# HG changeset patch
# User devteam
# Date 1400517257 14400
# Node ID f17a1585733b0e335be90e825d93c7e93d0f7007

Imported from capsule None

diff -r 000000000000 -r f17a1585733b short_reads_trim_seq.py
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/short_reads_trim_seq.py	Mon May 19 12:34:17 2014 -0400
@@ -0,0 +1,234 @@
+#!/usr/bin/env python
+"""
+trim reads based on the quality scores
+input: read file and quality score file
+output: trimmed read file
+"""
+
+import os, sys, math, tempfile, re
+
+assert sys.version_info[:2] >= ( 2, 4 )
+
+def stop_err( msg ):
+    sys.stderr.write( "%s\n" % msg )
+    sys.exit()
+
+def append_to_outfile( outfile_name, seq_title, segments ):
+    segments = segments.split( ',' )
+    if len( segments ) > 1:
+        outfile = open( outfile_name, 'a' )
+        for i in range( len( segments ) ):
+            outfile.write( "%s_%d\n%s\n" % ( seq_title, i, segments[i] ) )
+        outfile.close()
+    elif segments[0]:
+        outfile = open( outfile_name, 'a' )
+        outfile.write( "%s\n%s\n" % ( seq_title, segments[0] ) )
+        outfile.close()
+
+def trim_seq( seq, score, arg, trim_score, threshold ):
+    seq_method = '454'
+    trim_pos = 0
+    # trim after a certain position
+    if arg.isdigit():
+        keep_homopolymers = False
+        trim_pos = int( arg )    
+        if trim_pos > 0 and trim_pos < len( seq ):
+            seq = seq[0:trim_pos]
+    else:
+        keep_homopolymers = arg=='yes'
+        
+    new_trim_seq = ''
+    max_segment = 0
+
+    for i in range( len( seq ) ):
+        if i >= len( score ):
+            score.append(-1)   
+        if int( score[i] ) >= trim_score:
+            pass_nuc = seq[ i:( i + 1 ) ]
+        else:
+            if keep_homopolymers and ( (i == 0 ) or ( seq[ i:( i + 1 ) ].lower() == seq[ ( i - 1 ):i ].lower() ) ):
+                pass_nuc = seq[ i:( i + 1 ) ]
+            else:
+                pass_nuc = ' '    
+        new_trim_seq = '%s%s' % ( new_trim_seq, pass_nuc )
+        # find the max substrings
+        segments = new_trim_seq.split()
+        max_segment = ''
+        len_max_segment = 0
+        if threshold == 0:
+            for seg in segments:
+                if len_max_segment < len( seg ):
+                    max_segment = '%s,' % seg
+                    len_max_segment = len( seg )
+                elif len_max_segment == len( seg ):
+                    max_segment = '%s%s,' % ( max_segment, seg )
+        else:
+            for seg in segments:
+                if len( seg ) >= threshold:
+                    max_segment = '%s%s,' % ( max_segment, seg )
+    return max_segment[ 0:-1 ]
+
+def __main__():
+    
+    try:
+        threshold_trim = int( sys.argv[1].strip() )
+    except:
+        stop_err( "Minimal quality score must be numeric." )
+    try:
+        threshold_report = int( sys.argv[2].strip() )
+    except:
+        stop_err( "Minimal length of trimmed reads must be numeric." )
+    outfile_seq_name = sys.argv[3].strip()
+    infile_seq_name = sys.argv[4].strip()
+    infile_score_name = sys.argv[5].strip()
+    arg = sys.argv[6].strip()
+
+    seq_infile_name = infile_seq_name
+    score_infile_name = infile_score_name
+    
+
+    # Determine quailty score format: tabular or fasta format within the first 100 lines
+    seq_method = None
+    data_type = None
+    for i, line in enumerate( file( score_infile_name ) ):
+        line = line.rstrip( '\r\n' )
+        if not line or line.startswith( '#' ):
+            continue
+        if data_type == None:
+            if line.startswith( '>' ):
+                data_type = 'fasta'
+                continue
+            elif len( line.split( '\t' ) ) > 0:
+                fields = line.split()
+                for score in fields:
+                    try:
+                        int( score )
+                        data_type = 'tabular'
+                        seq_method = 'solexa'
+                        break
+                    except:
+                        break
+        elif data_type == 'fasta':
+            fields = line.split()
+            for score in fields:
+                try: 
+                    int( score )
+                    seq_method = '454'
+                    break
+                except:
+                    break
+        if i == 100:
+            break
+
+    if data_type is None:
+        stop_err( 'This tool can only use fasta data or tabular data.' ) 
+    if seq_method is None:
+        stop_err( 'Invalid data for fasta format.')
