2 +GCF 47.49 3 +GCF 47.99 12 +GCF 48.49 13 +GCF 48.99 9 +GCF 49.50 2 +GCF 50.25 3 +GCF 51.01 6 +GCF 51.51 4 +GCF 52.01 1 +GCF 52.51 0 +GCF 53.02 1 +# GC Content of last fragments. Use `grep ^GCL | cut -f 2-` to extract this part. +GCL 21.86 0 +GCL 44.22 2 +GCL 44.97 8 +GCL 45.48 4 +GCL 45.98 3 +GCL 46.48 5 +GCL 46.98 2 +GCL 47.49 3 +GCL 47.99 12 +GCL 48.49 13 +GCL 48.99 9 +GCL 49.50 2 +GCL 50.25 3 +GCL 51.01 6 +GCL 51.51 4 +GCL 52.01 1 +GCL 52.51 0 +GCL 53.02 1 +# ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle, and A,C,G,T counts [%] +GCC 1 21.50 29.50 33.50 15.50 +GCC 2 30.00 16.00 11.00 43.00 +GCC 3 33.00 25.00 9.00 33.00 +GCC 4 17.00 29.00 13.00 41.00 +GCC 5 37.00 22.00 12.00 29.00 +GCC 6 36.00 26.00 17.00 21.00 +GCC 7 29.50 13.50 31.50 25.50 +GCC 8 50.50 14.50 19.50 15.50 +GCC 9 17.00 33.00 18.00 32.00 +GCC 10 37.00 14.00 21.00 28.00 +GCC 11 20.50 14.50 29.50 35.50 +GCC 12 30.00 24.00 22.00 24.00 +GCC 13 27.00 15.00 21.00 37.00 +GCC 14 24.00 22.00 26.00 28.00 +GCC 15 25.50 20.50 24.50 29.50 +GCC 16 31.00 15.00 20.00 34.00 +GCC 17 28.00 25.00 14.00 33.00 +GCC 18 30.50 28.50 19.50 21.50 +GCC 19 29.00 26.00 21.00 24.00 +GCC 20 22.50 23.50 17.50 36.50 +GCC 21 35.50 17.50 19.50 27.50 +GCC 22 37.50 28.50 15.50 18.50 +GCC 23 31.00 19.00 13.00 37.00 +GCC 24 37.00 12.00 22.00 29.00 +GCC 25 35.50 22.50 17.50 24.50 +GCC 26 33.50 18.50 15.50 32.50 +GCC 27 34.50 14.50 25.50 25.50 +GCC 28 31.00 14.00 24.00 31.00 +GCC 29 30.00 27.00 24.00 19.00 +GCC 30 31.00 20.00 14.00 35.00 +GCC 31 33.50 29.50 13.50 23.50 +GCC 32 42.50 20.50 19.50 17.50 +GCC 33 25.50 23.50 14.50 36.50 +GCC 34 39.50 16.50 20.50 23.50 +GCC 35 32.50 23.50 21.50 22.50 +GCC 36 42.00 25.00 16.00 17.00 +GCC 37 38.00 17.00 19.00 26.00 +GCC 38 24.00 26.00 25.00 25.00 +GCC 39 22.50 41.50 18.50 17.50 +GCC 40 32.00 16.00 21.00 31.00 +GCC 41 33.00 28.00 19.00 20.00 +GCC 42 30.50 25.50 19.50 24.50 +GCC 43 35.00 29.00 15.00 21.00 +GCC 44 20.00 27.00 22.00 31.00 +GCC 45 40.50 21.50 21.50 16.50 +GCC 46 26.50 20.50 22.50 30.50 +GCC 47 38.50 29.50 16.50 15.50 +GCC 48 27.50 24.50 17.50 30.50 +GCC 49 28.50 32.50 10.50 28.50 +GCC 50 46.50 20.50 9.50 23.50 +GCC 51 34.50 28.50 13.50 23.50 +GCC 52 41.50 23.50 20.50 14.50 +GCC 53 20.00 28.00 26.00 26.00 +GCC 54 31.50 18.50 24.50 25.50 +GCC 55 30.50 22.50 16.50 30.50 +GCC 56 33.50 22.50 13.50 30.50 +GCC 57 23.00 24.00 23.00 30.00 +GCC 58 25.00 37.00 19.00 19.00 +GCC 59 34.00 23.00 24.00 19.00 +GCC 60 29.00 28.00 17.00 26.00 +GCC 61 25.50 23.50 24.50 26.50 +GCC 62 31.50 22.50 16.50 29.50 +GCC 63 27.50 28.50 25.50 18.50 +GCC 64 33.50 21.50 25.50 19.50 +GCC 65 35.50 19.50 18.50 26.50 +GCC 66 34.00 25.00 15.00 26.00 +GCC 67 37.00 23.00 19.00 21.00 +GCC 68 36.50 29.50 13.50 20.50 +GCC 69 38.50 19.50 20.50 21.50 +GCC 70 38.50 16.50 18.50 26.50 +GCC 71 25.50 38.50 21.50 14.50 +GCC 72 29.00 29.00 25.00 17.00 +GCC 73 32.50 20.50 21.50 25.50 +GCC 74 28.50 32.50 12.50 26.50 +GCC 75 41.50 12.50 18.50 27.50 +GCC 76 24.50 29.50 23.50 22.50 +GCC 77 36.00 21.00 18.00 25.00 +GCC 78 27.00 34.00 22.00 17.00 +GCC 79 21.50 26.50 25.50 26.50 +GCC 80 34.00 19.00 28.00 19.00 +GCC 81 17.00 26.00 26.00 31.00 +GCC 82 31.00 30.00 23.00 16.00 +GCC 83 31.50 26.50 12.50 29.50 +GCC 84 19.00 41.00 21.00 19.00 +GCC 85 37.50 24.50 16.50 21.50 +GCC 86 15.00 48.00 15.00 22.00 +GCC 87 41.00 16.00 18.00 25.00 +GCC 88 23.50 27.50 27.50 21.50 +GCC 89 26.50 27.50 26.50 19.50 +GCC 90 18.50 23.50 24.50 33.50 +GCC 91 27.00 32.00 22.00 19.00 +GCC 92 23.50 17.50 27.50 31.50 +GCC 93 25.50 37.50 15.50 21.50 +GCC 94 27.00 17.00 24.00 32.00 +GCC 95 26.50 37.50 14.50 21.50 +GCC 96 29.50 25.50 16.50 28.50 +GCC 97 29.00 31.00 21.00 19.00 +GCC 98 18.00 33.00 22.00 27.00 +GCC 99 24.50 33.50 24.50 17.50 +GCC 100 24.50 16.50 24.50 34.50 +GCC 101 25.00 40.00 19.00 16.00 +GCC 102 17.50 17.50 32.50 32.50 +GCC 103 31.00 26.00 16.00 27.00 +GCC 104 26.50 29.50 20.50 23.50 +GCC 105 34.00 33.00 21.00 12.00 +GCC 106 23.00 31.00 26.00 20.00 +GCC 107 17.50 35.50 23.50 23.50 +GCC 108 24.50 30.50 23.50 21.50 +GCC 109 17.00 31.00 22.00 30.00 +GCC 110 16.00 35.00 24.00 25.00 +GCC 111 24.00 32.00 23.00 21.00 +GCC 112 37.00 28.00 16.00 19.00 +GCC 113 19.50 22.50 32.50 25.50 +GCC 114 17.00 31.00 35.00 17.00 +GCC 115 29.50 24.50 23.50 22.50 +GCC 116 22.00 30.00 34.00 14.00 +GCC 117 27.00 23.00 19.00 31.00 +GCC 118 25.50 14.50 34.50 25.50 +GCC 119 22.50 34.50 20.50 22.50 +GCC 120 17.50 24.50 26.50 31.50 +GCC 121 27.50 33.50 22.50 16.50 +GCC 122 17.00 23.00 25.00 35.00 +GCC 123 23.50 46.50 11.50 18.50 +GCC 124 9.00 32.00 34.00 25.00 +GCC 125 24.00 27.00 19.00 30.00 +GCC 126 26.00 17.00 28.00 29.00 +GCC 127 26.50 16.50 21.50 35.50 +GCC 128 18.00 34.00 31.00 17.00 +GCC 129 25.50 25.50 27.50 21.50 +GCC 130 25.00 20.00 22.00 33.00 +GCC 131 17.50 39.50 24.50 18.50 +GCC 132 21.00 28.00 23.00 28.00 +GCC 133 13.50 31.50 35.50 19.50 +GCC 134 24.50 19.50 30.50 25.50 +GCC 135 16.50 23.50 30.50 29.50 +GCC 136 28.00 32.00 15.00 25.00 +GCC 137 22.50 21.50 30.50 25.50 +GCC 138 14.50 34.50 24.50 26.50 +GCC 139 20.50 29.50 24.50 25.50 +GCC 140 17.00 23.00 30.00 30.00 +GCC 141 20.50 23.50 25.50 30.50 +GCC 142 18.00 29.00 38.00 15.00 +GCC 143 22.00 24.00 27.00 27.00 +GCC 144 21.50 30.50 26.50 21.50 +GCC 145 22.00 21.00 29.00 28.00 +GCC 146 25.00 16.00 39.00 20.00 +GCC 147 26.50 22.50 30.50 20.50 +GCC 148 12.50 28.50 36.50 22.50 +GCC 149 26.50 23.50 23.50 26.50 +GCC 150 14.00 29.00 24.00 33.00 +GCC 151 19.50 30.50 32.50 17.50 +GCC 152 18.50 17.50 29.50 34.50 +GCC 153 22.50 22.50 31.50 23.50 +GCC 154 22.00 21.00 29.00 28.00 +GCC 155 21.00 26.00 19.00 34.00 +GCC 156 14.50 23.50 35.50 26.50 +GCC 157 22.00 31.00 23.00 24.00 +GCC 158 22.50 29.50 24.50 23.50 +GCC 159 17.50 12.50 46.50 23.50 +GCC 160 24.50 26.50 26.50 22.50 +GCC 161 13.00 23.00 45.00 19.00 +GCC 162 31.50 16.50 22.50 29.50 +GCC 163 19.50 21.50 35.50 23.50 +GCC 164 29.00 18.00 21.00 32.00 +GCC 165 14.50 17.50 35.50 32.50 +GCC 166 17.50 37.50 28.50 16.50 +GCC 167 16.50 21.50 31.50 30.50 +GCC 168 14.00 25.00 30.00 31.00 +GCC 169 18.50 20.50 23.50 37.50 +GCC 170 19.00 23.00 28.00 30.00 +GCC 171 20.00 28.00 33.00 19.00 +GCC 172 19.00 20.00 32.00 29.00 +GCC 173 24.50 16.50 33.50 25.50 +GCC 174 17.50 23.50 33.50 25.50 +GCC 175 33.50 17.50 35.50 13.50 +GCC 176 16.50 32.50 28.50 22.50 +GCC 177 19.00 22.00 27.00 32.00 +GCC 178 16.00 26.00 30.00 28.00 +GCC 179 18.00 18.00 22.00 42.00 +GCC 180 21.00 22.00 34.00 23.00 +GCC 181 20.50 19.50 35.50 24.50 +GCC 182 32.50 18.50 22.50 26.50 +GCC 183 24.50 13.50 28.50 33.50 +GCC 184 15.00 29.00 30.00 26.00 +GCC 185 15.00 32.00 33.00 20.00 +GCC 186 22.50 23.50 34.50 19.50 +GCC 187 19.00 14.00 40.00 27.00 +GCC 188 27.50 21.50 27.50 23.50 +GCC 189 17.00 22.00 34.00 27.00 +GCC 190 23.00 30.00 23.00 24.00 +GCC 191 25.00 22.00 28.00 25.00 +GCC 192 34.50 24.50 13.50 27.50 +GCC 193 18.50 25.50 25.50 30.50 +GCC 194 18.50 33.50 24.50 23.50 +GCC 195 16.00 26.00 23.00 35.00 +GCC 196 21.50 25.50 24.50 28.50 +GCC 197 20.00 21.00 23.00 36.00 +GCC 198 17.00 21.00 37.00 25.00 +GCC 199 20.50 18.50 25.50 35.50 +GCC 200 21.00 29.00 21.00 29.00 +GCC 201 27.00 21.00 23.00 29.00 +GCC 202 21.50 24.50 19.50 34.50 +GCC 203 21.50 24.50 26.50 27.50 +GCC 204 27.00 29.00 24.00 20.00 +GCC 205 19.50 21.50 22.50 36.50 +GCC 206 26.50 24.50 21.50 27.50 +GCC 207 22.50 21.50 19.50 36.50 +GCC 208 14.00 35.00 29.00 22.00 +GCC 209 16.00 23.00 12.00 49.00 +GCC 210 18.50 19.50 40.50 21.50 +GCC 211 26.00 20.00 22.00 32.00 +GCC 212 21.00 31.00 18.00 30.00 +GCC 213 24.00 15.00 31.00 30.00 +GCC 214 17.50 24.50 25.50 32.50 +GCC 215 26.00 24.00 23.00 27.00 +GCC 216 21.50 17.50 25.50 35.50 +GCC 217 26.00 29.00 17.00 28.00 +GCC 218 20.00 27.00 21.00 32.00 +GCC 219 17.00 21.00 21.00 41.00 +GCC 220 25.50 23.50 23.50 27.50 +GCC 221 21.50 23.50 20.50 34.50 +GCC 222 21.50 21.50 18.50 38.50 +GCC 223 20.00 27.00 28.00 25.00 +GCC 224 22.50 22.50 24.50 30.50 +GCC 225 14.50 35.50 30.50 19.50 +GCC 226 20.00 23.00 26.00 31.00 +GCC 227 20.50 24.50 23.50 31.50 +GCC 228 33.00 19.00 26.00 22.00 +GCC 229 22.50 24.50 18.50 34.50 +GCC 230 21.00 32.00 16.00 31.00 +GCC 231 23.00 28.00 30.00 19.00 +GCC 232 23.50 21.50 12.50 42.50 +GCC 233 21.00 27.00 25.00 27.00 +GCC 234 16.50 27.50 22.50 33.50 +GCC 235 20.00 15.00 28.00 37.00 +GCC 236 28.00 23.00 21.00 28.00 +GCC 237 20.50 19.50 22.50 37.50 +GCC 238 21.50 29.50 24.50 24.50 +GCC 239 20.00 8.00 17.00 55.00 +GCC 240 28.00 24.00 16.00 32.00 +GCC 241 22.50 22.50 16.50 38.50 +GCC 242 29.00 25.00 13.00 33.00 +GCC 243 22.50 15.50 23.50 38.50 +GCC 244 20.50 23.50 16.50 39.50 +GCC 245 28.00 23.00 19.00 30.00 +GCC 246 21.00 29.00 25.00 25.00 +GCC 247 32.00 14.00 13.00 41.00 +GCC 248 18.00 18.00 25.00 39.00 +GCC 249 25.00 23.00 21.00 31.00 +GCC 250 27.50 22.50 17.50 32.50 +GCC 251 13.50 20.50 36.50 29.50 +# Insert sizes. Use `grep ^IS | cut -f 2-` to extract this part. The columns are: insert size, pairs total, inward oriented pairs, outward oriented pairs, other pairs +# Read lengths. Use `grep ^RL | cut -f 2-` to extract this part. The columns are: read length, count +RL 251 200 +# Indel distribution. Use `grep ^ID | cut -f 2-` to extract this part. The columns are: length, number of insertions, number of deletions +ID 1 1 0 +ID 2 1 0 +ID 4 2 0 +ID 10 5 0 +ID 13 1 0 +ID 14 1 0 +ID 15 1 0 +ID 18 1 0 +ID 21 1 0 +ID 22 1 0 +ID 23 2 0 +ID 24 3 0 +ID 29 1 0 +ID 35 2 0 +ID 38 2 0 +# Indels per cycle. Use `grep ^IC | cut -f 2-` to extract this part. The columns are: cycle, number of insertions (fwd), .. (rev) , number of deletions (fwd), .. (rev) +IC 2 1 0 0 0 +IC 4 2 0 0 0 +IC 5 3 0 0 0 +IC 210 2 0 0 0 +IC 219 1 0 0 0 +IC 220 1 0 0 0 +IC 224 2 0 0 0 +IC 225 2 0 0 0 +IC 226 1 0 0 0 +IC 228 1 0 0 0 +IC 230 1 0 0 0 +IC 233 1 0 0 0 +IC 234 1 0 0 0 +IC 235 1 0 0 0 +IC 236 1 0 0 0 +IC 239 1 0 0 0 +IC 240 1 0 0 0 +IC 241 1 0 0 0 +IC 247 1 0 0 0 +# Coverage distribution. Use `grep ^COV | cut -f 2-` to extract this part. +COV [1-1] 1 1 +COV [7-7] 7 1 +COV [18-18] 18 1 +COV [24-24] 24 1 +COV [25-25] 25 249 +# GC-depth. Use `grep ^GCD | cut -f 2-` to extract this part. The columns are: GC%, unique sequence percentiles, 10th, 25th, 50th, 75th and 90th depth percentile +GCD 0.0 100.000 0.000 0.000 0.000 0.000 0.000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/samtools_stats_out2.tab Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,1137 @@ +# This file was produced by samtools stats (1.2+htslib-1.2.1) and can be plotted using plot-bamstats +# The command line was: stats --coverage 1,1000,1 --GC-depth 20000.0 --insert-size 8000 --most-inserts 0.99 --trim-quality 0 --ref-seq /Users/anton/galaxy-git/database/files/000/dataset_9.dat /Users/anton/galaxy-git/database/files/000/dataset_10.dat +# CHK, Checksum [2]Read Names [3]Sequences [4]Qualities +# CHK, CRC32 of reads which passed filtering followed by addition (32bit overflow) +CHK 1bd20fd8 58ad2167 29883386 +# Summary Numbers. Use `grep ^SN | cut -f 2-` to extract this part. +SN raw total sequences: 200 +SN filtered sequences: 0 +SN sequences: 200 +SN is sorted: 1 +SN 1st fragments: 100 +SN last fragments: 100 +SN reads mapped: 25 +SN reads mapped and paired: 0 # paired-end technology bit set + both mates mapped +SN reads unmapped: 175 +SN reads properly paired: 0 # proper-pair bit set +SN reads paired: 200 # paired-end technology bit set +SN reads duplicated: 0 # PCR or optical duplicate bit set +SN reads MQ0: 6 # mapped and MQ=0 +SN reads QC failed: 0 +SN non-primary alignments: 0 +SN total length: 50200 # ignores clipping +SN bases mapped: 6275 # ignores clipping +SN bases mapped (cigar): 6275 # more accurate +SN bases trimmed: 0 +SN bases duplicated: 0 +SN mismatches: 591 # from NM fields +SN error rate: 9.418327e-02 # mismatches / bases mapped (cigar) +SN average length: 251 +SN maximum length: 251 +SN average quality: 34.7 +SN insert size average: 0.0 +SN insert size standard deviation: 0.0 +SN inward oriented pairs: 0 +SN outward oriented pairs: 0 +SN pairs with other orientation: 0 +SN pairs on different chromosomes: 0 +# First Fragment Qualitites. Use `grep ^FFQ | cut -f 2-` to extract this part. +# Columns correspond to qualities and rows to cycles. First column is the cycle number. +FFQ 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 3 2 0 20 38 32 1 0 0 0 0 0 0 +FFQ 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 3 0 0 18 36 36 6 0 0 0 0 0 0 +FFQ 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 14 31 46 5 0 0 0 0 0 0 +FFQ 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 8 36 42 11 0 0 0 0 0 0 +FFQ 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 12 35 43 6 0 0 0 0 0 0 +FFQ 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 7 8 0 0 81 0 0 0 0 +FFQ 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 13 1 0 76 0 0 0 0 +FFQ 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 11 15 4 0 69 0 0 0 0 +FFQ 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 6 20 3 0 68 0 0 0 0 +FFQ 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 11 5 0 75 0 0 0 0 +FFQ 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 6 16 6 0 70 0 0 0 0 +FFQ 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 8 2 0 86 0 0 0 0 +FFQ 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 3 92 0 0 0 +FFQ 14 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 2 1 0 3 89 0 0 0 +FFQ 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 4 91 0 0 0 +FFQ 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 96 0 0 0 +FFQ 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 3 94 0 0 0 +FFQ 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 2 93 0 0 0 +FFQ 19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 93 0 0 0 +FFQ 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 4 91 0 0 0 +FFQ 21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 3 94 0 0 0 +FFQ 22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 97 0 0 0 +FFQ 23 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 18 74 0 0 +FFQ 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 19 76 0 0 +FFQ 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 4 15 76 0 0 +FFQ 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 2 18 75 0 0 +FFQ 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 12 84 0 0 +FFQ 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 5 16 74 0 0 +FFQ 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 6 19 73 0 0 +FFQ 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 12 17 67 0 0 +FFQ 31 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 0 1 2 15 77 0 0 +FFQ 32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 7 22 68 0 0 +FFQ 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 0 1 3 18 73 0 0 +FFQ 34 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 7 19 72 0 0 +FFQ 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 2 23 71 0 0 +FFQ 36 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 26 69 0 0 +FFQ 37 