|
0
|
1 <tool id="vcfprimers" name="VCFprimers:" version="0.0.3">
|
|
|
2 <description>Extract flanking sequences for each VCF record</description>
|
|
|
3 <macros>
|
|
|
4 <import>macros.xml</import>
|
|
|
5 </macros>
|
|
|
6 <expand macro="requirements"></expand>
|
|
|
7 <expand macro="stdio"></expand>
|
|
|
8 <command>
|
|
|
9 #set $reference_fasta_filename = "localref.fa"
|
|
|
10 #if str( $reference_source.reference_source_selector ) == "history":
|
|
|
11 ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" &&
|
|
|
12 #else:
|
|
|
13 #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path )
|
|
|
14 #end if
|
|
|
15 vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command>
|
|
|
16 <inputs>
|
|
|
17 <param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" />
|
|
|
18 <conditional name="reference_source">
|
|
|
19 <param name="reference_source_selector" type="select" label="Choose the source for the reference genome">
|
|
|
20 <option value="cached">Locally cached</option>
|
|
|
21 <option value="history">History</option>
|
|
|
22 </param>
|
|
|
23 <when value="cached">
|
|
|
24 <param name="ref_file" type="select" label="Select reference genome">
|
|
|
25 <options from_data_table="fasta_indexes">
|
|
|
26 </options>
|
|
|
27 <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
|
|
|
28 </param>
|
|
|
29 </when>
|
|
|
30 <when value="history"> <!-- FIX ME!!!! -->
|
|
|
31 <param name="ref_file" type="data" format="fasta" label="Using reference file" />
|
|
|
32 </when>
|
|
|
33 </conditional>
|
|
|
34 <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" />
|
|
|
35 </inputs>
|
|
|
36 <outputs>
|
|
|
37 <data format="fasta" name="out_file1" />
|
|
|
38 </outputs>
|
|
|
39 <tests>
|
|
|
40 <test>
|
|
|
41 <param name="reference_source_selector" value="history" />
|
|
|
42 <param name="input_vcf" value="vcflib-phix.vcf"/>
|
|
|
43 <param name="ref_file" value="vcflib-test-genome-phix.fa" />
|
|
|
44 <param name="primer_length" value="5" />
|
|
|
45 <output name="out_file1" file="vcfprimers-test1.fasta"/>
|
|
|
46 </test>
|
|
|
47 </tests>
|
|
|
48 <help>
|
|
|
49
|
|
|
50 For each VCF record, extract the flanking sequences, and write them as FASTA
|
|
|
51 records suitable for alignment. This tool is intended for use in designing validation
|
|
|
52 experiments. Primers extracted which would flank all of the alleles at multi-allelic
|
|
|
53 sites. The name of the FASTA "reads" indicates the VCF record which they apply to.
|
|
|
54 The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer,
|
|
|
55 for example::
|
|
|
56
|
|
|
57 >20_233255_LEFT
|
|
|
58 CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA
|
|
|
59 >20_233255_RIGHT
|
|
|
60 ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA
|
|
|
61
|
|
|
62 ----
|
|
|
63
|
|
|
64 Vcfprimers @IS_PART_OF_VCFLIB@
|
|
|
65 </help>
|
|
|
66 <expand macro="citations" />
|
|
|
67 </tool>
|