+    
+    if os.path.exists( seq_infile_name ) and os.path.exists( score_infile_name ):
+        seq = None
+        score = None
+        score_found = False
+        
+        score_file = open( score_infile_name, 'r' )
+
+        for i, line in enumerate( open( seq_infile_name ) ):
+            line = line.rstrip( '\r\n' )
+            if not line or line.startswith( '#' ):
+                continue
+            if line.startswith( '>' ):
+                if seq:
+                    scores = []
+                    if data_type == 'fasta':
+                        score = None
+                        score_found = False
+                        score_line = 'start'
+                        while not score_found and score_line:
+                            score_line = score_file.readline().rstrip( '\r\n' )
+                            if not score_line or score_line.startswith( '#' ):
+                                continue
+                            if score_line.startswith( '>' ):
+                                if score:
+                                    scores = score.split()
+                                    score_found = True    
+                                score = None
+                            else:
+                                for val in score_line.split():
+                                    try:
+                                        int( val ) 
+                                    except:
+                                        score_file.close()
+                                        stop_err( "Non-numerical value '%s' in score file." % val )
+                                if not score:
+                                    score = score_line
+                                else:
+                                    score = '%s %s' % ( score, score_line )                                        
+                    elif data_type == 'tabular':
+                        score = score_file.readline().rstrip('\r\n')
+                        loc = score.split( '\t' )
+                        for base in loc:
+                            nuc_error = base.split()
+                            try:
+                                nuc_error[0] = int( nuc_error[0] )
+                                nuc_error[1] = int( nuc_error[1] )
+                                nuc_error[2] = int( nuc_error[2] )
+                                nuc_error[3] = int( nuc_error[3] )
+                                big = max( nuc_error )
+                            except:
+                                score_file.close()
+                                stop_err( "Invalid characters in line %d: '%s'" % ( i, line ) )
+                            scores.append( big )
+                    if scores:
+                        new_trim_seq_segments = trim_seq( seq, scores, arg, threshold_trim, threshold_report )
+                        append_to_outfile( outfile_seq_name, seq_title, new_trim_seq_segments )  
+                                
+                seq_title = line
+                seq = None
+            else:
+                if not seq:
+                    seq = line
+                else:
+                    seq = "%s%s" % ( seq, line )
+        if seq:
+            scores = []
+            if data_type == 'fasta':
+                score = None
+                while score_line:
+                    score_line = score_file.readline().rstrip( '\r\n' )
+                    if not score_line or score_line.startswith( '#' ) or score_line.startswith( '>' ):
+                        continue
+                    for val in score_line.split():
+                        try:
+                            int( val )
+                        except:
+                            score_file.close()
+                            stop_err( "Non-numerical value '%s' in score file." % val )
+                    if not score:
+                        score = score_line
+                    else:
+                        score = "%s %s" % ( score, score_line ) 
+                if score: 
+                    scores = score.split()
+            elif data_type == 'tabular':
+                score = score_file.readline().rstrip('\r\n')
+                loc = score.split( '\t' )
+                for base in loc:
+                    nuc_error = base.split()
+                    try:
+                        nuc_error[0] = int( nuc_error[0] )
+                        nuc_error[1] = int( nuc_error[1] )
+                        nuc_error[2] = int( nuc_error[2] )
+                        nuc_error[3] = int( nuc_error[3] )
+                        big = max( nuc_error )
+                    except:
+                        score_file.close()
+                        stop_err( "Invalid characters in line %d: '%s'" % ( i, line ) )
+                    scores.append( big )
+            if scores:
+                new_trim_seq_segments = trim_seq( seq, scores, arg, threshold_trim, threshold_report )
+                append_to_outfile( outfile_seq_name, seq_title, new_trim_seq_segments )  
+        score_file.close()
+    else:
+        stop_err( "Cannot locate sequence file '%s'or score file '%s'." % ( seq_infile_name, score_infile_name ) )    
+
+if __name__ == "__main__": __main__()
diff -r 000000000000 -r f17a1585733b short_reads_trim_seq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/short_reads_trim_seq.xml	Mon May 19 12:34:17 2014 -0400
@@ -0,0 +1,93 @@
+<tool id="trim_reads" name="Select high quality segments" version="1.0.0">
+<description></description>
+
+<command interpreter="python">
+ short_reads_trim_seq.py $trim $length $output1 $input1 $input2 $sequencing_method_choice.input3
+</command>
+<inputs>
+<page>
+    <param name="input1" type="data" format="fasta" label="Reads" />
+    <param name="input2" type="data" format="qualsolexa,qual454" label="Quality scores" />
+	<param name="trim" type="integer" size="5" value="20" label="Minimal quality score" help="bases scoring below this value will trigger splitting"/>
+    <param name="length" type="integer" size="5" value="100" label="Minimal length of contiguous segment" help="report all high quality segments above this length. Setting this option to '0' will cause the program to return a single longest run of high quality bases per read" />
+    <conditional name="sequencing_method_choice">
+        <param name="sequencer" type="select" label="Select technology">
+            <option value="454">Roche (454) or ABI SOLiD</option>
+            <option value="Solexa">Illumina (Solexa)</option>
+        </param>
+        <when value="454">
+            <param name="input3" type="select" label="Low quality bases in homopolymers" help="if set to 'DO NOT trigger splitting' the program will not count low quality bases that are within or adjacent to homonucleotide runs.  This will significantly reduce fragmentation of 454 data">
+                <option value="yes">DO NOT trigger splitting </option>
+                <option value="no">trigger splitting</option>
+            </param>
+        </when>
+        <when value="Solexa">
+            <param name="input3" type="integer" size="5" value="0" label="Restrict length of each read to" help="('0' = do not trim) The quality of Solexa reads drops towards the end. This option allows selecting the specified number of nucleotides from the beginning and then running the tool." />
+        </when> 
+    </conditional>
+</page>
+</inputs>
+
+<outputs>
+    <data name="output1" format="fasta" />
+</outputs>
+
+<tests>
+	<test>
+		<param name="sequencer" value="454" />
+		<param name="input1" value="454.fasta" ftype="fasta" />
+		<param name="input2" value="454.qual" ftype="qual454" />
+		<param name="input3" value="no" />
+		<param name="trim" value="20" />
+		<param name="length" value="0" />
+		<output name="output1" file="short_reads_trim_seq_out1.fasta" />
+	</test>
+	<test>
+		<param name="sequencer" value="Solexa" />
+		<param name="input1" value="solexa.fasta" ftype="fasta" />
+		<param name="input2" value="solexa.qual" ftype="qualsolexa" />
+		<param name="input3" value="0" />
+		<param name="trim" value="20" />
+		<param name="length" value="0" />
+		<output name="output1" file="short_reads_trim_seq_out2.fasta" />
+	</test>
+</tests>
+
+<help>
+  
+.. class:: warningmark
+
+To use this tool, your dataset needs to be in the *Quality Score* format. Click the pencil icon next to your dataset to set the datatype to *Quality Score* (see below for examples).