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 3 0 6 23 65 0 0 +FFQ 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 31 63 0 0 +FFQ 39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 5 33 56 0 0 +FFQ 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 3 1 1 7 25 60 0 0 +FFQ 41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 1 7 19 67 0 0 +FFQ 42 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 7 21 68 0 0 +FFQ 43 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 4 5 28 56 0 0 +FFQ 44 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 2 13 29 49 0 0 +FFQ 45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 7 31 57 0 0 +FFQ 46 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 4 2 8 34 49 0 0 +FFQ 47 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 1 1 0 8 22 63 0 0 +FFQ 48 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 7 24 64 0 0 +FFQ 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 9 28 58 0 0 +FFQ 50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 1 6 12 76 0 0 +FFQ 51 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 4 2 28 63 0 0 +FFQ 52 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 6 27 62 0 0 +FFQ 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 2 8 27 58 0 0 +FFQ 54 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 21 73 0 0 +FFQ 55 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 8 18 68 0 0 +FFQ 56 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 6 9 18 63 0 0 +FFQ 57 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 1 9 18 69 0 0 +FFQ 58 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 4 6 17 69 2 0 +FFQ 59 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 4 2 22 65 1 0 +FFQ 60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 3 6 19 64 1 0 +FFQ 61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 6 28 61 0 0 +FFQ 62 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 3 4 6 23 59 2 0 +FFQ 63 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 4 9 31 51 2 0 +FFQ 64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 4 8 29 53 0 0 +FFQ 65 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 1 7 5 26 57 0 0 +FFQ 66 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 1 2 2 3 20 64 2 0 +FFQ 67 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 2 0 3 10 25 56 0 0 +FFQ 68 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 1 1 2 5 6 19 61 0 0 +FFQ 69 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 8 19 63 0 0 +FFQ 70 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 7 4 25 58 0 0 +FFQ 71 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 9 28 55 0 0 +FFQ 72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 1 0 0 0 1 0 2 2 0 0 6 7 24 54 0 0 +FFQ 73 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 5 8 25 57 0 0 +FFQ 74 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 2 0 2 0 1 1 4 10 24 52 0 0 +FFQ 75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 1 9 11 21 52 0 0 +FFQ 76 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 4 1 0 3 1 0 7 6 22 52 0 0 +FFQ 77 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 2 2 0 1 10 12 23 47 0 0 +FFQ 78 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 5 8 37 44 0 0 +FFQ 79 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 3 10 27 56 0 0 +FFQ 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 0 1 1 0 3 12 30 48 0 0 +FFQ 81 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 7 7 33 46 0 0 +FFQ 82 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 3 0 7 7 22 56 0 0 +FFQ 83 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 5 2 3 8 25 52 0 0 +FFQ 84 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 1 0 3 1 0 4 11 32 45 0 0 +FFQ 85 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 2 2 0 1 4 0 1 12 22 54 0 0 +FFQ 86 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 4 5 12 28 46 0 0 +FFQ 87 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 1 5 9 29 47 0 0 +FFQ 88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 2 2 0 1 2 15 38 38 0 0 +FFQ 89 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 0 1 0 3 11 34 46 0 0 +FFQ 90 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 1 4 11 31 47 0 0 +FFQ 91 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 2 0 1 0 2 6 32 53 0 0 +FFQ 92 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 3 10 23 60 0 0 +FFQ 93 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 4 10 32 50 0 0 +FFQ 94 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 3 0 0 0 5 7 29 54 0 0 +FFQ 95 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 3 8 26 56 0 0 +FFQ 96 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 4 8 21 61 0 0 +FFQ 97 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 5 0 2 6 5 23 56 0 0 +FFQ 98 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 5 10 21 57 0 0 +FFQ 99 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 3 1 4 6 33 48 0 0 +FFQ 100 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 1 2 0 2 2 0 3 5 23 56 0 0 +FFQ 101 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 9 36 44 0 0 +FFQ 102 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 7 5 34 47 0 0 +FFQ 103 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 2 1 1 3 8 35 48 0 0 +FFQ 104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 5 7 36 49 0 0 +FFQ 105 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 5 9 32 48 0 0 +FFQ 106 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 3 5 4 9 23 52 0 0 +FFQ 107 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 5 9 33 43 0 0 +FFQ 108 0 0 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 3 3 13 23 51 0 0 +FFQ 109 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 2 1 6 12 39 35 0 0 +FFQ 110 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 1 1 0 0 0 0 0 1 0 0 0 0 1 1 0 2 0 3 2 8 36 40 0 0 +FFQ 111 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 1 1 3 3 1 2 3 8 30 44 0 0 +FFQ 112 0 0 1 0 0 0 0 0 0 0 0 0 2 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 3 0 4 14 28 42 0 0 +FFQ 113 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 1 0 3 0 2 1 5 10 31 43 0 0 +FFQ 114 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 2 3 4 10 29 44 0 0 +FFQ 115 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 3 4 3 7 9 37 32 0 0 +FFQ 116 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 2 0 0 0 0 0 1 0 0 0 0 0 2 0 1 1 3 5 1 12 35 34 0 0 +FFQ 117 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 1 0 0 0 0 1 3 1 1 1 1 1 2 9 34 42 0 0 +FFQ 118 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 3 1 2 2 1 9 33 43 0 0 +FFQ 119 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 1 2 3 13 38 36 0 0 +FFQ 120 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 1 3 3 4 13 26 44 0 0 +FFQ 121 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 2 0 0 1 0 0 0 0 0 1 1 3 3 7 26 53 0 0 +FFQ 122 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 3 1 3 7 28 52 0 0 +FFQ 123 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 2 0 0 1 5 4 4 12 18 50 0 0 +FFQ 124 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 6 2 2 13 35 37 0 0 +FFQ 125 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 3 0 1 0 4 2 3 14 34 34 0 0 +FFQ 126 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 2 1 4 3 2 11 39 33 0 0 +FFQ 127 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 1 2 2 2 9 35 43 0 0 +FFQ 128 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 2 0 0 1 0 0 2 0 0 1 8 1 1 8 36 37 0 0 +FFQ 129 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 1 5 2 4 12 30 40 0 0 +FFQ 130 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 2 1 2 1 3 13 23 47 0 0 +FFQ 131 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 1 0 1 4 3 3 12 27 45 0 0 +FFQ 132 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 4 5 14 25 44 0 0 +FFQ 133 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 2 1 6 5 3 7 34 36 0 0 +FFQ 134 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 3 1 4 8 2 10 32 34 0 0 +FFQ 135 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 1 3 5 3 13 35 31 0 0 +FFQ 136 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 2 2 4 2 3 6 2 15 35 25 0 0 +FFQ 137 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 2 0 1 7 2 3 15 29 35 0 0 +FFQ 138 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 2 2 3 5 9 33 35 0 0 +FFQ 139 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 0 0 0 0 0 0 0 0 2 0 0 0 1 0 1 0 2 1 6 4 1 20 25 32 0 0 +FFQ 140 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 1 2 1 0 0 1 0 1 0 3 3 3 20 32 30 0 0 +FFQ 141 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 1 1 0 1 2 1 2 0 3 2 1 19 36 27 0 0 +FFQ 142 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 4 2 5 3 4 23 34 17 0 0 +FFQ 143 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 1 1 0 0 0 0 0 0 0 0 1 1 0 1 2 1 2 3 8 2 3 21 25 25 0 0 +FFQ 144 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 1 0 0 1 0 0 0 0 0 3 0 0 2 0 1 2 1 2 4 1 4 3 16 33 22 0 0 +FFQ 145 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 2 2 5 3 4 4 4 16 21 32 0 0 +FFQ 146 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 1 3 0 0 0 0 0 0 0 0 0 1 3 0 0 3 1 6 1 4 2 2 16 31 21 0 0 +FFQ 147 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 2 0 4 2 6 5 5 16 29 27 0 0 +FFQ 148 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 4 5 1 1 3 22 30 28 0 0 +FFQ 149 0 0 0 0 0 0 0 0 0 0 0 0 2 0 3 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 3 2 3 4 3 24 36 18 0 0 +FFQ 150 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 0 0 0 0 0 0 0 2 0 0 2 0 0 0 0 0 1 4 3 4 25 30 24 0 0 +FFQ 151 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 0 5 4 4 22 27 29 0 0 +FFQ 152 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 2 1 0 0 0 0 0 0 0 1 0 2 2 0 0 2 0 2 5 2 6 5 22 25 20 0 0 +FFQ 153 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 0 0 0 0 0 0 0 0 1 0 0 3 1 1 1 1 4 2 4 3 3 32 24 14 0 0 +FFQ 154 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 1 0 0 0 0 0 0 0 0 0 0 2 2 0 1 0 0 5 4 3 8 6 23 21 20 0 0 +FFQ 155 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 2 1 1 1 3 7 5 28 26 17 0 0 +FFQ 156 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 3 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 5 3 5 3 31 20 24 0 0 +FFQ 157 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 2 1 5 3 2 2 31 20 28 0 0 +FFQ 158 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 2 1 0 0 0 0 0 0 0 2 0 0 2 1 0 1 0 1 3 4 5 4 34 7 30 0 0 +FFQ 159 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 2 0 1 0 0 0 0 0 0 0 2 0 0 0 1 0 0 4 1 4 8 3 42 15 14 0 0 +FFQ 160 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 2 0 1 0 2 5 1 3 2 7 4 1 37 17 14 0 0 +FFQ 161 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 1 0 0 0 0 0 0 0 1 0 2 2 1 0 2 1 1 3 11 3 2 34 14 18 0 0 +FFQ 162 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 0 0 0 0 0 0 1 3 1 0 0 0 3 3 4 9 4 6 36 12 14 0 0 +FFQ 163 0 0 0 0 0 0 0 0 0 0 0 0 2 1 4 0 0 0 0 0 0 0 0 0 0 1 2 1 0 0 1 1 3 1 6 5 3 38 17 14 0 0 +FFQ 164 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 1 0 1 2 0 0 1 1 3 1 9 5 4 39 16 13 0 0 +FFQ 165 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 1 1 2 5 0 6 8 2 39 15 15 0 0 +FFQ 166 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 3 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 3 3 3 0 6 43 13 22 0 0 +FFQ 167 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 3 1 0 0 0 0 0 0 0 0 3 2 0 0 0 2 0 0 4 5 3 10 36 13 16 0 0 +FFQ 168 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 1 0 0 0 0 0 0 0 0 0 2 1 1 0 1 2 1 3 3 10 2 4 37 11 16 0 0 +FFQ 169 0 0 0 0 0 0 0 0 0 0 0 0 6 6 3 1 1 0 0 0 0 0 0 0 0 4 3 0 1 0 2 3 3 4 3 0 2 35 9 14 0 0 +FFQ 170 0 0 0 0 0 0 0 0 0 0 0 0 2 6 1 0 0 0 0 0 0 0 0 0 0 5 5 0 0 2 1 2 2 6 5 3 3 39 8 10 0 0 +FFQ 171 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 0 0 0 0 0 0 0 0 0 0 3 2 0 0 0 3 3 2 5 8 5 7 36 10 11 0 0 +FFQ 172 0 0 0 0 0 0 0 0 0 0 0 0 6 5 0 1 0 0 0 0 0 0 0 0 0 0 3 1 0 0 3 0 3 4 5 6 4 32 15 12 0 0 +FFQ 173 0 0 0 0 0 0 0 0 0 0 0 0 4 1 1 0 0 0 0 0 0 0 0 0 1 0 4 0 0 0 0 0 6 4 4 5 4 37 18 11 0 0 +FFQ 174 0 0 0 0 0 0 0 0 0 0 0 0 4 2 1 1 0 0 0 0 0 0 0 0 1 1 2 1 0 0 0 3 3 4 7 3 5 36 12 14 0 0 +FFQ 175 0 0 0 0 0 0 0 0 0 0 0 0 4 2 0 2 0 0 0 0 0 0 0 0 0 2 2 1 0 0 3 3 6 3 10 3 4 30 13 12 0 0 +FFQ 176 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 5 0 0 0 0 0 0 0 0 0 1 4 1 1 3 2 1 2 3 4 3 2 42 7 14 0 0 +FFQ 177 0 0 0 0 0 0 0 0 0 0 0 0 3 3 2 4 0 0 0 0 0 0 0 0 1 2 2 0 0 1 2 1 1 5 5 7 3 33 11 14 0 0 +FFQ 178 0 0 0 0 0 0 0 0 0 0 0 0 1 3 1 3 0 0 0 0 0 0 0 0 1 3 1 0 0 0 0 0 3 6 9 2 8 39 10 10 0 0 +FFQ 179 0 0 0 0 0 0 0 0 0 0 0 0 2 4 2 3 0 0 0 0 0 0 0 0 1 1 2 0 0 0 1 1 1 7 8 2 6 36 10 13 0 0 +FFQ 180 0 0 0 0 0 0 0 0 0 0 0 0 1 4 3 3 0 0 0 0 0 0 0 0 3 1 1 0 0 0 3 0 4 3 4 2 8 41 13 6 0 0 +FFQ 181 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 2 0 0 0 0 0 0 0 0 1 1 2 0 0 0 2 1 6 10 5 5 4 39 10 8 0 0 +FFQ 182 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 1 0 0 0 0 0 0 0 0 5 1 2 0 0 0 2 1 2 5 4 2 3 46 19 3 0 0 +FFQ 183 0 0 0 0 0 0 0 0 0 0 0 0 4 1 0 3 0 0 0 0 0 0 0 0 1 0 0 1 0 2 1 0 1 8 6 4 7 43 14 4 0 0 +FFQ 184 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2 1 1 0 1 0 0 3 3 4 6 3 5 55 8 2 0 0 +FFQ 185 0 0 0 0 0 0 0 0 0 0 0 0 3 2 1 3 0 0 0 0 0 0 0 0 0 1 2 0 1 1 1 1 2 7 2 4 8 47 9 5 0 0 +FFQ 186 0 0 0 0 0 0 0 0 0 0 0 0 1 1 4 6 0 0 0 0 0 0 0 0 2 0 5 0 0 0 1 1 3 11 5 5 4 37 11 3 0 0 +FFQ 187 0 0 0 0 0 0 0 0 0 0 0 0 4 1 3 3 0 0 0 0 0 0 0 0 5 1 1 0 2 0 1 1 6 10 3 2 3 41 10 3 0 0 +FFQ 188 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 3 0 0 0 0 0 0 0 0 2 4 7 0 1 0 3 2 7 7 6 3 4 34 9 2 0 0 +FFQ 189 0 0 0 0 0 0 0 0 0 0 0 0 3 4 3 4 0 0 0 0 0 0 0 0 4 0 5 2 0 0 5 0 6 8 3 8 8 30 6 1 0 0 +FFQ 190 0 0 0 0 0 0 0 0 0 0 0 0 5 5 3 6 0 0 0 0 0 0 0 0 2 1 3 0 1 0 2 2 7 11 1 8 3 34 6 0 0 0 +FFQ 191 0 0 0 0 0 0 0 0 0 0 0 0 5 7 2 4 0 0 0 0 0 0 0 0 3 0 3 0 0 0 1 0 4 5 9 6 12 33 6 0 0 0 +FFQ 192 0 0 0 0 0 0 0 0 0 0 0 0 3 3 2 6 0 0 0 0 0 0 0 0 3 3 6 0 1 0 0 1 5 9 4 4 5 38 7 0 0 0 +FFQ 193 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 7 0 0 0 0 0 0 0 0 4 3 3 0 0 0 0 0 5 10 4 2 11 43 4 0 0 0 +FFQ 194 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 6 0 0 0 0 0 0 0 0 5 1 8 0 1 0 1 0 4 8 2 7 3 43 8 0 0 0 +FFQ 195 0 0 0 0 0 0 0 0 0 0 0 0 4 1 2 8 0 0 0 0 0 0 0 0 0 0 4 0 1 0 3 0 2 13 1 4 8 39 10 0 0 0 +FFQ 196 0 0 0 0 0 0 0 0 0 0 0 0 1 6 1 3 0 0 0 0 0 0 0 0 1 1 3 0 2 0 1 1 4 11 2 1 9 43 10 0 0 0 +FFQ 197 0 0 0 0 0 0 0 0 0 0 0 0 2 0 2 10 0 0 0 0 0 0 0 0 3 0 1 0 0 0 2 1 6 10 2 0 4 47 10 0 0 0 +FFQ 198 0 0 0 0 0 0 0 0 0 0 0 0 2 4 4 7 0 0 0 0 0 0 0 0 1 0 5 1 2 1 0 0 1 7 4 2 4 47 8 0 0 0 +FFQ 199 0 0 0 0 0 0 0 0 0 0 0 0 1 4 5 6 0 0 0 0 0 0 0 0 3 2 7 0 0 0 1 0 3 7 3 3 7 39 9 0 0 0 +FFQ 200 0 0 0 0 0 0 0 0 0 0 0 0 0 5 2 8 0 0 0 0 0 0 0 0 5 1 1 0 1 0 2 0 5 12 5 5 3 40 5 0 0 0 +FFQ 201 0 0 0 0 0 0 0 0 0 0 0 0 2 1 6 7 0 0 0 0 0 0 0 0 5 0 4 0 