+ 
+-----
+
+**What it does**
+
+This tool finds high quality segments within sequencing reads generated by by Roche (454), Illumina (Solexa), or ABI SOLiD machines.
+
+-----
+
+**Example**
+
+
+Suppose this is your sequencing read::
+  
+   5'---------*-------------*------**----3'
+   
+where **dashes** (-) are HIGH quality bases (above 20) and **asterisks** (*) are LOW quality bases (below 20). If the **Minimal length of contiguous segment** is set to **5** (of course, only for the purposes of this example), the tool will return::
+
+   5'---------
+               -------------
+                             -------
+
+you can see that the tool simply splits the read on low quality bases and then returns all segments longer than 5.  **Note**, that the output of this tool will likely contain higher number of shorter sequences compared to the original input.   If we set the **Minimal length of contiguous segment** to **0**, the tool will only return the single longest segment::
+
+               -------------
+               
+
+               
+
+
+
+</help>
+</tool>
diff -r 000000000000 -r f17a1585733b test-data/454.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/454.fasta	Mon May 19 12:34:17 2014 -0400
@@ -0,0 +1,52 @@
+>EYKX4VC01B65GS length=54 xy=0784_1754 region=1 run=R_2007_11_07_16_15_57_
+CCGGTATCCGGGTGCCGTGATGAGCGCCACCGGAACGAATTCGACTATGCCGAA
+>EYKX4VC01BNCSP length=187 xy=0558_3831 region=1 run=R_2007_11_07_16_15_57_
+CTTACCGGTCACCACCGTGCCTTCAGGATTGATCGCCAGATCGGTCGGTGCGTCAGGCGG
+GGTGACATCGCCCACCACGGTACTCACTGGCTGGCTCTGGTTCCCGGCGGCATCGGAGGC
+CACCACGTTGAGGGTATTCCCCTCGGTTTGTGGCTCGGTGAGAACCACGTTGTAGTCGCC
+ATTGGTC
+>EYKX4VC01CD9FT length=115 xy=0865_1719 region=1 run=R_2007_11_07_16_15_57_
+GGGGGCTTTGGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGCGGCTGGCGATC
+ATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACCACCCGCACCCAACGCG
+>EYKX4VC01B8FW0 length=95 xy=0799_0514 region=1 run=R_2007_11_07_16_15_57_
+TAAATTTCAAGGAATGCAAATCAGGGTCGTGTGTTTAGACTTCGGCTTTAGAGACCTGAA
+TACGTCAAAAACATAACTTCATGATATCTTGCAGT
+>EYKX4VC01BCGYW length=115 xy=0434_3926 region=1 run=R_2007_11_07_16_15_57_
+GGCCAGCCGGGACAGCGTTGTTGGGCTGCATGGCGACGAGCTAAAAGTCGCCATCACCGC
+CCCGCCGGTTGATGGGCAGGCTAATGCCCATCTGGTAAAAACTTTCTCGCCAAAC
+>EYKX4VC01AZXC6 length=116 xy=0292_0280 region=1 run=R_2007_11_07_16_15_57_
+GGGGGCGTTTGGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGCGGCTGGCGAT
+CATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACCACCCGCACCCAACGCG
+>EYKX4VC01CATH5 length=82 xy=0826_0843 region=1 run=R_2007_11_07_16_15_57_
+CGAAATTGCACATTCTCGGCCATATCTCTGGACCTACATGACCGATTTGATCATCTTCGA
+ACTTAGCCTTCCTTTNTTAACG
+>EYKX4VC01BCEIV length=47 xy=0434_0757 region=1 run=R_2007_11_07_16_15_57_
+TGACGTCGTGCCGAGCTACGACAATGCCGACATGGTGATCGTTAACA
+>EYKX4VC01BWERM length=83 xy=0662_0304 region=1 run=R_2007_11_07_16_15_57_
+CGGTCGGCCTCACCATGGAGAAGATCCCGCCCCGGCCGAGGTCATGGTGGATCTCGGCCA
+GGGCGTGCTGATGAAGTTCAAAT
+>EYKX4VC01BT2O7 length=69 xy=0635_1945 region=1 run=R_2007_11_07_16_15_57_
+AGCGTTTCTCCAGCCGGTCGGCTACGCCGTTTGCCCCTGAAAGACGCTGTTCAGACCGAA
+CGCGGTAAA
+>EYKX4VC01BO0UO length=222 xy=0577_3838 region=1 run=R_2007_11_07_16_15_57_
+AGACCTGGGACAGCGGCGGGCTGCTGAAGCCGCAGGCGATAGAGGACAAACTGCAGTACC
+GCTTCTGGCTGCACTATGCCGAAGGCTCGCTGATGCCGCTGCTGTTAATGAAGCTGGTGT
+TCGCCAGCCTGGGTAAACCCCCTGTGCCCTTTGGCGTCCGCTCGCTGGGCGCCCTGCTGG
+GCAAGGGCATTCAGAAAGCGTGGCTGGATCCCCAGCTGGCCA
+>EYKX4VC01CBCPK length=83 xy=0832_1158 region=1 run=R_2007_11_07_16_15_57_
+CGGTCGGCCTCACCATGGAGAAGATCCCGCCCCGGCCGAGGTCATGGTGGATCTCGGCCA
+GGGCGTGCTGATGAAGTTCAAAT
+>EYKX4VC01B474S length=54 xy=0762_2010 region=1 run=R_2007_11_07_16_15_57_
+AGCAGTTTTCCAGCGCTTTCGAAGAGCGCTGGCGCGCGCGGGCTTCCAGCATAT
+>EYKX4VC01BB4QL length=57 xy=0431_0363 region=1 run=R_2007_11_07_16_15_57_
+GGGGAGGAGCTAATAATATGCTCTTGGGGAGGAGCTAATTATATGCTCTTGGGGAGG
+>EYKX4VC01BJ37M length=64 xy=0522_0192 region=1 run=R_2007_11_07_16_15_57_
+TCGAGTATGTATCAAGGACTACATACAAATTTGCCAAAAGAGATTATGCACTATCCCGAC
+TTCC
+>EYKX4VC01BV9R8 length=54 xy=0660_2038 region=1 run=R_2007_11_07_16_15_57_
+AAAACTCGGAGAAACTATTCAGCAGCACTGCGTTTCGCTGAATTTTAGACCGTT
+>EYKX4VC01CEPP8 length=60 xy=0870_2350 region=1 run=R_2007_11_07_16_15_57_
+CTGGGTGGGTGCACTACAGGAACGTCATTTGTTCAATCCTCACGTTGTTGTTAGTGTCAG
+>EYKX4VC01BTLME length=78 xy=0630_0292 region=1 run=R_2007_11_07_16_15_57_
+TTATCCACACGCTGTCCGGATCCAGCGCCAGGCGCCGACGCTGGACTTCCGCCGCCTGCG
+CCCAGTTGCCCTGACTTC
diff -r 000000000000 -r f17a1585733b test-data/454.qual
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/454.qual	Mon May 19 12:34:17 2014 -0400
@@ -0,0 +1,52 @@
+>EYKX4VC01B65GS length=54 xy=0784_1754 region=1 run=R_2007_11_07_16_15_57_
+33 23 34 25 28 28 28 32 23 34 27 4 28 28 31 21 28 27 27 28 28 28 28 28 28 28 33 23 28 33 24 36 27 31 21 28 28 33 26 33 24 27 28 28 28 28 28 28 28 32 23 28 34 25
+>EYKX4VC01BNCSP length=187 xy=0558_3831 region=1 run=R_2007_11_07_16_15_57_
+27 35 26 25 37 28 37 28 25 28 27 36 27 28 36 27 28 28 27 36 27 30 19 27 28 36 28 23 36 27 27 28 27 27 28 37 29 27 26 27 24 24 36 27 26 28 36 28 24 25 21 28 24 28 26 34 25 26 43 36
+22 9 23 19 28 28 28 28 26 28 39 32 12 27 36 28 28 26 37 28 28 26 28 28 28 27 28 26 36 27 27 27 36 28 27 27 28 28 36 27 36 28 39 32 12 35 28 26 37 29 28 28 28 28 37 29 28 36 28 35
+26 27 37 29 28 26 28 36 28 26 24 38 32 11 28 26 32 24 36 32 18 2 27 25 33 26 32 28 6 18 22 26 17 15 14 28 20 8 22 21 14 22 26 16 26 16 28 20 22 27 18 27 18 27 28 27 20 25 34 27
+27 33 25 34 28 8 26
+>EYKX4VC01CD9FT length=115 xy=0865_1719 region=1 run=R_2007_11_07_16_15_57_
+35 24 16 9 2 27 39 33 13 36 27 36 27 28 28 28 27 28 28 33 23 37 28 28 28 36 27 28 28 28 28 36 27 28 28 28 27 28 28 28 28 28 28 28 37 28 28 28 28 37 28 26 28 36 27 28 28 28 28 28
+28 28 28 37 28 28 35 26 27 28 28 27 36 27 35 25 32 22 28 28 28 28 28 28 28 28 28 34 25 36 27 34 25 28 27 28 28 36 27 28 35 29 6 28 28 28 37 30 8 33 24 28 27 27 27
+>EYKX4VC01B8FW0 length=95 xy=0799_0514 region=1 run=R_2007_11_07_16_15_57_
+28 40 34 15 35 28 6 27 33 23 34 24 32 22 28 28 28 41 34 17 28 28 28 37 30 9 28 28 28 28 28 27 28 37 30 8 28 28 27 28 35 26 27 35 26 28 37 30 9 28 27 28 28 28 34 25 28 28 32 22
+26 28 28 28 28 27 43 36 23 12 1 28 21 28 27 16 28 32 23 27 28 27 28 28 27 28 28 28 32 22 28 26 26 27 28
+>EYKX4VC01BCGYW length=115 xy=0434_3926 region=1 run=R_2007_11_07_16_15_57_
+28 6 26 15 27 28 37 28 41 35 17 28 21 28 23 21 27 36 27 24 36 28 40 34 14 22 25 28 24 27 28 37 28 26 28 27 27 28 28 28 28 27 43 36 22 8 28 26 28 27 26 14 28 25 20 28 34 24 25 40
+33 18 1 19 27 16 36 28 36 28 21 27 25 41 34 16 22 28 37 29 26 26 35 27 28 26 41 34 16 28 28 27 28 37 29 25 43 36 23 12 1 11 39 32 12 28 17 20 28 28 17 36 29 7 24
+>EYKX4VC01AZXC6 length=116 xy=0292_0280 region=1 run=R_2007_11_07_16_15_57_
+35 24 17 11 5 26 24 40 33 14 34 25 33 24 28 27 27 26 28 28 33 24 36 27 28 27 36 27 27 28 27 28 35 26 27 27 28 27 28 28 28 28 28 27 28 36 27 28 28 28 37 28 27 26 35 26 27 28 28 28
+27 28 28 28 37 29 28 35 26 28 27 28 28 35 26 35 26 31 21 28 28 28 28 28 28 28 28 28 34 25 35 26 35 26 28 28 28 28 37 28 27 37 30 9 28 28 28 37 30 9 33 23 28 28 28 27
+>EYKX4VC01CATH5 length=82 xy=0826_0843 region=1 run=R_2007_11_07_16_15_57_
+28 28 41 35 17 33 24 28 27 28 28 28 36 27 28 28 28 36 27 34 25 27 28 28 28 28 28 28 28 37 28 27 35 25 28 26 28 27 28 28 24 36 27 26 26 37 30 9 28 28 28 28 28 25 25 35 26 26 27 35
+25 28 36 28 28 28 31 21 25 13 32 22 41 34 17 0 22 10 32 23 24 28
+>EYKX4VC01BCEIV length=47 xy=0434_0757 region=1 run=R_2007_11_07_16_15_57_
+28 28 26 26 28 26 28 27 28 25 32 22 27 26 25 27 28 28 27 26 27 28 32 23 28 28 34 25 27 22 26 26 27 28 17 28 28 28 28 28 28 34 24 35 25 28 28
+>EYKX4VC01BWERM length=83 xy=0662_0304 region=1 run=R_2007_11_07_16_15_57_
+28 36 27 28 28 35 26 34 24 28 28 28 32 22 28 28 32 23 28 28 32 23 27 28 27 34 27 3 27 43 36 22 9 35 26 37 29 26 27 32 23 28 28 27 28 36 27 28 36 27 28 28 28 28 28 35 26 34 25 28
+36 30 8 28 28 28 28 27 27 28 28 28 28 37 28 28 36 27 28 39 33 13 27