0 0 1 1 7 8 1 0 4 47 6 0 0 0 +FFQ 202 0 0 0 0 0 0 0 0 0 0 0 0 6 7 3 8 0 0 0 0 0 0 0 0 3 3 1 0 0 0 1 0 4 12 2 3 2 34 11 0 0 0 +FFQ 203 0 0 0 0 0 0 0 0 0 0 0 0 8 5 2 5 0 0 0 0 0 0 0 0 2 0 4 0 1 0 1 1 4 9 7 2 2 37 10 0 0 0 +FFQ 204 0 0 0 0 0 0 0 0 0 0 0 0 2 5 1 6 0 0 0 0 0 0 0 0 4 3 5 0 0 0 0 0 5 11 3 3 5 41 6 0 0 0 +FFQ 205 0 0 0 0 0 0 0 0 0 0 0 0 5 11 1 5 0 0 0 0 0 0 0 0 3 0 3 0 0 0 2 0 4 18 2 4 4 33 5 0 0 0 +FFQ 206 0 0 0 0 0 0 0 0 0 0 0 0 3 7 2 5 0 0 0 0 0 0 0 0 4 5 7 0 0 0 0 0 2 13 0 3 4 37 8 0 0 0 +FFQ 207 0 0 0 0 0 0 0 0 0 0 0 0 1 6 5 6 0 0 0 0 0 0 0 0 4 2 4 0 2 0 4 1 3 10 4 2 3 36 7 0 0 0 +FFQ 208 0 0 0 0 0 0 0 0 0 0 0 0 1 4 3 4 0 0 0 0 0 0 0 0 6 4 4 0 0 0 1 0 9 11 2 5 3 36 7 0 0 0 +FFQ 209 0 0 0 0 0 0 0 0 0 0 0 0 2 7 4 8 0 0 0 0 0 0 0 0 3 2 4 0 0 0 3 0 8 14 2 1 2 33 7 0 0 0 +FFQ 210 0 0 0 0 0 0 0 0 0 0 0 0 1 5 6 7 0 0 0 0 0 0 0 0 4 3 3 0 0 0 3 0 6 6 0 3 5 43 5 0 0 0 +FFQ 211 0 0 0 0 0 0 0 0 0 0 0 0 2 5 6 4 0 0 0 0 0 0 0 0 6 3 5 0 0 0 0 2 5 11 4 3 3 35 6 0 0 0 +FFQ 212 0 0 0 0 0 0 0 0 0 0 0 0 0 3 6 7 0 0 0 0 0 0 0 0 3 4 8 0 0 0 0 0 5 17 1 1 4 35 6 0 0 0 +FFQ 213 0 0 0 0 0 0 0 0 0 0 0 0 6 6 10 5 0 0 0 0 0 0 0 0 5 3 1 0 0 0 0 1 4 7 1 5 2 43 1 0 0 0 +FFQ 214 0 0 0 0 0 0 0 0 0 0 0 0 4 9 4 10 0 0 0 0 0 0 0 0 4 1 6 0 2 0 1 1 3 9 0 2 3 39 2 0 0 0 +FFQ 215 0 0 0 0 0 0 0 0 0 0 0 0 5 6 5 6 0 0 0 0 0 0 0 0 5 5 8 0 0 0 1 2 5 12 0 0 4 34 2 0 0 0 +FFQ 216 0 0 0 0 0 0 0 0 0 0 0 0 3 3 6 5 0 0 0 0 0 0 0 0 3 6 5 1 3 0 1 0 5 15 1 3 2 37 1 0 0 0 +FFQ 217 0 0 0 0 0 0 0 0 0 0 0 0 3 7 6 4 0 0 0 0 0 0 0 0 4 1 2 0 0 1 1 0 10 15 1 3 2 39 1 0 0 0 +FFQ 218 0 0 0 0 0 0 0 0 0 0 0 0 2 4 7 2 0 0 0 0 0 0 0 0 6 4 10 0 0 0 1 0 3 13 1 5 3 35 4 0 0 0 +FFQ 219 0 0 0 0 0 0 0 0 0 0 0 0 2 5 4 4 0 0 0 0 0 0 0 0 5 1 5 0 0 1 0 0 4 13 1 6 3 45 1 0 0 0 +FFQ 220 0 0 0 0 0 0 0 0 0 0 0 0 2 4 9 4 0 0 0 0 0 0 0 0 4 2 2 0 0 0 0 2 5 14 1 1 2 47 1 0 0 0 +FFQ 221 0 0 0 0 0 0 0 0 0 0 0 0 3 4 6 4 0 0 0 0 0 0 0 0 1 4 6 0 0 0 0 0 2 10 1 3 3 53 0 0 0 0 +FFQ 222 0 0 0 0 0 0 0 0 0 0 0 0 3 5 8 6 0 0 0 0 0 0 0 0 5 2 6 0 0 0 0 0 2 6 1 3 4 49 0 0 0 0 +FFQ 223 0 0 0 0 0 0 0 0 0 0 0 0 5 8 6 8 0 0 0 0 0 0 0 0 3 3 5 1 1 0 1 0 0 13 1 0 2 43 0 0 0 0 +FFQ 224 0 0 0 0 0 0 0 0 0 0 0 0 2 9 11 6 0 0 0 0 0 0 0 0 4 3 3 0 0 0 0 1 2 15 1 0 1 42 0 0 0 0 +FFQ 225 0 0 0 0 0 0 0 0 0 0 0 0 4 8 2 4 0 0 0 0 0 0 0 0 7 3 10 0 2 0 0 0 3 10 1 2 5 39 0 0 0 0 +FFQ 226 0 0 0 0 0 0 0 0 0 0 0 0 5 9 3 7 0 0 0 0 0 0 0 0 8 5 5 0 1 0 2 1 3 13 0 2 3 33 0 0 0 0 +FFQ 227 0 0 0 0 0 0 0 0 0 0 0 0 10 8 4 5 0 0 0 0 0 0 0 0 3 2 3 0 0 0 2 3 5 17 0 3 2 33 0 0 0 0 +FFQ 228 0 0 0 0 0 0 0 0 0 0 0 0 10 8 6 2 0 0 0 0 0 0 0 0 6 1 6 0 1 2 1 1 4 13 1 2 1 35 0 0 0 0 +FFQ 229 0 0 0 0 0 0 0 0 0 0 0 0 4 11 6 6 0 0 0 0 0 0 0 0 1 3 5 0 0 0 0 2 6 13 0 3 5 35 0 0 0 0 +FFQ 230 0 0 0 0 0 0 0 0 0 0 0 0 4 11 10 7 0 0 0 0 0 0 0 0 2 3 4 0 0 0 1 2 9 10 0 1 1 35 0 0 0 0 +FFQ 231 0 0 0 0 0 0 0 0 0 0 0 0 6 7 6 6 0 0 0 0 0 0 0 0 4 5 4 0 1 0 1 0 4 13 1 5 5 32 0 0 0 0 +FFQ 232 0 0 0 0 0 0 0 0 0 0 0 0 3 7 10 4 0 0 0 0 0 0 0 0 6 4 7 0 0 0 0 0 3 12 0 1 3 40 0 0 0 0 +FFQ 233 0 0 0 0 0 0 0 0 0 0 0 0 7 7 9 8 0 0 0 0 0 0 0 0 5 5 3 1 1 0 0 0 6 10 1 1 4 32 0 0 0 0 +FFQ 234 0 0 0 0 0 0 0 0 0 0 0 0 9 6 10 5 0 0 0 0 0 0 0 0 5 5 3 1 0 0 0 1 5 11 0 1 4 34 0 0 0 0 +FFQ 235 0 0 0 0 0 0 0 0 0 0 0 0 4 10 13 7 0 0 0 0 0 0 0 0 5 1 4 0 0 0 2 1 5 7 0 0 4 37 0 0 0 0 +FFQ 236 0 0 0 0 0 0 0 0 0 0 0 0 7 8 15 6 0 0 0 0 0 0 0 0 7 3 5 1 0 0 0 1 6 8 0 1 1 31 0 0 0 0 +FFQ 237 0 0 0 0 0 0 0 0 0 0 0 0 2 9 13 6 0 0 0 0 0 0 0 0 6 4 7 1 0 0 0 1 3 12 0 1 1 34 0 0 0 0 +FFQ 238 0 0 0 0 0 0 0 0 0 0 0 0 2 10 16 6 0 0 0 0 0 0 0 0 9 2 3 0 0 0 0 0 5 9 0 2 3 33 0 0 0 0 +FFQ 239 0 0 0 0 0 0 0 0 0 0 0 0 4 5 17 9 0 0 0 0 0 0 0 0 7 3 1 0 0 0 1 1 2 15 0 1 3 31 0 0 0 0 +FFQ 240 0 0 0 0 0 0 0 0 0 0 0 0 0 10 19 6 0 0 0 0 0 0 0 0 6 4 4 0 0 1 3 0 2 13 0 1 1 30 0 0 0 0 +FFQ 241 0 0 0 0 0 0 0 0 0 0 0 0 1 4 23 9 0 0 0 0 0 0 0 0 7 5 8 1 0 0 2 1 1 8 0 1 3 26 0 0 0 0 +FFQ 242 0 0 0 0 0 0 0 0 0 0 0 0 3 10 19 10 0 0 0 0 0 0 0 0 2 5 4 1 0 0 0 1 2 10 0 0 2 31 0 0 0 0 +FFQ 243 0 0 0 0 0 0 0 0 0 0 0 0 2 2 17 14 0 0 0 0 0 0 0 0 6 5 5 0 0 0 0 0 6 13 0 2 3 25 0 0 0 0 +FFQ 244 0 0 0 0 0 0 0 0 0 0 0 0 1 3 18 11 0 0 0 0 0 0 0 0 6 5 5 1 0 0 1 0 2 12 0 5 1 29 0 0 0 0 +FFQ 245 0 0 0 0 0 0 0 0 0 0 0 0 1 8 14 11 0 0 0 0 0 0 0 0 8 5 3 1 0 0 1 0 1 15 1 1 3 27 0 0 0 0 +FFQ 246 0 0 0 0 0 0 0 0 0 0 0 0 4 6 15 12 0 0 0 0 0 0 0 0 5 2 8 1 0 1 1 0 1 13 0 2 1 28 0 0 0 0 +FFQ 247 0 0 0 0 0 0 0 0 0 0 0 0 8 3 16 14 0 0 0 0 0 0 0 0 10 4 6 0 0 0 0 0 2 15 1 2 2 17 0 0 0 0 +FFQ 248 0 0 0 0 0 0 0 0 0 0 0 0 5 6 21 8 0 0 0 0 0 0 0 0 7 8 6 2 0 0 0 1 1 14 0 2 2 17 0 0 0 0 +FFQ 249 0 0 0 0 0 0 0 0 0 0 0 0 5 6 20 8 0 0 0 0 0 0 0 0 5 7 10 0 1 0 0 0 1 15 0 2 0 20 0 0 0 0 +FFQ 250 0 0 0 0 0 0 0 0 0 0 0 0 2 10 15 10 0 0 0 0 0 0 0 0 9 5 8 1 0 0 0 2 6 10 0 0 2 20 0 0 0 0 +FFQ 251 0 0 0 0 0 0 0 0 0 0 0 0 7 20 21 17 0 0 0 0 0 0 0 0 7 7 6 0 0 0 0 1 2 4 0 0 0 8 0 0 0 0 +FFQ 252 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +# Last Fragment Qualitites. Use `grep ^LFQ | cut -f 2-` to extract this part. +# Columns correspond to qualities and rows to cycles. First column is the cycle number. +LFQ 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 3 2 0 20 38 32 1 0 0 0 0 0 0 +LFQ 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 3 0 0 18 36 36 6 0 0 0 0 0 0 +LFQ 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 14 31 46 5 0 0 0 0 0 0 +LFQ 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 8 36 42 11 0 0 0 0 0 0 +LFQ 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 12 35 43 6 0 0 0 0 0 0 +LFQ 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 7 8 0 0 81 0 0 0 0 +LFQ 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 13 1 0 76 0 0 0 0 +LFQ 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 11 15 4 0 69 0 0 0 0 +LFQ 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 6 20 3 0 68 0 0 0 0 +LFQ 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 11 5 0 75 0 0 0 0 +LFQ 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 6 16 6 0 70 0 0 0 0 +LFQ 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 8 2 0 86 0 0 0 0 +LFQ 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 3 92 0 0 0 +LFQ 14 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 2 1 0 3 89 0 0 0 +LFQ 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 4 91 0 0 0 +LFQ 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 96 0 0 0 +LFQ 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 3 94 0 0 0 +LFQ 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 2 93 0 0 0 +LFQ 19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 93 0 0 0 +LFQ 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 4 91 0 0 0 +LFQ 21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 3 94 0 0 0 +LFQ 22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 97 0 0 0 +LFQ 23 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 18 74 0 0 +LFQ 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 19 76 0 0 +LFQ 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 4 15 76 0 0 +LFQ 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 2 18 75 0 0 +LFQ 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 12 84 0 0 +LFQ 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 5 16 74 0 0 +LFQ 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 6 19 73 0 0 +LFQ 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 12 17 67 0 0 +LFQ 31 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 0 1 2 15 77 0 0 +LFQ 32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 7 22 68 0 0 +LFQ 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 0 1 3 18 73 0 0 +LFQ 34 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 7 19 72 0 0 +LFQ 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 2 23 71 0 0 +LFQ 36 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 26 69 0 0 +LFQ 37 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 3 0 6 23 65 0 0 +LFQ 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 31 63 0 0 +LFQ 39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 5 33 56 0 0 +LFQ 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 3 1 1 7 25 60 0 0 +LFQ 41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 1 7 19 67 0 0 +LFQ 42 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 7 21 68 0 0 +LFQ 43 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 4 5 28 56 0 0 +LFQ 44 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 2 13 29 49 0 0 +LFQ 45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 7 31 57 0 0 +LFQ 46 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 4 2 8 34 49 0 0 +LFQ 47 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 1 1 0 8 22 63 0 0 +LFQ 48 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 7 24 64 0 0 +LFQ 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 9 28 58 0 0 +LFQ 50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 1 6 12 76 0 0 +LFQ 51 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 4 2 28 63 0 0 +LFQ 52 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 6 27 62 0 0 +LFQ 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 2 8 27 58 0 0 +LFQ 54 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 21 73 0 0 +LFQ 55 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 8 18 68 0 0 +LFQ 56 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 6 9 18 63 0 0 +LFQ 57 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 1 9 18 69 0 0 +LFQ 58 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 4 6 17 69 2 0 +LFQ 59 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 4 2 22 65 1 0 +LFQ 60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 3 6 19 64 1 0 +LFQ 61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 6 28 61 0 0 +LFQ 62 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 3 4 6 23 59 2 0 +LFQ 63 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 4 9 31 51 2 0 +LFQ 64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 4 8 29 53 0 0 +LFQ 65 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 1 7 5 26 57 0 0 +LFQ 66 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 1 2 2 3 20 64 2 0 +LFQ 67 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 2 0 3 10 25 56 0 0 +LFQ 68 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 1 1 2 5 6 19 61 0 0 +LFQ 69 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 8 19 63 0 0 +LFQ 70 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 7 4 25 58 0 0 +LFQ 71 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 9 28 55 0 0 +LFQ 72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 1 0 0 0 1 0 2 2 0 0 6 7 24 54 0 0 +LFQ 73 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 5 8 25 57 0 0 +LFQ 74 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 2 0 2 0 1 1 4 10 24 52 0 0 +LFQ 75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 1 9 11 21 52 0 0 +LFQ 76 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 4 1 0 3 1 0 7 6 22 52 0 0 +LFQ 77 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 2 2 0 1 10 12 23 47 0 0 +LFQ 78 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 5 8 37 44 0 0 +LFQ 79 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 3 10 27 56 0 0 +LFQ 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 0 1 1 0 3 12 30 48 0 0 +LFQ 81 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 7 7 33 46 0 0 +LFQ 82 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 3 0 7 7 22 56 0 0 +LFQ 83 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 5 2 3 8 25 52 0 0 +LFQ 84 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 1 0 3 1 0 4 11 32 45 0 0 +LFQ 85 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 2 2 0 1 4 0 1 12 22 54 0 0 +LFQ 86 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 4 5 12 28 46 0 0 +LFQ 87 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 1 5 9 29 47 0 0 +LFQ 88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 2 2 0 1 2 15 38 38 0 0 +LFQ 89 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 0 1 0 3 11 34 46 0 0 +LFQ 90 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 1 4 11 31 47 0 0 +LFQ 91 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 2 0 1 0 2 6 32 53 0 0 +LFQ 92 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 3 10 23 60 0 0 +LFQ 93 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 4 10 32 50 0 0 +LFQ 94 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 3 0 0 0 5 7 29 54 0 0 +LFQ 95 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 3 8 26 56 0 0 +LFQ 96 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 4 8 21 61 0 0 +LFQ 97 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 5 0 2 6 5 23 56 0 0 +LFQ 98 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 5 10 21 57 0 0 +LFQ 99 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 3 1 4 6 33 48 0 0 +LFQ 100 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 1 2 0 2 2 0 3 5 23 56 0 0 +LFQ 101 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 6 9 36 44 0 0 +LFQ 102 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 7 5 34 47 0 0 +LFQ 103 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 2 1 1 3 8 35 48 0 0 +LFQ 104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 5 7 36 49 0 0 +LFQ 105 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 5 9 32 48 0 0 +LFQ 106 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 3 5 4 9 23 52 0 0 +LFQ 107 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 5 9 33 43 0 0 +LFQ 108 0 0 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 3 3 13 23 51 0 0 +LFQ 109 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 2 1 6 12 39 35 0 0 +LFQ 110 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 1 1 0 0 0 0 0 1 0 0 0 0 1 1 0 2 0 3 2 8 36 40 0 0 +LFQ 111 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 1 1 3 3 1 2 3 8 30 44 0 0 +LFQ 112 0 0 1 0 0 0 0 0 0 0 0 0 2 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 3 0 4 14 28 42 0 0 +LFQ 113 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 1 0 3 0 2 1 5 10 31 43 0 0 +LFQ 114 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 2 3 4 10 29 44 0 0 +LFQ 115 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 3 4 3 7 9 37 32 0 0 +LFQ 116 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 2 0 0 0 0 0 1 0 0 0 0 0 2 0 1 1 3 5 1 12 35 34 0 0 +LFQ 117 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 1 0 0 0 0 1 3 1 1 1 1 1 2 9 34 42 0 0 +LFQ 118 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 3 1 2 2 1 9 33 43 0 0 +LFQ 119 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 1 2 3 13 38 36 0 0 +LFQ 120 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 1 3 3 4 13 26 44 0 0 +LFQ 121 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 2 0 0 1 0 0 0 0 0 1 1 3 3 7 26 53 0 0 +LFQ 122 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0 3 1 3 7 28 52 0 0 +LFQ 123 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 2 0 0 1 5 4 4 12 18 50 0 0 +LFQ 124 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 6 2 2 13 35 