+>EYKX4VC01BT2O7 length=69 xy=0635_1945 region=1 run=R_2007_11_07_16_15_57_
+28 28 28 28 41 34 17 27 28 31 21 28 27 32 23 36 27 28 28 33 24 28 27 28 28 27 32 22 28 34 27 3 27 43 36 22 8 27 28 34 27 3 28 28 28 28 28 28 28 33 23 28 28 28 28 34 24 28 34 24
+28 28 27 36 27 28 37 30 9
+>EYKX4VC01BO0UO length=222 xy=0577_3838 region=1 run=R_2007_11_07_16_15_57_
+27 27 28 36 27 28 39 33 13 28 28 28 27 28 37 28 28 41 35 17 28 28 28 27 28 26 36 27 28 36 27 27 28 27 35 26 27 26 28 28 28 28 28 36 27 28 28 38 31 10 24 27 27 27 27 27 28 28 37 28
+27 28 35 26 28 28 36 27 28 28 27 28 28 28 28 28 28 27 36 28 27 36 27 37 28 27 28 27 28 28 28 27 28 28 27 36 27 26 27 28 28 28 28 28 37 28 37 29 25 28 36 27 28 27 28 34 27 26 24 34
+28 28 28 31 23 27 28 34 27 28 37 33 14 23 37 33 15 38 34 23 13 2 26 24 28 26 35 31 12 36 32 14 31 22 24 28 27 33 26 26 27 27 27 27 28 27 35 30 11 26 27 35 31 12 28 27 26 27 36 32
+14 27 34 27 37 33 15 27 27 34 28 27 23 27 35 31 11 27 28 28 26 34 26 27 28 34 28 28 28 39 35 22 9 27 27 23 27 35 28 34 27 27
+>EYKX4VC01CBCPK length=83 xy=0832_1158 region=1 run=R_2007_11_07_16_15_57_
+28 35 26 28 28 35 26 35 26 28 28 28 34 24 28 28 35 25 28 28 34 25 28 28 27 35 28 5 28 43 36 22 9 35 26 37 28 28 27 32 23 27 28 28 28 36 27 28 36 27 28 28 28 28 28 36 27 35 25 28
+37 30 9 28 28 28 28 28 28 28 28 28 28 36 27 28 35 26 28 38 31 10 28
+>EYKX4VC01B474S length=54 xy=0762_2010 region=1 run=R_2007_11_07_16_15_57_
+28 28 28 28 27 43 36 23 11 33 23 27 25 26 28 28 39 33 13 28 27 29 18 28 26 27 26 28 27 28 36 27 26 28 28 28 28 25 28 41 34 17 24 36 28 37 28 28 26 28 17 27 28 26
+>EYKX4VC01BB4QL length=57 xy=0431_0363 region=1 run=R_2007_11_07_16_15_57_
+36 24 15 7 28 33 26 28 27 27 26 29 18 28 35 26 28 26 28 25 27 27 28 36 27 41 34 20 5 27 36 28 28 28 27 28 32 22 34 25 28 28 28 28 26 28 27 28 36 27 40 34 18 3 28 37 28
+>EYKX4VC01BJ37M length=64 xy=0522_0192 region=1 run=R_2007_11_07_16_15_57_
+28 26 28 28 28 28 28 28 27 28 28 27 27 36 27 37 28 28 28 28 28 28 28 28 28 27 36 29 8 39 33 13 28 36 27 41 34 20 5 28 28 28 27 36 28 28 28 28 27 28 28 28 28 27 37 30 8 27 28 26
+33 26 35 26
+>EYKX4VC01BV9R8 length=54 xy=0660_2038 region=1 run=R_2007_11_07_16_15_57_
+41 34 19 4 27 28 28 30 20 28 28 34 27 4 28 28 27 34 25 27 28 28 28 28 28 28 28 28 28 28 28 28 38 31 11 27 28 28 28 28 37 28 40 33 18 2 24 15 25 24 12 26 34 27
+>EYKX4VC01CEPP8 length=60 xy=0870_2350 region=1 run=R_2007_11_07_16_15_57_
+26 21 40 34 17 26 36 29 8 26 28 22 26 28 28 20 24 28 34 26 23 11 28 28 26 27 26 40 33 14 27 35 26 26 23 10 28 31 21 28 23 27 23 28 36 27 26 36 28 27 36 28 28 27 25 27 27 27 26 28
+>EYKX4VC01BTLME length=78 xy=0630_0292 region=1 run=R_2007_11_07_16_15_57_
+36 27 25 24 33 23 28 26 28 28 28 28 27 27 26 36 27 36 28 28 28 36 27 28 28 27 27 36 28 28 37 29 28 26 36 27 27 28 27 27 28 27 36 28 28 28 36 27 36 27 28 36 28 25 36 28 28 28 27 28
+39 33 13 28 28 37 28 28 41 34 16 28 28 28 26 36 28 24
diff -r 000000000000 -r f17a1585733b test-data/short_reads_trim_seq_out1.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/short_reads_trim_seq_out1.fasta	Mon May 19 12:34:17 2014 -0400
@@ -0,0 +1,36 @@
+>EYKX4VC01B65GS length=54 xy=0784_1754 region=1 run=R_2007_11_07_16_15_57_
+TGCCGTGATGAGCGCCACCGGAACGAATTCGACTATGCCGAA
+>EYKX4VC01BNCSP length=187 xy=0558_3831 region=1 run=R_2007_11_07_16_15_57_
+CAGGATTGATCGCCAGATCGGTCGGTGCGTCAGGCGGG
+>EYKX4VC01CD9FT length=115 xy=0865_1719 region=1 run=R_2007_11_07_16_15_57_
+GGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGCGGCTGGCGATCATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACCACC
+>EYKX4VC01B8FW0 length=95 xy=0799_0514 region=1 run=R_2007_11_07_16_15_57_
+AGAGACCTGAATACGTCAAA
+>EYKX4VC01BCGYW length=115 xy=0434_3926 region=1 run=R_2007_11_07_16_15_57_
+CTGCATGGCGACGAGCTAAA
+>EYKX4VC01AZXC6 length=116 xy=0292_0280 region=1 run=R_2007_11_07_16_15_57_
+GGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGCGGCTGGCGATCATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACCACC
+>EYKX4VC01CATH5 length=82 xy=0826_0843 region=1 run=R_2007_11_07_16_15_57_
+TTGCACATTCTCGGCCATATCTCTGGACCTACATGACCGATT
+>EYKX4VC01BCEIV length=47 xy=0434_0757 region=1 run=R_2007_11_07_16_15_57_
+TGACGTCGTGCCGAGCTACGACAATGCCGACATG
+>EYKX4VC01BWERM length=83 xy=0662_0304 region=1 run=R_2007_11_07_16_15_57_
+GGCCGAGGTCATGGTGGATCTCGGCCAGG
+>EYKX4VC01BT2O7 length=69 xy=0635_1945 region=1 run=R_2007_11_07_16_15_57_
+GACGCTGTTCAGACCGAACGCGGTAA
+>EYKX4VC01BO0UO length=222 xy=0577_3838 region=1 run=R_2007_11_07_16_15_57_
+CTGCAGTACCGCTTCTGGCTGCACTATGCCGAAGGCTCGCTGATGCCGCTGCTGTTAATGAAGCTGGTGTTCGCCAGCCTGG
+>EYKX4VC01CBCPK length=83 xy=0832_1158 region=1 run=R_2007_11_07_16_15_57_
+GGCCGAGGTCATGGTGGATCTCGGCCAGG
+>EYKX4VC01B474S length=54 xy=0762_2010 region=1 run=R_2007_11_07_16_15_57_
+GAGCGCTGGCGCGCGCGG
+>EYKX4VC01BB4QL length=57 xy=0431_0363 region=1 run=R_2007_11_07_16_15_57_
+AGGAGCTAATTATATGCTCTTGG
+>EYKX4VC01BJ37M length=64 xy=0522_0192 region=1 run=R_2007_11_07_16_15_57_
+TCGAGTATGTATCAAGGACTACATACAA
+>EYKX4VC01BV9R8 length=54 xy=0660_2038 region=1 run=R_2007_11_07_16_15_57_
+CTATTCAGCAGCACTGCGTT
+>EYKX4VC01CEPP8 length=60 xy=0870_2350 region=1 run=R_2007_11_07_16_15_57_
+TCCTCACGTTGTTGTTAGTGTCAG
+>EYKX4VC01BTLME length=78 xy=0630_0292 region=1 run=R_2007_11_07_16_15_57_
+TTATCCACACGCTGTCCGGATCCAGCGCCAGGCGCCGACGCTGGACTTCCGCCGCCTGCGCC
diff -r 000000000000 -r f17a1585733b test-data/short_reads_trim_seq_out2.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/short_reads_trim_seq_out2.fasta	Mon May 19 12:34:17 2014 -0400
@@ -0,0 +1,62 @@
+>0
+GACTCATGATTTCTTACCTATTAGTGGTTGAACA
+>1
+GTGATATGTATGTTGA
+>2
+GTTGTCGATAGAACTTCATGTG
+>3
+ACCAACCAGAACGTGAAAAAG
+>4
+GTTTATGTTGGTTTCATGGTTT
+>5
+GCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCG
+>6
+GCTTGTTTACGAATTAAATCGAAGTGGACTGCTG
+>7
+GTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTT
+>8
+GTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCT
+>9
+GTGGCCTGTTGAT
+>10_0
+GTGACCG
+>10_1
+ATAAAGT
+>11
+TCGCTACACGCAGGA
+>12
+GCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAAC
+>13
+GTTGACGGCCATAAGGCTG
+>14
+GTCAAGGACTGGTTTAGATATGAGTCACATTTTGTT
+>15
+GTGCTGAGTTTTTTTCTGTTACTGTG
+>16
+GACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGG
+>17
+GGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCT
+>18
+GAGTCTCATTTTGCATCTCGGCAATCTCTTTCTGAT
+>19
+GTCATAAGAGGTTTTACCTCCAAATGAAGAAATAAC
+>20
+GCTGGTAATGGTGGTTTTTTTTTTTTTTTTTTT
+>21
+GTTGAGGCTTGCGTTTATGGTACGCTGGACTTT
+>22
+CAAGGT
+>23
+GGCGACTTCACGCCAGAATACGAAA
+>24
+GCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGA
+>25
+GGGATGAACATAATAAGCAATGACG
+>26
+GTATTTTACCAATGACCAAATCAAAGAAATGACTCG
+>27
+GTTTTTAGTGAGTTGTTCCATTCTTTAGCTCCTAGA
+>28
+AAGCTGTTGCCGA
+>29
+GCGTACTTATTCGCCACCATGATTATTAC
diff -r 000000000000 -r f17a1585733b test-data/solexa.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/solexa.fasta	Mon May 19 12:34:17 2014 -0400
@@ -0,0 +1,60 @@
+>0
+GACTCATGATTTCTTACCTATTAGTGGTTGAACATC
+>1
+GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT
+>2
+GTTGTCGATAGAACTTCATGTGCCTGTAAAACAAGT
+>3
+ACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGC
+>4
+GTTTATGTTGGTTTCATGGTTTTGTCTAACTTTATC
+>5
+GCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCG
+>6
+GCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGC
+>7
+GTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTT
+>8
+GTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCT
+>9
+GTGGCCTGTTGATTCTAAAGGTTAGTTTCTTCACGC
+>10
+GTGACCGCATAAAGTGCACAACATGGAAATGAGGAC
+>11
+GCAGATCGCTACACGCAGGACGCTTTTTCACGTTCT
+>12
+GCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAAC
+>13
+GTTGACGGCCATAAGGCTGCTTCTGACGTTCGTGAT
+>14
+GTCAAGGACTGGTTTAGATATGAGTCACATTTTGTT
+>15
+GTGCTGAGTTTTTTTCTGTTACTGTGACATTAATTT
+>16
+GACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGG
+>17
+GGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCT
+>18
+GAGTCTCATTTTGCATCTCGGCAATCTCTTTCTGAT
+>19
+GTCATAAGAGGTTTTACCTCCAAATGAAGAAATAAC
+>20
+GCTGGTAATGGTGGTTTTTTTTTTTTTTTTTTTTTT