37 0 0 +LFQ 125 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 3 0 1 0 4 2 3 14 34 34 0 0 +LFQ 126 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 2 1 4 3 2 11 39 33 0 0 +LFQ 127 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 1 2 2 2 9 35 43 0 0 +LFQ 128 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 2 0 0 1 0 0 2 0 0 1 8 1 1 8 36 37 0 0 +LFQ 129 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 1 5 2 4 12 30 40 0 0 +LFQ 130 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 2 1 2 1 3 13 23 47 0 0 +LFQ 131 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 1 0 1 4 3 3 12 27 45 0 0 +LFQ 132 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 4 5 14 25 44 0 0 +LFQ 133 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 2 1 6 5 3 7 34 36 0 0 +LFQ 134 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 3 1 4 8 2 10 32 34 0 0 +LFQ 135 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 1 3 5 3 13 35 31 0 0 +LFQ 136 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 2 2 4 2 3 6 2 15 35 25 0 0 +LFQ 137 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 2 0 1 7 2 3 15 29 35 0 0 +LFQ 138 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 2 2 3 5 9 33 35 0 0 +LFQ 139 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 0 0 0 0 0 0 0 0 2 0 0 0 1 0 1 0 2 1 6 4 1 20 25 32 0 0 +LFQ 140 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 1 2 1 0 0 1 0 1 0 3 3 3 20 32 30 0 0 +LFQ 141 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 1 1 0 1 2 1 2 0 3 2 1 19 36 27 0 0 +LFQ 142 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 4 2 5 3 4 23 34 17 0 0 +LFQ 143 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 1 1 0 0 0 0 0 0 0 0 1 1 0 1 2 1 2 3 8 2 3 21 25 25 0 0 +LFQ 144 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 1 0 0 1 0 0 0 0 0 3 0 0 2 0 1 2 1 2 4 1 4 3 16 33 22 0 0 +LFQ 145 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 2 2 5 3 4 4 4 16 21 32 0 0 +LFQ 146 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 1 3 0 0 0 0 0 0 0 0 0 1 3 0 0 3 1 6 1 4 2 2 16 31 21 0 0 +LFQ 147 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 2 0 4 2 6 5 5 16 29 27 0 0 +LFQ 148 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 4 5 1 1 3 22 30 28 0 0 +LFQ 149 0 0 0 0 0 0 0 0 0 0 0 0 2 0 3 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 3 2 3 4 3 24 36 18 0 0 +LFQ 150 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 0 0 0 0 0 0 0 2 0 0 2 0 0 0 0 0 1 4 3 4 25 30 24 0 0 +LFQ 151 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 1 0 5 4 4 22 27 29 0 0 +LFQ 152 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 2 1 0 0 0 0 0 0 0 1 0 2 2 0 0 2 0 2 5 2 6 5 22 25 20 0 0 +LFQ 153 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 4 0 0 0 0 0 0 0 0 1 0 0 3 1 1 1 1 4 2 4 3 3 32 24 14 0 0 +LFQ 154 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 1 0 0 0 0 0 0 0 0 0 0 2 2 0 1 0 0 5 4 3 8 6 23 21 20 0 0 +LFQ 155 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 2 1 1 1 3 7 5 28 26 17 0 0 +LFQ 156 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 3 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 5 3 5 3 31 20 24 0 0 +LFQ 157 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 2 1 5 3 2 2 31 20 28 0 0 +LFQ 158 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 2 1 0 0 0 0 0 0 0 2 0 0 2 1 0 1 0 1 3 4 5 4 34 7 30 0 0 +LFQ 159 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 2 0 1 0 0 0 0 0 0 0 2 0 0 0 1 0 0 4 1 4 8 3 42 15 14 0 0 +LFQ 160 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 2 0 1 0 2 5 1 3 2 7 4 1 37 17 14 0 0 +LFQ 161 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 1 0 0 0 0 0 0 0 1 0 2 2 1 0 2 1 1 3 11 3 2 34 14 18 0 0 +LFQ 162 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 0 0 0 0 0 0 1 3 1 0 0 0 3 3 4 9 4 6 36 12 14 0 0 +LFQ 163 0 0 0 0 0 0 0 0 0 0 0 0 2 1 4 0 0 0 0 0 0 0 0 0 0 1 2 1 0 0 1 1 3 1 6 5 3 38 17 14 0 0 +LFQ 164 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 1 0 1 2 0 0 1 1 3 1 9 5 4 39 16 13 0 0 +LFQ 165 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 1 1 2 5 0 6 8 2 39 15 15 0 0 +LFQ 166 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 3 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 3 3 3 0 6 43 13 22 0 0 +LFQ 167 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 3 1 0 0 0 0 0 0 0 0 3 2 0 0 0 2 0 0 4 5 3 10 36 13 16 0 0 +LFQ 168 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 1 0 0 0 0 0 0 0 0 0 2 1 1 0 1 2 1 3 3 10 2 4 37 11 16 0 0 +LFQ 169 0 0 0 0 0 0 0 0 0 0 0 0 6 6 3 1 1 0 0 0 0 0 0 0 0 4 3 0 1 0 2 3 3 4 3 0 2 35 9 14 0 0 +LFQ 170 0 0 0 0 0 0 0 0 0 0 0 0 2 6 1 0 0 0 0 0 0 0 0 0 0 5 5 0 0 2 1 2 2 6 5 3 3 39 8 10 0 0 +LFQ 171 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 0 0 0 0 0 0 0 0 0 0 3 2 0 0 0 3 3 2 5 8 5 7 36 10 11 0 0 +LFQ 172 0 0 0 0 0 0 0 0 0 0 0 0 6 5 0 1 0 0 0 0 0 0 0 0 0 0 3 1 0 0 3 0 3 4 5 6 4 32 15 12 0 0 +LFQ 173 0 0 0 0 0 0 0 0 0 0 0 0 4 1 1 0 0 0 0 0 0 0 0 0 1 0 4 0 0 0 0 0 6 4 4 5 4 37 18 11 0 0 +LFQ 174 0 0 0 0 0 0 0 0 0 0 0 0 4 2 1 1 0 0 0 0 0 0 0 0 1 1 2 1 0 0 0 3 3 4 7 3 5 36 12 14 0 0 +LFQ 175 0 0 0 0 0 0 0 0 0 0 0 0 4 2 0 2 0 0 0 0 0 0 0 0 0 2 2 1 0 0 3 3 6 3 10 3 4 30 13 12 0 0 +LFQ 176 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 5 0 0 0 0 0 0 0 0 0 1 4 1 1 3 2 1 2 3 4 3 2 42 7 14 0 0 +LFQ 177 0 0 0 0 0 0 0 0 0 0 0 0 3 3 2 4 0 0 0 0 0 0 0 0 1 2 2 0 0 1 2 1 1 5 5 7 3 33 11 14 0 0 +LFQ 178 0 0 0 0 0 0 0 0 0 0 0 0 1 3 1 3 0 0 0 0 0 0 0 0 1 3 1 0 0 0 0 0 3 6 9 2 8 39 10 10 0 0 +LFQ 179 0 0 0 0 0 0 0 0 0 0 0 0 2 4 2 3 0 0 0 0 0 0 0 0 1 1 2 0 0 0 1 1 1 7 8 2 6 36 10 13 0 0 +LFQ 180 0 0 0 0 0 0 0 0 0 0 0 0 1 4 3 3 0 0 0 0 0 0 0 0 3 1 1 0 0 0 3 0 4 3 4 2 8 41 13 6 0 0 +LFQ 181 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 2 0 0 0 0 0 0 0 0 1 1 2 0 0 0 2 1 6 10 5 5 4 39 10 8 0 0 +LFQ 182 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 1 0 0 0 0 0 0 0 0 5 1 2 0 0 0 2 1 2 5 4 2 3 46 19 3 0 0 +LFQ 183 0 0 0 0 0 0 0 0 0 0 0 0 4 1 0 3 0 0 0 0 0 0 0 0 1 0 0 1 0 2 1 0 1 8 6 4 7 43 14 4 0 0 +LFQ 184 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 2 1 1 0 1 0 0 3 3 4 6 3 5 55 8 2 0 0 +LFQ 185 0 0 0 0 0 0 0 0 0 0 0 0 3 2 1 3 0 0 0 0 0 0 0 0 0 1 2 0 1 1 1 1 2 7 2 4 8 47 9 5 0 0 +LFQ 186 0 0 0 0 0 0 0 0 0 0 0 0 1 1 4 6 0 0 0 0 0 0 0 0 2 0 5 0 0 0 1 1 3 11 5 5 4 37 11 3 0 0 +LFQ 187 0 0 0 0 0 0 0 0 0 0 0 0 4 1 3 3 0 0 0 0 0 0 0 0 5 1 1 0 2 0 1 1 6 10 3 2 3 41 10 3 0 0 +LFQ 188 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 3 0 0 0 0 0 0 0 0 2 4 7 0 1 0 3 2 7 7 6 3 4 34 9 2 0 0 +LFQ 189 0 0 0 0 0 0 0 0 0 0 0 0 3 4 3 4 0 0 0 0 0 0 0 0 4 0 5 2 0 0 5 0 6 8 3 8 8 30 6 1 0 0 +LFQ 190 0 0 0 0 0 0 0 0 0 0 0 0 5 5 3 6 0 0 0 0 0 0 0 0 2 1 3 0 1 0 2 2 7 11 1 8 3 34 6 0 0 0 +LFQ 191 0 0 0 0 0 0 0 0 0 0 0 0 5 7 2 4 0 0 0 0 0 0 0 0 3 0 3 0 0 0 1 0 4 5 9 6 12 33 6 0 0 0 +LFQ 192 0 0 0 0 0 0 0 0 0 0 0 0 3 3 2 6 0 0 0 0 0 0 0 0 3 3 6 0 1 0 0 1 5 9 4 4 5 38 7 0 0 0 +LFQ 193 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 7 0 0 0 0 0 0 0 0 4 3 3 0 0 0 0 0 5 10 4 2 11 43 4 0 0 0 +LFQ 194 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 6 0 0 0 0 0 0 0 0 5 1 8 0 1 0 1 0 4 8 2 7 3 43 8 0 0 0 +LFQ 195 0 0 0 0 0 0 0 0 0 0 0 0 4 1 2 8 0 0 0 0 0 0 0 0 0 0 4 0 1 0 3 0 2 13 1 4 8 39 10 0 0 0 +LFQ 196 0 0 0 0 0 0 0 0 0 0 0 0 1 6 1 3 0 0 0 0 0 0 0 0 1 1 3 0 2 0 1 1 4 11 2 1 9 43 10 0 0 0 +LFQ 197 0 0 0 0 0 0 0 0 0 0 0 0 2 0 2 10 0 0 0 0 0 0 0 0 3 0 1 0 0 0 2 1 6 10 2 0 4 47 10 0 0 0 +LFQ 198 0 0 0 0 0 0 0 0 0 0 0 0 2 4 4 7 0 0 0 0 0 0 0 0 1 0 5 1 2 1 0 0 1 7 4 2 4 47 8 0 0 0 +LFQ 199 0 0 0 0 0 0 0 0 0 0 0 0 1 4 5 6 0 0 0 0 0 0 0 0 3 2 7 0 0 0 1 0 3 7 3 3 7 39 9 0 0 0 +LFQ 200 0 0 0 0 0 0 0 0 0 0 0 0 0 5 2 8 0 0 0 0 0 0 0 0 5 1 1 0 1 0 2 0 5 12 5 5 3 40 5 0 0 0 +LFQ 201 0 0 0 0 0 0 0 0 0 0 0 0 2 1 6 7 0 0 0 0 0 0 0 0 5 0 4 0 0 0 1 1 7 8 1 0 4 47 6 0 0 0 +LFQ 202 0 0 0 0 0 0 0 0 0 0 0 0 6 7 3 8 0 0 0 0 0 0 0 0 3 3 1 0 0 0 1 0 4 12 2 3 2 34 11 0 0 0 +LFQ 203 0 0 0 0 0 0 0 0 0 0 0 0 8 5 2 5 0 0 0 0 0 0 0 0 2 0 4 0 1 0 1 1 4 9 7 2 2 37 10 0 0 0 +LFQ 204 0 0 0 0 0 0 0 0 0 0 0 0 2 5 1 6 0 0 0 0 0 0 0 0 4 3 5 0 0 0 0 0 5 11 3 3 5 41 6 0 0 0 +LFQ 205 0 0 0 0 0 0 0 0 0 0 0 0 5 11 1 5 0 0 0 0 0 0 0 0 3 0 3 0 0 0 2 0 4 18 2 4 4 33 5 0 0 0 +LFQ 206 0 0 0 0 0 0 0 0 0 0 0 0 3 7 2 5 0 0 0 0 0 0 0 0 4 5 7 0 0 0 0 0 2 13 0 3 4 37 8 0 0 0 +LFQ 207 0 0 0 0 0 0 0 0 0 0 0 0 1 6 5 6 0 0 0 0 0 0 0 0 4 2 4 0 2 0 4 1 3 10 4 2 3 36 7 0 0 0 +LFQ 208 0 0 0 0 0 0 0 0 0 0 0 0 1 4 3 4 0 0 0 0 0 0 0 0 6 4 4 0 0 0 1 0 9 11 2 5 3 36 7 0 0 0 +LFQ 209 0 0 0 0 0 0 0 0 0 0 0 0 2 7 4 8 0 0 0 0 0 0 0 0 3 2 4 0 0 0 3 0 8 14 2 1 2 33 7 0 0 0 +LFQ 210 0 0 0 0 0 0 0 0 0 0 0 0 1 5 6 7 0 0 0 0 0 0 0 0 4 3 3 0 0 0 3 0 6 6 0 3 5 43 5 0 0 0 +LFQ 211 0 0 0 0 0 0 0 0 0 0 0 0 2 5 6 4 0 0 0 0 0 0 0 0 6 3 5 0 0 0 0 2 5 11 4 3 3 35 6 0 0 0 +LFQ 212 0 0 0 0 0 0 0 0 0 0 0 0 0 3 6 7 0 0 0 0 0 0 0 0 3 4 8 0 0 0 0 0 5 17 1 1 4 35 6 0 0 0 +LFQ 213 0 0 0 0 0 0 0 0 0 0 0 0 6 6 10 5 0 0 0 0 0 0 0 0 5 3 1 0 0 0 0 1 4 7 1 5 2 43 1 0 0 0 +LFQ 214 0 0 0 0 0 0 0 0 0 0 0 0 4 9 4 10 0 0 0 0 0 0 0 0 4 1 6 0 2 0 1 1 3 9 0 2 3 39 2 0 0 0 +LFQ 215 0 0 0 0 0 0 0 0 0 0 0 0 5 6 5 6 0 0 0 0 0 0 0 0 5 5 8 0 0 0 1 2 5 12 0 0 4 34 2 0 0 0 +LFQ 216 0 0 0 0 0 0 0 0 0 0 0 0 3 3 6 5 0 0 0 0 0 0 0 0 3 6 5 1 3 0 1 0 5 15 1 3 2 37 1 0 0 0 +LFQ 217 0 0 0 0 0 0 0 0 0 0 0 0 3 7 6 4 0 0 0 0 0 0 0 0 4 1 2 0 0 1 1 0 10 15 1 3 2 39 1 0 0 0 +LFQ 218 0 0 0 0 0 0 0 0 0 0 0 0 2 4 7 2 0 0 0 0 0 0 0 0 6 4 10 0 0 0 1 0 3 13 1 5 3 35 4 0 0 0 +LFQ 219 0 0 0 0 0 0 0 0 0 0 0 0 2 5 4 4 0 0 0 0 0 0 0 0 5 1 5 0 0 1 0 0 4 13 1 6 3 45 1 0 0 0 +LFQ 220 0 0 0 0 0 0 0 0 0 0 0 0 2 4 9 4 0 0 0 0 0 0 0 0 4 2 2 0 0 0 0 2 5 14 1 1 2 47 1 0 0 0 +LFQ 221 0 0 0 0 0 0 0 0 0 0 0 0 3 4 6 4 0 0 0 0 0 0 0 0 1 4 6 0 0 0 0 0 2 10 1 3 3 53 0 0 0 0 +LFQ 222 0 0 0 0 0 0 0 0 0 0 0 0 3 5 8 6 0 0 0 0 0 0 0 0 5 2 6 0 0 0 0 0 2 6 1 3 4 49 0 0 0 0 +LFQ 223 0 0 0 0 0 0 0 0 0 0 0 0 5 8 6 8 0 0 0 0 0 0 0 0 3 3 5 1 1 0 1 0 0 13 1 0 2 43 0 0 0 0 +LFQ 224 0 0 0 0 0 0 0 0 0 0 0 0 2 9 11 6 0 0 0 0 0 0 0 0 4 3 3 0 0 0 0 1 2 15 1 0 1 42 0 0 0 0 +LFQ 225 0 0 0 0 0 0 0 0 0 0 0 0 4 8 2 4 0 0 0 0 0 0 0 0 7 3 10 0 2 0 0 0 3 10 1 2 5 39 0 0 0 0 +LFQ 226 0 0 0 0 0 0 0 0 0 0 0 0 5 9 3 7 0 0 0 0 0 0 0 0 8 5 5 0 1 0 2 1 3 13 0 2 3 33 0 0 0 0 +LFQ 227 0 0 0 0 0 0 0 0 0 0 0 0 10 8 4 5 0 0 0 0 0 0 0 0 3 2 3 0 0 0 2 3 5 17 0 3 2 33 0 0 0 0 +LFQ 228 0 0 0 0 0 0 0 0 0 0 0 0 10 8 6 2 0 0 0 0 0 0 0 0 6 1 6 0 1 2 1 1 4 13 1 2 1 35 0 0 0 0 +LFQ 229 0 0 0 0 0 0 0 0 0 0 0 0 4 11 6 6 0 0 0 0 0 0 0 0 1 3 5 0 0 0 0 2 6 13 0 3 5 35 0 0 0 0 +LFQ 230 0 0 0 0 0 0 0 0 0 0 0 0 4 11 10 7 0 0 0 0 0 0 0 0 2 3 4 0 0 0 1 2 9 10 0 1 1 35 0 0 0 0 +LFQ 231 0 0 0 0 0 0 0 0 0 0 0 0 6 7 6 6 0 0 0 0 0 0 0 0 4 5 4 0 1 0 1 0 4 13 1 5 5 32 0 0 0 0 +LFQ 232 0 0 0 0 0 0 0 0 0 0 0 0 3 7 10 4 0 0 0 0 0 0 0 0 6 4 7 0 0 0 0 0 3 12 0 1 3 40 0 0 0 0 +LFQ 233 0 0 0 0 0 0 0 0 0 0 0 0 7 7 9 8 0 0 0 0 0 0 0 0 5 5 3 1 1 0 0 0 6 10 1 1 4 32 0 0 0 0 +LFQ 234 0 0 0 0 0 0 0 0 0 0 0 0 9 6 10 5 0 0 0 0 0 0 0 0 5 5 3 1 0 0 0 1 5 11 0 1 4 34 0 0 0 0 +LFQ 235 0 0 0 0 0 0 0 0 0 0 0 0 4 10 13 7 0 0 0 0 0 0 0 0 5 1 4 0 0 0 2 1 5 7 0 0 4 37 0 0 0 0 +LFQ 236 0 0 0 0 0 0 0 0 0 0 0 0 7 8 15 6 0 0 0 0 0 0 0 0 7 3 5 1 0 0 0 1 6 8 0 1 1 31 0 0 0 0 +LFQ 237 0 0 0 0 0 0 0 0 0 0 0 0 2 9 13 6 0 0 0 0 0 0 0 0 6 4 7 1 0 0 0 1 3 12 0 1 1 34 0 0 0 0 +LFQ 238 0 0 0 0 0 0 0 0 0 0 0 0 2 10 16 6 0 0 0 0 0 0 0 0 9 2 3 0 0 0 0 0 5 9 0 2 3 33 0 0 0 0 +LFQ 239 0 0 0 0 0 0 0 0 0 0 0 0 4 5 17 9 0 0 0 0 0 0 0 0 7 3 1 0 0 0 1 1 2 15 0 1 3 31 0 0 0 0 +LFQ 240 0 0 0 0 0 0 0 0 0 0 0 0 0 10 19 6 0 0 0 0 0 0 0 0 6 4 4 0 0 1 3 0 2 13 0 1 1 30 0 0 0 0 +LFQ 241 0 0 0 0 0 0 0 0 0 0 0 0 1 4 23 9 0 0 0 0 0 0 0 0 7 5 8 1 0 0 2 1 1 8 0 1 3 26 0 0 0 0 +LFQ 242 0 0 0 0 0 0 0 0 0 0 0 0 3 10 19 10 0 0 0 0 0 0 0 0 2 5 4 1 0 0 0 1 2 10 0 0 2 31 0 0 0 0 +LFQ 243 0 0 0 0 0 0 0 0 0 0 0 0 2 2 17 14 0 0 0 0 0 0 0 0 6 5 5 0 0 0 0 0 6 13 0 2 3 25 0 0 0 0 +LFQ 244 0 0 0 0 0 0 0 0 0 0 0 0 1 3 18 11 0 0 0 0 0 0 0 0 6 5 5 1 0 0 1 0 2 12 0 5 1 29 0 0 0 0 +LFQ 245 0 0 0 0 0 0 0 0 0 0 0 0 1 8 14 11 0 0 0 0 0 0 0 0 8 5 3 1 0 0 1 0 1 15 1 1 3 27 0 0 0 0 +LFQ 246 0 0 0 0 0 0 0 0 0 0 0 0 4 6 15 12 0 0 0 0 0 0 0 0 5 2 8 1 0 1 1 0 1 13 0 2 1 28 0 0 0 0 +LFQ 247 0 0 0 0 0 0 0 0 0 0 0 0 8 3 16 14 0 0 0 0 0 0 0 0 10 4 6 0 0 0 0 0 2 15 1 2 2 17 0 0 0 0 +LFQ 248 0 0 0 0 0 0 0 0 0 0 0 0 5 6 21 8 0 0 0 0 0 0 0 0 7 8 6 2 0 0 0 1 1 14 0 2 2 17 0 0 0 0 +LFQ 249 0 0 0 0 0 0 0 0 0 0 0 0 5 6 20 8 0 0 0 0 0 0 0 0 5 7 10 0 1 0 0 0 1 15 0 2 0 20 0 0 0 0 +LFQ 250 0 0 0 0 0 0 0 0 0 0 0 0 2 10 15 10 0 0 0 0 0 0 0 0 9 5 8 1 0 0 0 2 6 10 0 0 2 20 0 0 0 0 +LFQ 251 0 0 0 0 0 0 0 0 0 0 0 0 7 20 21 17 0 0 0 0 0 0 0 0 7 7 6 0 0 0 0 1 2 4 0 0 0 8 0 0 0 0 +LFQ 252 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +# Mismatches per cycle and quality. Use `grep ^MPC | cut -f 2-` to extract this part. +# Columns correspond to qualities, rows to cycles. First column is the cycle number, second +# is the number of N's and the rest is the number of mismatches +MPC 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 +MPC 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 +MPC 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 +MPC 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 +MPC 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 23 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 31 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 34 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 36 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 37 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 42 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 43 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 44 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 46 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 47 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 48 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 51 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 52 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 54 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 55 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 56 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 57 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 58 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 59 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 62 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 63 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 65 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 66 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 67 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 68 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 69 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 70 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 71 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 73 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 