+>21
+GTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTA
+>22
+GAGGAGAGTGCAGGTATTAATATCAAGGTTTGTGAG
+>23
+GGCGACTTCACGCCAGAATACGAAATACCAGGTATT
+>24
+GCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGA
+>25
+GGGATGAACATAATAAGCAATGACGGCAGCAATAAA
+>26
+GTATTTTACCAATGACCAAATCAAAGAAATGACTCG
+>27
+GTTTTTAGTGAGTTGTTCCATTCTTTAGCTCCTAGA
+>28
+GTATTGATAAAGCTGTTGCCGATACTTAGCACTATT
+>29
+GCGTACTTATTCGCCACCATGATTATTACCAGTGTT
diff -r 000000000000 -r f17a1585733b test-data/solexa.qual
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/solexa.qual	Mon May 19 12:34:17 2014 -0400
@@ -0,0 +1,30 @@
+ -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -15   15	 -40   40  -40  -40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	  -5    5  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40   21  -40  -21	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  12  -40  -40  -12	 -36  -40   36  -40	 -40  -40   40  -40	  -4    4  -40  -40	 -40  -40  -40   40	 -40  -40   14  -14	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -25   25
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   34  -40  -34	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -25   25  -40	 -40  -40  -40   40	 -37  -40   37  -40	 -40    7  -40   -7	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  38  -40  -40  -38	  40  -40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	  11  -16  -13  -22	 -40  -40   40  -40	 -40  -40  -40   40
+  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -33   33  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40  -25   25	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   27  -27	  -5    5  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -37   37  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -25   25	  40  -40  -40  -40	 -40  -40   34  -34	 -40   40  -40  -40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   -2    2	 -40  -40   35  -35	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	 -40   36  -40  -36	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	   5   -5  -40  -28	 -40  -16  -40   16	 -40   40  -40  -40
+ -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   28  -28	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40
+ -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   27  -27	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   14  -14	 -40   40  -40  -40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -36  -40  -40   36	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40   22  -22	 -40   40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   -6    6	 -40   40  -40  -40	 -40  -40  -40   40	   3  -40  -40   -3	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	  -0  -40  -40    0	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -20   20  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	   8  -40  -40   -8	 -40   40  -40  -40	 -40  -40   40  -40	  -4    4  -40  -40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	  -1    1  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   28  -28	 -40  -40  -40   40	 -10  -40   10  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40    2   -2  -40	  40  -40  -40  -40	  17  -40  -17  -40	 -40   40  -40  -40	   3   -3  -40  -40	 -40  -40  -40   40	 -28  -40   28  -40	 -40  -40   40  -40	  13  -26  -13  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   18  -18	  40  -40  -40  -40	 -10  -40   10  -40	 -40  -40   40  -40	  17  -40  -17  -40	 -28   28  -40  -40
+ -40  -40   40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	   5  -40  -40   -5	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -10   10  -40  -40	 -40  -40   40  -40	 -40   28  -28  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	  32  -32  -40  -40	 -40    4  -40   -4	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40
+ -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40   40  -40  -40	  27  -27  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -15   15  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  32  -40  -40  -32	 -40  -40  -40   40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  25  -40  -40  -25	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -20   20	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -31   31  -40  -40	 -40  -40  -40   40	 -40  -23   23  -40	 -40  -40  -40   40	 -40  -40   40  -40	  15  -15  -40  -40	 -40   40  -40  -40	  25  -40  -25  -40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	  39  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40
+ -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40
+ -40  -40   40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40
+ -40  -40   40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40  -40   40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40
+ -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -36  -40   36	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -24  -40  -40   24	 -40  -40  -40   40	 -14  -40  -40   14	 -40  -40  -40   40	 -40  -40  -40   40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40    9   -9	 -40  -40  -40   40	  23  -40  -40  -23
+ -40  -40   40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   20  -20	  40  -40  -40  -40	 -40  -10   10  -40	  14  -40  -40  -14	 -40  -40   40  -40	 -40  -40  -40   40	 -35  -40   35  -40	 -40   38  -38  -40	  40  -40  -40  -40	 -40  -40   13  -13	 -40  -40   40  -40	 -40  -40  -40   40	  29  -29  -40  -40	 -40  -40  -40   40	 -15  -40  -40   15	  40  -40  -40  -40	  40  -40  -40  -40	 -23  -40  -40   23	  40  -40  -40  -40	  -1  -40  -40    1	 -40   38  -38  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   -9    9	 -40  -40  -21   21	 -40  -40   21  -21	 -40  -40  -29   29	 -40  -13   13  -40	  40  -40  -40  -40	 -40  -40   40  -40
+ -40  -40   40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   -3    3	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	  12  -40  -40  -12	 -10  -40   10  -40	 -40  -40   40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -21  -40  -40   21
+ -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40
+ -40  -40   40  -40	 -40  -40   40  -40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40   -1    1  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -31   31  -40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40
+ -40  -40   40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	  40  -40  -40  -40	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40
+ -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40   40  -40  -40	 -29   29  -40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40   36  -36	  40  -40  -40  -40
+ -40  -40   40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	  20  -20  -40  -40	 -40  -40  -40   40	   3  -40  -40   -3	  40  -40  -40  -40	  40  -40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40  -40   40  -40	 -40   40  -40  -40	 -40   40  -40  -40	 -40  -40   33  -33	  40  -40  -40  -40	 -13  -40  -40   13	   8   -8  -40  -40	 -40   28  -28  -40	 -29  -40  -40   29	 -40  -40  -40   40	   2  -40   -2  -26	 -40  -28   27  -33	  -1    0  -40  -35	  31  -31  -40  -40	 -40   40  -40  -40	 -11  -40  -40   11	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40
+ -40  -40   40  -40	 -40   40  -40  -40	 -40  -40   40  -40	 -40  -40  -40   40	  40  -40  -40  -40	 -40   40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  38  -38  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	 -40   40  -40  -40	 -40  -40   40  -40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40   40  -40  -40	 -40   40  -40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40   40  -40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  40  -40  -40  -40	 -40  -40  -40   40	 -40  -40  -40   40	  29  -40  -40  -29	 -40   40  -40  -40	 -40   10  -40  -10	  40  -40  -40  -40	 -40  -40    2   -2	 -13  -40  -40   13	 -40  -40   40  -40	 -40  -40  -40   40	 -40  -40  -40   40