74 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 76 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 +MPC 77 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 78 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 79 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 81 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 82 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 83 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 84 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 85 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 86 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 87 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 89 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 90 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 91 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 92 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 93 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 94 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 95 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 96 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 97 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 98 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 99 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 100 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 101 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 102 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 103 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 105 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 106 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 107 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 108 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 +MPC 109 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 110 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 111 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 112 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 113 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 114 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 115 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 116 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 117 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 118 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 119 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 120 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 121 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 122 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 123 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 124 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 125 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 126 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 127 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 128 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 129 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 130 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 131 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 132 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 133 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 134 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 135 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 136 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 137 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 138 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 139 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 140 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 141 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 +MPC 142 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 143 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 144 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 145 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 146 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 147 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 148 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 149 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 150 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 +MPC 151 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 152 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 153 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 154 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 155 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 156 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 0 +MPC 157 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 +MPC 158 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 159 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 160 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 161 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 +MPC 162 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 163 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 164 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 165 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 166 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 +MPC 167 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 168 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 +MPC 169 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 +MPC 170 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 171 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 172 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 173 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 174 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 175 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 176 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 177 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 178 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +MPC 179 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 +MPC 180 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 181 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 182 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 183 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 184 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 185 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 186 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 187 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 188 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 189 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 190 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 191 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 192 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 193 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 194 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 195 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 196 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 197 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 198 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 199 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 200 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 201 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 202 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 203 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 204 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 205 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 206 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 207 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 208 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 209 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 210 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 211 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 212 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 213 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 214 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 215 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 216 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 217 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 218 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 219 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 220 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 221 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 222 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 223 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 224 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 225 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 226 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 227 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 228 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 229 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 230 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 231 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 232 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 +MPC 233 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 234 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 235 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 236 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 237 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 238 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 239 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 240 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 241 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 242 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +MPC 243 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 244 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 245 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 246 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +MPC 247 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 +MPC 248 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 2 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 2 0 0 0 3 0 0 0 +MPC 249 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 2 0 5 0 0 0 0 0 0 2 0 0 0 0 0 0 0 +MPC 250 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 2 0 0 0 2 0 0 0 +MPC 251 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 2 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 3 0 0 0 +MPC 252 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +# GC Content of first fragments. Use `grep ^GCF | cut -f 2-` to extract this part. +GCF 21.86 0 +GCF 44.22 2 +GCF 44.97 8 +GCF 45.48 4 +GCF 45.98 3 +GCF 46.48 5 +GCF 46.98 2 +GCF 47.49 3 +GCF 47.99 12 +GCF 48.49 13 +GCF 48.99 9 +GCF 49.50 2 +GCF 50.25 3 +GCF 51.01 6 +GCF 51.51 4 +GCF 52.01 1 +GCF 52.51 0 +GCF 53.02 1 +# GC Content of last fragments. Use `grep ^GCL | cut -f 2-` to extract this part. +GCL 21.86 0 +GCL 44.22 2 +GCL 44.97 8 +GCL 45.48 4 +GCL 45.98 3 +GCL 46.48 5 +GCL 46.98 2 +GCL 47.49 3 +GCL 47.99 12 +GCL 48.49 13 +GCL 48.99 9 +GCL 49.50 2 +GCL 50.25 3 +GCL 51.01 6 +GCL 51.51 4 +GCL 52.01 1 +GCL 52.51 0 +GCL 53.02 1 +# ACGT content per cycle. Use `grep ^GCC | cut -f 2-` to extract this part. The columns are: cycle, and A,C,G,T counts [%] +GCC 1 21.50 29.50 33.50 15.50 +GCC 2 30.00 16.00 11.00 43.00 +GCC 3 33.00 25.00 9.00 33.00 +GCC 4 17.00 29.00 13.00 41.00 +GCC 5 37.00 22.00 12.00 29.00 +GCC 6 36.00 26.00 17.00 21.00 +GCC 7 29.50 13.50 31.50 25.50 +GCC 8 50.50 14.50 19.50 15.50 +GCC 9 17.00 33.00 18.00 32.00 +GCC 10 37.00 14.00 21.00 28.00 +GCC 11 20.50 14.50 29.50 35.50 +GCC 12 30.00 24.00 22.00 24.00 +GCC 13 27.00 15.00 21.00 37.00 +GCC 14 24.00 22.00 26.00 28.00 +GCC 15 25.50 20.50 24.50 29.50 +GCC 16 31.00 15.00 20.00 34.00 +GCC 17 28.00 25.00 14.00 33.00 +GCC 18 30.50 28.50 19.50 21.50 +GCC 19 29.00 26.00 21.00 24.00 +GCC 20 22.50 23.50 17.50 36.50 +GCC 21 35.50 17.50 19.50 27.50 +GCC 22 37.50 28.50 15.50 18.50 +GCC 23 31.00 19.00 13.00 37.00 +GCC 24 37.00 12.00 22.00 29.00 +GCC 25 35.50 22.50 17.50 24.50 +GCC 26 33.50 18.50 15.50 32.50 +GCC 27 34.50 14.50 25.50 25.50 +GCC 28 31.00 14.00 24.00 31.00 +GCC 29 30.00 27.00 24.00 19.00 +GCC 30 31.00 20.00 14.00 35.00 +GCC 31 33.50 29.50 13.50 23.50 +GCC 32 42.50 20.50 19.50 17.50 +GCC 33 25.50 23.50 14.50 36.50 +GCC 34 39.50 16.50 20.50 23.50 +GCC 35 32.50 23.50 21.50 22.50 +GCC 36 42.00 25.00 16.00 17.00 +GCC 37 38.00 17.00 19.00 26.00 +GCC 38 24.00 26.00 25.00 25.00 +GCC 39 22.50 41.50 18.50 17.50 +GCC 40 32.00 16.00 21.00 31.00 +GCC 41 33.00 28.00 19.00 20.00 +GCC 42 30.50 25.50 19.50 24.50 +GCC 43 35.00 29.00 15.00 21.00 +GCC 44 20.00 27.00 22.00 31.00 +GCC 45 40.50 21.50 21.50 16.50 +GCC 46 26.50 20.50 22.50 30.50 +GCC 47 38.50 29.50 16.50 15.50 +GCC 48 27.50 24.50 17.50 30.50 +GCC 49 28.50 32.50 10.50 28.50 +GCC 50 46.50 20.50 9.50 23.50 +GCC 51 34.50 28.50 13.50 23.50 +GCC 52 41.50 23.50 20.50 14.50 +GCC 53 20.00 28.00 26.00 26.00 +GCC 54 31.50 18.50 24.50 25.50 +GCC 55 30.50 22.50 16.50 30.50 +GCC 56 33.50 22.50 13.50 30.50 +GCC 57 23.00 24.00 23.00 30.00 +GCC 58 25.00 37.00 19.00 19.00 +GCC 59 34.00 23.00 24.00 19.00 +GCC 60 29.00 28.00 17.00 26.00 +GCC 61 25.50 23.50 24.50 26.50 +GCC 62 31.50 22.50 16.50 29.50 +GCC 63 27.50 28.50 25.50 18.50 +GCC 64 33.50 21.50 25.50 19.50 +GCC 65 35.50 19.50 18.50 26.50 +GCC 66 34.00 25.00 15.00 26.00 +GCC 67 37.00 23.00 19.00 21.00 +GCC 68 36.50 29.50 13.50 20.50 +GCC 69 38.50 19.50 20.50 21.50 +GCC 70 38.50 16.50 18.50 26.50 +GCC 71 25.50 38.50 21.50 14.50 +GCC 72 29.00 29.00 25.00 17.00 +GCC 73 32.50 20.50 21.50 25.50 +GCC 74 28.50 32.50 12.50 26.50 +GCC 75 41.50 12.50 18.50 27.50 +GCC 76 24.50 29.50 23.50 22.50 +GCC 77 36.00 21.00 18.00 25.00 +GCC 78 27.00 34.00 22.00 17.00 +GCC 79 21.50 26.50 25.50 26.50 +GCC 80 34.00 19.00 28.00 19.00 +GCC 81 17.00 26.00 26.00 31.00 +GCC 82 31.00 30.00 23.00 16.00 +GCC 83 31.50 26.50 12.50 29.50 +GCC 84 19.00 41.00 21.00 19.00 +GCC 85 37.50 24.50 16.50 21.50 +GCC 86 15.00 48.00 15.00 22.00 +GCC 87 41.00 16.00 18.00 25.00 +GCC 88 23.50 27.50 27.50 21.50 +GCC 89 26.50 27.50 26.50 19.50 +GCC 90 18.50 23.50 24.50 33.50 +GCC 91 27.00 32.00 22.00 19.00 +GCC 92 23.50 17.50 27.50 31.50 +GCC 93 25.50 37.50 15.50 21.50 +GCC 94 27.00 17.00 24.00 32.00 +GCC 95 26.50 37.50 14.50 21.50 +GCC 96 29.50 25.50 16.50 28.50 +GCC 97 29.00 31.00 21.00 19.00 +GCC 98 18.00 33.00 22.00 27.00 +GCC 99 24.50 33.50 24.50 17.50 +GCC 100 24.50 16.50 24.50 34.50 +GCC 101 25.00 40.00 19.00 16.00 +GCC 102 17.50 17.50 32.50 32.50 +GCC 103 31.00 26.00 16.00 27.00 +GCC 104 26.50 29.50 20.50 23.50 +GCC 105 34.00 33.00 21.00 12.00 +GCC 106 23.00 31.00 26.00 20.00 +GCC 107 17.50 35.50 23.50 23.50 +GCC 108 24.50 30.50 23.50 21.50 +GCC 109 17.00 31.00 22.00 30.00 +GCC 110 16.00 35.00 24.00 25.00 +GCC 111 24.00 32.00 23.00 21.00 +GCC 112 37.00 28.00 16.00 19.00 +GCC 113 19.50 22.50 32.50 25.50 +GCC 114 17.00 31.00 35.00 17.00 +GCC 115 29.50 24.50 23.50 22.50 +GCC 116 22.00 30.00 34.00 14.00 +GCC 117 27.00 23.00 19.00 31.00 +GCC 118 25.50 14.50 34.50 25.50 +GCC 119 22.50 34.50 20.50 22.50 +GCC 120 17.50 24.50 26.50 31.50 +GCC 121 27.50 33.50 22.50 16.50 +GCC 122 17.00 23.00 25.00 35.00 +GCC 123 23.50 46.50 11.50 18.50 +GCC 124 9.00 32.00 34.00 25.00 +GCC 125 24.00 27.00 19.00 30.00 +GCC 126 26.00 17.00 28.00 29.00 +GCC 127 26.50 16.50 21.50 35.50 +GCC 128 18.00 34.00 31.00 17.00 +GCC 129 25.50 25.50 27.50 21.50 +GCC 130 25.00 20.00 22.00 33.00 +GCC 131 17.50 39.50 24.50 18.50 +GCC 132 21.00 28.00 23.00 28.00 +GCC 133 13.50 31.50 35.50 19.50 +GCC 134 24.50 19.50 30.50 25.50 +GCC 135 16.50 23.50 30.50 29.50 +GCC 136 28.00 32.00 15.00 25.00 +GCC 137 22.50 21.50 30.50 25.50 +GCC 138 14.50 34.50 24.50 26.50 +GCC 139 20.50 29.50 24.50 25.50 +GCC 140 17.00 23.00 30.00 30.00 +GCC 141 20.50 23.50 25.50 30.50 +GCC 142 18.00 29.00 38.00 15.00 +GCC 143 22.00 24.00 27.00 27.00 +GCC 144 21.50 30.50 26.50 21.50 +GCC 145 22.00 21.00 29.00 28.00 +GCC 146 25.00 16.00 39.00 20.00 +GCC 147 26.50 22.50 30.50 20.50 +GCC 148 12.50 28.50 36.50 22.50 +GCC 149 26.50 23.50 23.50 26.50 +GCC 150 14.00 29.00 24.00 33.00 +GCC 151 19.50 30.50 32.50 17.50 +GCC 152 18.50 17.50 29.50 34.50 +GCC 153 22.50 22.50 31.50 23.50 +GCC 154 22.00 21.00 29.00 28.00 +GCC 155 21.00 26.00 19.00 34.00 +GCC 156 14.50 23.50 35.50 26.50 +GCC 157 22.00 31.00 23.00 24.00 +GCC 158 22.50 29.50 24.50 23.50 +GCC 159 17.50 12.50 46.50 23.50 +GCC 160 24.50 26.50 26.50 22.50 +GCC 161 13.00 23.00 45.00 19.00 +GCC 162 31.50 16.50 22.50 29.50 +GCC 163 19.50 21.50 35.50 23.50 +GCC 164 29.00 18.00 21.00 32.00 +GCC 165 14.50 17.50 35.50 32.50 +GCC 166 17.50 37.50 28.50 16.50 +GCC 167 16.50 21.50 31.50 30.50 +GCC 168 14.00 25.00 30.00 31.00 +GCC 169 18.50 20.50 23.50 37.50 +GCC 170 19.00 23.00 28.00 30.00 +GCC 171 20.00 28.00 33.00 19.00 +GCC 172 19.00 20.00 32.00 29.00 +GCC 173 24.50 16.50 33.50 25.50 +GCC 174 17.50 23.50 33.50 25.50 +GCC 175 33.50 17.50 35.50 13.50 +GCC 176 16.50 32.50 28.50 22.50 +GCC 177 19.00 22.00 27.00 32.00 +GCC 178 16.00 26.00 30.00 28.00 +GCC 179 18.00 18.00 22.00 42.00 +GCC 180 21.00 22.00 34.00 23.00 +GCC 181 20.50 19.50 35.50 24.50 +GCC 182 32.50 18.50 22.50 26.50 +GCC 183 24.50 13.50 28.50 33.50 +GCC 184 15.00 29.00 30.00 26.00 +GCC 185 15.00 32.00 33.00 20.00 +GCC 186 22.50 23.50 34.50 19.50 +GCC 187 19.00 14.00 40.00 27.00 +GCC 188 27.50 21.50 27.50 23.50 +GCC 189 17.00 22.00 34.00 27.00 +GCC 190 23.00 30.00 23.00 24.00 +GCC 191 25.00 22.00 28.00 25.00 +GCC 192 34.50 24.50 13.50 27.50 +GCC 193 18.50 25.50 25.50 30.50 +GCC 194 18.50 33.50 24.50 23.50 +GCC 195 16.00 26.00 23.00 35.00 +GCC 196 21.50 25.50 24.50 28.50 +GCC 197 20.00 21.00 23.00 36.00 +GCC 198 17.00 21.00 37.00 25.00 +GCC 199 20.50 18.50 25.50 35.50 +GCC 200 21.00 29.00 21.00 29.00 +GCC 201 27.00 21.00 23.00 29.00 +GCC 202 21.50 24.50 19.50 34.50 +GCC 203 21.50 24.50 26.50 27.50 +GCC 204 27.00 29.00 24.00 20.00 +GCC 205 19.50 21.50 22.50 36.50 +GCC 206 26.50 24.50 21.50 27.50 +GCC 207 22.50 21.50 19.50 36.50 +GCC 208 14.00 35.00 29.00 22.00 +GCC 209 16.00 23.00 12.00 49.00 +GCC 210 18.50 19.50 40.50 21.50 +GCC 211 26.00 20.00 22.00 32.00 +GCC 212 21.00 31.00 18.00 30.00 +GCC 213 24.00 15.00 31.00 30.00 +GCC 214 17.50 24.50 25.50 32.50 +GCC 215 26.00 24.00 23.00 27.00 +GCC 216 21.50 17.50 25.50 35.50 +GCC 217 26.00 29.00 17.00 28.00 +GCC 218 20.00 27.00 21.00 32.00 +GCC 219 17.00 21.00 21.00 41.00 +GCC 220 25.50 23.50 23.50 27.50 +GCC 221 21.50 23.50 20.50 34.50 +GCC 222 21.50 21.50 18.50 38.50 +GCC 223 20.00 27.00 28.00 25.00 +GCC 224 22.50 22.50 24.50 30.50 +GCC 225 14.50 35.50 30.50 19.50 +GCC 226 20.00 23.00 26.00 31.00 +GCC 227 20.50 24.50 23.50 31.50 +GCC 228 33.00 19.00 26.00 22.00 +GCC 229 22.50 24.50 18.50 34.50 +GCC 230 21.00 32.00 16.00 31.00 +GCC 231 23.00 28.00 30.00 19.00 +GCC 232 23.50 21.50 12.50 42.50 +GCC 233 21.00 27.00 25.00 27.00 +GCC 234 16.50 27.50 22.50 33.50 +GCC 235 20.00 15.00 28.00 37.00 +GCC 236 28.00 23.00 21.00 28.00 +GCC 237 20.50 19.50 22.50 37.50 +GCC 238 21.50 29.50 24.50 24.50 +GCC 239 20.00 8.00 17.00 55.00 +GCC 240 28.00 24.00 16.00 32.00 +GCC 241 22.50 22.50 16.50 38.50 +GCC 242 29.00 25.00 13.00 33.00 +GCC 243 22.50 15.50 23.50 38.50 +GCC 244 20.50 23.50 16.50 39.50 +GCC 245 28.00 23.00 19.00 30.00 +GCC 246 21.00 29.00 25.00 25.00 +GCC 247 32.00 14.00 13.00 41.00 +GCC 248 18.00 18.00 25.00 39.00 +GCC 249 25.00 23.00 21.00 31.00 +GCC 250 27.50 22.50 17.50 32.50 +GCC 251 13.50 20.50 36.50 29.50 +# Insert sizes. Use `grep ^IS | cut -f 2-` to extract this part. The columns are: insert size, pairs total, inward oriented pairs, outward oriented pairs, other pairs +# Read lengths. Use `grep ^RL | cut -f 2-` to extract this part. The columns are: read length, count +RL 251 200 +# Indel distribution. Use `grep ^ID | cut -f 2-` to extract this part. The columns are: length, number of insertions, number of deletions +ID 1 1 0 +ID 2 1 0 +ID 4 2 0 +ID 10 5 0 +ID 13 1 0 +ID 14 1 0 +ID 15 1 0 +ID 18 1 0 +ID 21 1 0 +ID 22 1 0 +ID 23 2 0 +ID 24 3 0 +ID 29 1 0 +ID 35 2 0 +ID 38 2 0 +# Indels per cycle. Use `grep ^IC | cut -f 2-` to extract this part. The columns are: cycle, number of insertions (fwd), .. (rev) , number of deletions (fwd), .. (rev) +IC 2 1 0 0 0 +IC 4 2 0 0 0 +IC 5 3 0 0 0 +IC 210 2 0 0 0 +IC 219 1 0 0 0 +IC 220 1 0 0 0 +IC 224 2 0 0 0 +IC 225 2 0 0 0 +IC 226 1 0 0 0 +IC 228 1 0 0 0 +IC 230 1 0 0 0 +IC 233 1 0 0 0 +IC 234 1 0 0 0 +IC 235 1 0 0 0 +IC 236 1 0 0 0 +IC 239 1 0 0 0 +IC 240 1 0 0 0 +IC 241 1 0 0 0 +IC 247 1 0 0 0 +# Coverage distribution. Use `grep ^COV | cut -f 2-` to extract this part. +COV [1-1] 1 1 +COV [7-7] 7 1 +COV [18-18] 18 1 +COV [24-24] 24 1 +COV [25-25] 25 249 +# GC-depth. Use `grep ^GCD | cut -f 2-` to extract this part. The columns are: GC%, unique sequence percentiles, 10th, 25th, 50th, 75th and 90th depth percentile +GCD 0.0 100.000 0.000 0.000 0.000 0.000 0.000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/samtools_stats_out2/gcc.tab Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,252 @@ +# ACGT content per cycle. The columns are: cycle, and A,C,G,T counts (percent) +1 21.50 29.50 33.50 15.50 +2 30.00 16.00 11.00 43.00 +3 33.00 25.00 9.00 33.00 +4 17.00 29.00 13.00 41.00 +5 37.00 22.00 12.00 29.00 +6 36.00 26.00 17.00 21.00 +7 29.50 13.50 31.50 25.50 +8 50.50 14.50 19.50 15.50 +9 17.00 33.00 18.00 32.00 +10 37.00 14.00 21.00 28.00 +11 20.50 14.50 29.50 35.50 +12 30.00 24.00 22.00 24.00 +13 27.00 15.00 21.00 37.00 +14 24.00 22.00 26.00 28.00 +15 25.50 20.50 24.50 29.50 +16 31.00 15.00 20.00 34.00 +17 28.00 25.00 14.00 33.00 +18 30.50 28.50 19.50 21.50 +19 29.00 26.00 21.00 24.00 +20 22.50 23.50 17.50 36.50 +21 35.50 17.50 19.50 27.50 +22 37.50 28.50 15.50 18.50 +23 31.00 19.00 13.00 37.00 +24 37.00 12.00 22.00 29.00 +25 35.50 22.50 17.50 24.50 +26 33.50 18.50 15.50 32.50 +27 34.50 14.50 25.50 25.50 +28 31.00 14.00 24.00 31.00 +29 30.00 27.00 24.00 19.00 +30 31.00 20.00 14.00 35.00 +31 33.50 29.50 13.50 23.50 +32 42.50 20.50 19.50 17.50 +33 25.50 23.50 14.50 36.50 +34 39.50 16.50 20.50 23.50 +35 32.50 23.50 21.50 22.50 +36 42.00 25.00 16.00 17.00 +37 38.00 17.00 19.00 26.00 +38 24.00 26.00 25.00 25.00 +39 22.50 41.50 18.50 17.50 +40 32.00 16.00 21.00 31.00 +41 33.00 28.00 19.00 20.00 +42 30.50 25.50 19.50 24.50 +43 35.00 29.00 15.00 21.00 +44 20.00 27.00 22.00 31.00 +45 40.50 21.50 21.50 16.50 +46 26.50 20.50 22.50 30.50 +47 38.50 29.50 16.50 15.50 +48 27.50 24.50 17.50 30.50 +49 28.50 32.50 10.50 28.50 +50 46.50 20.50 9.50 23.50 +51 34.50 28.50 13.50 23.50 +52 41.50 23.50 20.50 14.50 +53 20.00 28.00 26.00 26.00 +54 31.50 18.50 24.50 25.50 +55 30.50 22.50 16.50 30.50 +56 33.50 22.50 13.50 30.50 +57 23.00 24.00 23.00 30.00 +58 25.00 37.00 19.00 19.00 +59 34.00 23.00 24.00 19.00 +60 29.00 28.00 17.00 26.00 +61 25.50 23.50 24.50 26.50 +62 31.50 22.50 16.50 29.50 +63 27.50 28.50 25.50 18.50 +64 33.50 21.50 25.50 19.50 +65 35.50 19.50 18.50 26.50 +66 34.00 25.00 15.00 26.00 +67 37.00 23.00 19.00 21.00 +68 36.50 29.50 13.50 20.50 +69 38.50 19.50 20.50 21.50 +70 38.50 16.50 18.50 26.50 +71 25.50 38.50 21.50 14.50 +72 29.00 29.00 25.00 17.00 +73 32.50 20.50 21.50 25.50 +74 28.50 32.50 12.50 26.50 +75 41.50 12.50 18.50 27.50 +76 24.50 29.50 23.50 22.50 +77 36.00 21.00 18.00 25.00 +78 27.00 34.00 22.00 17.00 +79 21.50 26.50 25.50 26.50 +80 34.00 19.00 28.00 19.00 +81 17.00 26.00 26.00 31.00 +82 31.00 30.00 23.00 16.00 +83 31.50 26.50 12.50 29.50 +84 19.00 41.00 21.00 19.00 +85 37.50 24.50 16.50 21.50 +86 15.00 48.00 15.00 22.00 +87 41.00 16.00 18.00 25.00 +88 23.50 27.50 27.50 21.50 +89 26.50 27.50 26.50 19.50 +90 18.50 23.50 24.50 33.50 +91 27.00 32.00 22.00 19.00 +92 23.50 17.50 27.50 31.50 +93 25.50 37.50 15.50 21.50 +94 27.00 17.00 24.00 32.00 +95 26.50 37.50 14.50 21.50 +96 29.50 25.50 16.50 28.50 +97 29.00 31.00 21.00 19.00 +98 18.00 33.00 22.00 27.00 +99 24.50 33.50 24.50 17.50 +100 24.50 16.50 24.50 34.50 +101 25.00 40.00 19.00 16.00 +102 17.50 17.50 32.50 32.50 +103 31.00 26.00 16.00 27.00 +104 26.50 29.50 20.50 23.50 +105 34.00 33.00 21.00 12.00 +106 23.00 31.00 26.00 20.00 +107 17.50 35.50 23.50 23.50 +108 24.50 30.50 23.50 21.50 +109 17.00 31.00 22.00 30.00 +110 16.00 35.00 24.00 25.00 +111 24.00 32.00 23.00 21.00 +112 37.00 28.00 16.00 19.00 +113 19.50 22.50 32.50 25.50 +114 17.00 31.00 35.00 17.00 +115 29.50 24.50 23.50 22.50 +116 22.00 30.00 34.00 14.00 +117 27.00 23.00 19.00 31.00 +118 25.50 14.50 34.50 25.50 +119 22.50 34.50 20.50 22.50 +120 17.50 24.50 26.50 31.50 +121 27.50 33.50 22.50 16.50 +122 17.00 23.00 25.00 35.00 +123 23.50 46.50 11.50 18.50 +124 9.00 32.00 34.00 25.00 +125 24.00 27.00 19.00 30.00 +126 26.00 17.00 28.00 29.00 +127 26.50 16.50 21.50 35.50 +128 18.00 34.00 31.00 17.00 +129 25.50 25.50 27.50 21.50 +130 25.00 20.00 22.00 33.00 +131 17.50 39.50 24.50 18.50 +132 21.00 28.00 23.00 28.00 +133 13.50 31.50 35.50 19.50 +134 24.50 19.50 30.50 25.50 +135 16.50 23.50 30.50 29.50 +136 28.00 32.00 15.00 25.00 +137 22.50 21.50 30.50 25.50 +138 14.50 34.50 24.50 26.50 +139 20.50 29.50 24.50 25.50 +140 17.00 23.00 30.00 30.00 +141 20.50 23.50 25.50 30.50 +142 18.00 29.00 38.00 15.00 +143 22.00 24.00 27.00 27.00 +144 21.50 30.50 26.50 21.50 +145 22.00 21.00 29.00 28.00 +146 25.00 16.00 39.00 20.00 +147 26.50 22.50 30.50 20.50 +148 12.50 28.50 36.50 22.50 +149 26.50 23.50 23.50 26.50 +150 14.00 29.00 24.00 33.00 +151 19.50 30.50 32.50 17.50 +152 18.50 17.50 29.50 34.50 +153 22.50 22.50 31.50 23.50 +154 22.00 21.00 29.00 28.00 +155 21.00 26.00 19.00 34.00 +156 14.50 23.50 35.50 26.50 +157 22.00 31.00 23.00 24.00 +158 22.50 29.50 24.50 23.50 +159 17.50 12.50 46.50 23.50 +160 24.50 26.50 26.50 22.50 +161 13.00 23.00 45.00 19.00 +162 31.50 16.50 22.50 29.50 +163 19.50 21.50 35.50 23.50 +164 29.00 18.00 21.00 32.00 +165 14.50 17.50 35.50 32.50 +166 17.50 37.50 28.50 16.50 +167 16.50 21.50 31.50 30.50 +168 14.00 25.00 30.00 31.00 +169 18.50 20.50 23.50 37.50 +170 19.00 23.00 28.00 30.00 +171 20.00 28.00 33.00 19.00 +172 19.00 20.00 32.00 29.00 +173 24.50 16.50 33.50 25.50 +174 17.50 23.50 33.50 25.50 +175 33.50 17.50 35.50 13.50 +176 16.50 32.50 28.50 22.50 +177 19.00 22.00 27.00 32.00 +178 16.00 26.00 30.00 28.00 +179 18.00 18.00 22.00 42.00 +180 21.00 22.00 34.00 23.00 +181 20.50 19.50 35.50 24.50 +182 32.50 18.50 22.50 26.50 +183 24.50 13.50 28.50 33.50 +184 15.00 29.00 30.00 26.00 +185 15.00 32.00 33.00 20.00 +186 22.50 23.50 34.50 19.50 +187 19.00 14.00 40.00 27.00 +188 27.50 21.50 27.50 23.50 +189 17.00 22.00 34.00 27.00 +190 23.00 30.00 23.00 24.00 +191 25.00 22.00 28.00 25.00 +192 34.50 24.50 13.50 27.50 +193 18.50 25.50 25.50 30.50 +194 18.50 33.50 24.50 23.50 +195 16.00 26.00 23.00 35.00 +196 21.50 25.50 24.50 28.50 +197 20.00 21.00 23.00 36.00 +198 17.00 21.00 37.00 25.00 +199 20.50 18.50 25.50 35.50 +200 21.00 29.00 21.00 29.00 +201 27.00 21.00 23.00 29.00 +202 21.50 24.50 19.50 34.50 +203 21.50 24.50 26.50 27.50 +204 27.00 29.00 24.00 20.00 +205 19.50 21.50 22.50 36.50 +206 26.50 24.50 21.50 27.50 +207 22.50 21.50 19.50 36.50 +208 14.00 35.00 29.00 22.00 +209 16.00 23.00 12.00 49.00 +210 18.50 19.50 40.50 21.50 +211 26.00 20.00 22.00 32.00 +212 21.00 31.00 18.00 30.00 +213 24.00 15.00 31.00 30.00 +214 17.50 24.50 25.50 32.50 +215 26.00 24.00 23.00 27.00 +216 21.50 17.50 25.50 35.50 +217 26.00 29.00 17.00 28.00 +218 20.00 27.00 21.00 32.00 +219 17.00 21.00 21.00 41.00 +220 25.50 23.50 23.50 27.50 +221 21.50 23.50 20.50 34.50 +222 21.50 21.50 18.50 38.50 +223 20.00 27.00 28.00 25.00 +224 22.50 22.50 24.50 30.50 +225 14.50 35.50 30.50 19.50 +226 20.00 23.00 26.00 31.00 +227 20.50 24.50 23.50 31.50 +228 33.00 19.00 26.00 22.00 +229 22.50 24.50 18.50 34.50 +230 21.00 32.00 16.00 31.00 +231 23.00 28.00 30.00 19.00 +232 23.50 21.50 12.50 42.50 +233 21.00 27.00 25.00 27.00 +234 16.50 27.50 22.50 33.50 +235 20.00 15.00 28.00 37.00 +236 28.00 23.00 21.00 28.00 +237 20.50 19.50 22.50 37.50 +238 21.50 29.50 24.50 24.50 +239 20.00 8.00 17.00 55.00 +240 28.00 24.00 16.00 32.00 +241 22.50 22.50 16.50 38.50 +242 29.00 25.00 13.00 33.00 +243 22.50 15.50 23.50 38.50 +244 20.50 23.50 16.50 39.50 +245 28.00 23.00 19.00 30.00 +246 21.00 29.00 25.00 25.00 +247 32.00 14.00 13.00 41.00 +248 18.00 18.00 25.00 39.00 +249 25.00 23.00 21.00 31.00 +250 27.50 22.50 17.50 32.50 +251 13.50 20.50 36.50 29.50
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/samtools_stats_out2/mpc.tab Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,253 @@ +# Columns correspond to qualities, rows to cycles. First column is the cycle number, second is the number of N's and the rest is the number of mismatches +1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 +2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 +3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 +4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 +5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +23 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +31 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +34 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +36 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +37 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +42 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +43 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +44 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +46 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +47 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +48 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +51 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +52 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +54 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +55 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +56 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +57 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +58 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +59 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +62 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +63 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +65 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +66 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +67 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +68 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +69 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +70 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +71 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +73 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +74 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +76 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 +77 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +78 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +79 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +80 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +81 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +82 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +83 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +84 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +85 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +86 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +87 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +89 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +90 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +91 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +92 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +93 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +94 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +95 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +96 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +97 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +98 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +99 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +100 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +101 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +102 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +103 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +104 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +105 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +106 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +107 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +108 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 +109 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +110 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +111 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +112 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +113 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +114 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +115 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +116 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +117 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +118 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +119 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +120 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +121 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +122 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +123 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +124 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +125 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +126 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +127 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +128 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +129 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +130 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +131 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +132 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +133 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +134 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +135 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +136 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +137 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +138 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +139 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +140 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +141 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 +142 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +143 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +144 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +145 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +146 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +147 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +148 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +149 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +150 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 +151 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +152 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +153 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +154 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +155 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +156 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 3 0 +157 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 +158 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +159 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +160 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +161 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 +162 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +163 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +164 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 +165 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +166 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 +167 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +168 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 +169 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 +170 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +171 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +172 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +173 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +174 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +175 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +176 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +177 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +178 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 +179 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 +180 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +181 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +182 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +183 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +184 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +185 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +186 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +187 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +188 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +189 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +190 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +191 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +192 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +193 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +194 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +195 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +196 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +197 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +198 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +199 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +200 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +201 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +202 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +203 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +204 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +205 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +206 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +207 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +208 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +209 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +210 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +211 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +212 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +213 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +214 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +215 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +216 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +217 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +218 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +219 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +220 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +221 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +222 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +223 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +224 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +225 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +226 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +227 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +228 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +229 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +230 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +231 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +232 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 +233 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +234 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +235 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +236 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +237 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +238 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +239 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +240 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +241 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +242 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 +243 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +244 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +245 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +246 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +247 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 +248 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 2 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 2 0 0 0 3 0 0 0 +249 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 2 0 5 0 0 0 0 0 0 2 0 0 0 0 0 0 0 +250 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 2 0 0 0 2 0 0 0 +251 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 2 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 3 0 0 0 +252 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/samtools_stats_out2/sn.tab Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,33 @@ +# Summary Numbers + +raw total sequences: 200 +filtered sequences: 0 +sequences: 200 +is sorted: 1 +1st fragments: 100 +last fragments: 100 +reads mapped: 25 +reads mapped and paired: 0 # paired-end technology bit set + both mates mapped +reads unmapped: 175 +reads properly paired: 0 # proper-pair bit set +reads paired: 200 # paired-end technology bit set +reads duplicated: 0 # PCR or optical duplicate bit set +reads MQ0: 6 # mapped and MQ=0 +reads QC failed: 0 +non-primary alignments: 0 +total length: 50200 # ignores clipping +bases mapped: 6275 # ignores clipping +bases mapped (cigar): 6275 # more accurate +bases trimmed: 0 +bases duplicated: 0 +mismatches: 591 # from NM fields +error rate: 9.418327e-02 # mismatches / bases mapped (cigar) +average length: 251 +maximum length: 251 +average quality: 34.7 +insert size average: 0.0 +insert size standard deviation: 0.0 +inward oriented pairs: 0 +outward oriented pairs: 0 +pairs with other orientation: 0 +pairs on different chromosomes: 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/samtools_stats_ref.fa Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,239 @@ +>chrM +GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGG +GTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTC +CTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTA +ATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATC +ATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCA +AACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGCAC +TTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATA +CAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCCC +AAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTC +ACATCACCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAA +GCATCCCCGTTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCACGCAGC +AATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAA +ACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGA +TTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACT +CACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACAC +ACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATC +AACAAAACTGCTCGCCAGAACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATC +CCTCTAGAGGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATATA +CCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAAAGACGTTAGGTC +AAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTAT +GAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTAAGAGTAGAGTGCTTAGTTGAACAGGGCCCTGA +AGCGCGTACACACCGCCCGTCACCCTCCTCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCA +TTTATATAGAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTA +GCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACCTA +GCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTATAGGCG +ATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGATGAAAAATTATAACCAAGCATA +ATATAGCAAGGACTAACCCCTATACCTTCTGCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAGCC +AAAGCTAAGACCCCCGAAACCAGACGAGCTACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGCA +AAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTCCAAGAT +AGAATCTTAGTTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAGTC +CAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGTAAAAAATTTAACACCCATAG +TAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACCCACTACCTAAAAAATCCCAAAC +ATATAACTGAACTCCTCACACCCAATTGGACCAATCTATCACCCTATAGAAGAACTAATGTTAGTATAAG +TAACATGAAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTAAAACACTGAACTGACAATTAACAGCCC +AATATCTACAATCAACCAACAAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGA +AAGGTTAAAAAAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTACCAAAAACATCACCTCTAGC +ATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAA +AGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCCACGAGGGTTCAGCTGTCTCT +TACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGGCGGGCATAACACAGCAAGACGAGAAGACCCTA +TGGAGCTTTAATTTATTAATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATT +AAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAG +TCAAAGCGAACTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACA +GCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCCG +ATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGG +AGTAATCCAGGTCGGTTTCTATCTACNTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCT +ACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAAGA +ACAGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAAT +TCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCA +TTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCC +CCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCAC +ATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCC +CTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAG +CCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGC +AGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGC +TCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGG +CCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTC +CGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCCGAATAC +ACAAACATTATTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCC +CTGAACTCTACACAACATATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAAC +AGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTA +GCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTAAGAAATAT +GTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTAGGACTATGA +GAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAAGTAAGGTC +AGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCT +GGCCCAACCCGTCATCTACTCTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTT +TTTACCTGAGTAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCCTC +GTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCTTCTAATAGCTAT +CCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATACTACCAATCAATACTCATCATTAATA +ATCATAATAGCTATAGCAATAAAACTAGGAATAGCCCCCTTTCACTTCTGAGTCCCAGAGGTTACCCAAG +GCACCCCTCTGACATCCGGCCTGCTTCTTCTCACATGACAAAAACTAGCCCCCATCTCAATCATATACCA +AATCTCTCCCTCACTAAACGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGA +GGTGGATTAAACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGATGAATAA +TAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTATCCTAACTACTAC +CGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACCCTACTACTATCTCGCACCTGAAACAAGCTA +ACATGACTAACACCCTTAATTCCATCCACCCTCCTCTCCCTAGGAGGCCTGCCCCCGCTAACCGGCTTTT +TGCCCAAATGGGCCATTATCGAAGAATTCACAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCAC +CATCACCCTCCTTAACCTCTACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATA +TCTAACAACGTAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCCACACTCATCG +CCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTATAGAAATTTAGGTTAAATAC +AGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGTAACAGCTAAGGACTGCAAAA +CCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTACTAGACCAATGGGA +CTTAAACCCACAAACACTTAGTTAACAGCTAAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCC +GCCGGGAAAAAAGGCGGGAGAAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGA +AAATCACCTCGGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCACTCA +GCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGG +AACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTCTAAGCCTCCTTATTCGAGCC +GAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCCATGCAT +TTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAAT +AATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTC +CTACTCCTGCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAG +CAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTC +CTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAAACCCCCTGCCATAACCCAATAC +CAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAGTCCTAG +CTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGG +AGACCCCATTCTATACCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCA +GGCTTCGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGTA +TGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGG +AATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAA +GTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAG +GATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGT +ACTACACGACACGTACTACGTTGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATC +ATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCC +ATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCCTATCCGGAAT +GCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACATCCTATCATCTGTAGGCTCATTC +ATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCC +TAATAGTAGAAGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGA +AGAACCCGTATACATAAAATCTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAA +CCCCATGGCCTCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAAT +TATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCT +ATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCC +TGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTCAGGAAATAGA +AACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTAC +ATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACG +AGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCGA +CCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATAATTACA +TCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGTC +TAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTGTGGAGC +AAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTT +ACCCTATAGCACCCCCTCTACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTT +AAAGATTAAGAGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACCAT +AATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTA +CCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAGAACCAAAATGAACGAAAATCT +GTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCCGCCGCAGTACTGATCATTCTATTTCCCCCT +CTATTGATCCCCACCTCCAAATATCTCATCAACAACCGACTAATCACCACCCAACAATGACTAATCAAAC +TAACCTCAAAACAAATGATAACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTT +AATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTA +TCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTATAGGCTTTCGCTCTAAGATTA +AAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAGTTATTATCGA +AACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCCAC +CTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCA +TCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCAC +ACTTCTAGTAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGTAA +AACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGATT +TCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACACTAACCATATACCAATGATGG +CGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACG +GGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAG +CCTAGCCCCTACCCCCCAATTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAA +GTCCCACTCCTAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCTAA +TAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCTATTTTACCCT +CCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGGCATCTACGGCTCAACATTTTTT +GTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCTCAACTTTCCTCACTATCTGCTTCATCCGCC +AACTAATATTTCACTTTACATCCAAACATCACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGT +AGATGTGGTTTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGT +ACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAATTTTAA +TAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGGCTACAT +AGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCCCGCGTCCCTTTCTCCATAAAA +TTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCTAGAAATTGCCCTCCTTTTACCCCTACCATGAG +CCCTACAAACAACTAACCTGCCACTAATAGTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAG +TCTGGCCTATGAGTGACTACAAAAAGGATTAGACTGAACCGAATTGGTATATAGTTTAAACAAAACGAAT +GATTTCGACTCATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAATATTATACTAG +CATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTACTATGCCTAGA +AGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCCCTCTTAGCCAAT +ATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAGTCTCAA +TCTCCAACACATATGGCCTAGACTACGTACATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCA +ACAATTATATTACTACCACTGACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACA +GCCTAATTATTAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCCCC +AACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTACCCCTCACAATC +ATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAACTCTACCTCTCTATACTAATCT +CCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGAACTAATCATATTTTATATCTTCTTCGAAAC +CACACTTATCCCCACCTTGGCTATCATCACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACA +TACTTCCTATTCTACACCCTAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCC +TAGGCTCACTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAACTT +AATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCACTTATGACTCCCT +AAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACTTGCCGCAGTACTCTTAAAACTAGGCGGCT +ATGGTATAATACGCCTCACACTCATTCTCAACCCCCTGACAAAACACATAGCCTACCCCTTCCTTGTACT +ATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCA +TACTCTTCAATCAGCCACATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCG +GCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTA +CGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTT +TGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTG +TGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGC +CCTATACTCCCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAA +CCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACC +CCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAA +CAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCCCCCATGTCTAAC +AACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGCCCCAAAAATTTTGGTGCA +ACTCCAAATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGACTTCCCTAATTCCCCCC +ATCCTTACCACCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCAT +CCACCTTTATTATCAGTCTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAA +CTGACACTGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAATA +TTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATATAAACTCAGACC +CAAACATTAATCAGTTCTTCAAATATCTACTCATCTTCCTAATTACCATACTAATCTTAGTTACCGCTAA +CAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCATCAGTTGATGA +TACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCAATCCTATACAACCGTATCGGCGATATCGGTT +TCATCCTCGCCTTAGCATGATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAA +CGCTAATCCAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGT +CTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTA +TAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAAAATAGCCCACTAATCCAAAC +TCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGCAGCAGTCTGCGCCCTTACACAAAATGACATC +AAAAAAATCGTAGCCTTCTCCACTTCAAGTCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAAC +CACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGGTC +CATCATCCACAACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTC +ACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGGTTTCTACTCCA +AAGACCACATCATCGAAACCGCAAACATATCATACACAAACGCCTGAGCCCTATCTATTACTCTCATCGC +TACCTCCCTGACAAGCGCCTATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGCTTCCCC +ACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCC +TATTCGCAGGATTTCTCATTACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTA +CCTAAAACTCACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAACTACCTAACC +AACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACATACTCGGATTCTACCCTAGCA +TCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAGCCAAAACCTGCCCCTACTCCTCCTAGACCT +AACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAGCACCAAATCTCCACCTCCATCATCACCTCA +ACCCAAAAAGGCATAATTAAACTTTACTTCCTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAA +TCACATAACCTATTCCCCCGAGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAA +CTACTACTAATCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCTGA +CCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCACCCCATCATAC +TCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAACACTCACCAAGACCTCAACCC +CTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATCGCTGTAGTATATCCAAAGACAACCATCATTCC +CCCTAAATAAATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAATAACACACCCG +ACCACACCGCTAACAATCAATACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACC +CCATTACTAAACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGAC +CAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGACCCCAATACGCAAAACTAAC +CCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAA +ACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATGCACTA +CTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATC +ATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCC +TATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAGC +AACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAAC +TTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAGTAGACA +GTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTGCCCTTCATTATTGCAGCCCTAGCAACACT +CCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATC +ACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACAT +TAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCC +TCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCCTAACAAACTA +GGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATATCCAAAC +AACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCT +AACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATAC +TTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTC +CTTGTAGTATAAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGGACAAATCAGA +GAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATTCTCTGTTCTTTC +ATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACA +TTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCA +ATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCA +ACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAG +TACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC +TCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCG +CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTC +ATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/fasta_indexes.loc.sample Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#hg18canon hg18 Human (Homo sapiens): hg18 Canonical /depot/data2/galaxy/hg18/sam/hg18canon.fa +#hg18full hg18 Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,7 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/fasta_indexes.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Wed Apr 22 10:29:35 2015 -0400 @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="samtools" version="1.2"> + <repository changeset_revision="6eea04363026" name="package_samtools_1_2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>