Mercurial > repos > drosofff > metavisitor_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga @ 2:48b020a0d2f7 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit d5feabb3309f2da09ba15b5fe818d0a7b30f3266
author drosofff
date Fri, 13 May 2016 05:46:40 -0400
parents 4a47903bb4df
children ba15c770fd40
comparison
equal deleted inserted replaced
1:3d8eb2c065c7 2:48b020a0d2f7
17 ], 17 ],
18 "label": null, 18 "label": null,
19 "name": "Input dataset collection", 19 "name": "Input dataset collection",
20 "outputs": [], 20 "outputs": [],
21 "position": { 21 "position": {
22 "left": 211.9375, 22 "left": 192.9375,
23 "top": 200 23 "top": 200
24 }, 24 },
25 "tool_errors": null, 25 "tool_errors": null,
26 "tool_id": null, 26 "tool_id": null,
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", 27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}",
104 "output_name": "outfilename" 104 "output_name": "outfilename"
105 } 105 }
106 }, 106 },
107 "tool_errors": null, 107 "tool_errors": null,
108 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 108 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4",
109 "tool_shed_repository": {
110 "changeset_revision": "befdb392fece",
111 "name": "fetch_fasta_from_ncbi",
112 "owner": "drosofff",
113 "tool_shed": "toolshed.g2.bx.psu.edu"
114 },
109 "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}", 115 "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}",
110 "tool_version": "0.9.4", 116 "tool_version": "0.9.4",
111 "type": "tool", 117 "type": "tool",
112 "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c", 118 "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c",
113 "workflow_outputs": [ 119 "workflow_outputs": [
126 "input": { 132 "input": {
127 "id": 0, 133 "id": 0,
128 "output_name": "output" 134 "output_name": "output"
129 } 135 }
130 }, 136 },
131 "inputs": [], 137 "inputs": [
138 {
139 "description": "runtime parameter for tool Clip adapter",
140 "name": "input"
141 }
142 ],
132 "label": null, 143 "label": null,
133 "name": "Clip adapter", 144 "name": "Clip adapter",
134 "outputs": [ 145 "outputs": [
135 { 146 {
136 "name": "output", 147 "name": "output",
142 "top": 292.5 153 "top": 292.5
143 }, 154 },
144 "post_job_actions": {}, 155 "post_job_actions": {},
145 "tool_errors": null, 156 "tool_errors": null,
146 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 157 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
147 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}", 158 "tool_shed_repository": {
159 "changeset_revision": "91cce7c1436d",
160 "name": "yac_clipper",
161 "owner": "drosofff",
162 "tool_shed": "toolshed.g2.bx.psu.edu"
163 },
164 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}",
148 "tool_version": "1.3.6", 165 "tool_version": "1.3.6",
149 "type": "tool", 166 "type": "tool",
150 "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", 167 "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db",
151 "workflow_outputs": [ 168 "workflow_outputs": [
152 { 169 {
164 "input_file": { 181 "input_file": {
165 "id": 2, 182 "id": 2,
166 "output_name": "outfilename" 183 "output_name": "outfilename"
167 } 184 }
168 }, 185 },
169 "inputs": [], 186 "inputs": [
187 {
188 "description": "runtime parameter for tool NCBI BLAST+ makeblastdb",
189 "name": "mask_data_file"
190 },
191 {
192 "description": "runtime parameter for tool NCBI BLAST+ makeblastdb",
193 "name": "input_file"
194 }
195 ],
170 "label": null, 196 "label": null,
171 "name": "NCBI BLAST+ makeblastdb", 197 "name": "NCBI BLAST+ makeblastdb",
172 "outputs": [ 198 "outputs": [
173 { 199 {
174 "name": "outfile", 200 "name": "outfile",
186 "output_name": "outfile" 212 "output_name": "outfile"
187 } 213 }
188 }, 214 },
189 "tool_errors": null, 215 "tool_errors": null,
190 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 216 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06",
191 "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"False\\\"\"}", 217 "tool_shed_repository": {
218 "changeset_revision": "577d9c12411a",
219 "name": "ncbi_blast_plus",
220 "owner": "devteam",
221 "tool_shed": "toolshed.g2.bx.psu.edu"
222 },
223 "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}",
192 "tool_version": "0.1.06", 224 "tool_version": "0.1.06",
193 "type": "tool", 225 "type": "tool",
194 "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d", 226 "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d",
195 "workflow_outputs": [] 227 "workflow_outputs": []
196 }, 228 },
202 "input": { 234 "input": {
203 "id": 3, 235 "id": 3,
204 "output_name": "output" 236 "output_name": "output"
205 } 237 }
206 }, 238 },
207 "inputs": [], 239 "inputs": [
240 {
241 "description": "runtime parameter for tool Concatenate multiple datasets",
242 "name": "input"
243 }
244 ],
208 "label": null, 245 "label": null,
209 "name": "Concatenate multiple datasets", 246 "name": "Concatenate multiple datasets",
210 "outputs": [ 247 "outputs": [
211 { 248 {
212 "name": "out_file1", 249 "name": "out_file1",
231 "output_name": "out_file1" 268 "output_name": "out_file1"
232 } 269 }
233 }, 270 },
234 "tool_errors": null, 271 "tool_errors": null,
235 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 272 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
236 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 273 "tool_shed_repository": {
274 "changeset_revision": "201c568972c3",
275 "name": "concatenate_multiple_datasets",
276 "owner": "mvdbeek",
277 "tool_shed": "toolshed.g2.bx.psu.edu"
278 },
279 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
237 "tool_version": "0.2", 280 "tool_version": "0.2",
238 "type": "tool", 281 "type": "tool",
239 "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a", 282 "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a",
240 "workflow_outputs": [] 283 "workflow_outputs": []
241 }, 284 },
247 "switch|input": { 290 "switch|input": {
248 "id": 5, 291 "id": 5,
249 "output_name": "out_file1" 292 "output_name": "out_file1"
250 } 293 }
251 }, 294 },
252 "inputs": [], 295 "inputs": [
296 {
297 "description": "runtime parameter for tool fasta - tabular",
298 "name": "switch"
299 }
300 ],
253 "label": null, 301 "label": null,
254 "name": "fasta - tabular", 302 "name": "fasta - tabular",
255 "outputs": [ 303 "outputs": [
256 { 304 {
257 "name": "output", 305 "name": "output",
269 "output_name": "output" 317 "output_name": "output"
270 } 318 }
271 }, 319 },
272 "tool_errors": null, 320 "tool_errors": null,
273 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 321 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
274 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}", 322 "tool_shed_repository": {
323 "changeset_revision": "330dd8a8c31a",
324 "name": "msp_fasta_tabular_converter",
325 "owner": "drosofff",
326 "tool_shed": "toolshed.g2.bx.psu.edu"
327 },
328 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 0, \\\"conversionType\\\": \\\"fasta2tabular\\\"}\", \"__rerun_remap_job_id__\": null}",
275 "tool_version": "1.1.0", 329 "tool_version": "1.1.0",
276 "type": "tool", 330 "type": "tool",
277 "uuid": "32ec6fba-fb02-4edd-a3c3-3bd617e78ff2", 331 "uuid": "32ec6fba-fb02-4edd-a3c3-3bd617e78ff2",
278 "workflow_outputs": [] 332 "workflow_outputs": []
279 }, 333 },
285 "switch|input": { 339 "switch|input": {
286 "id": 6, 340 "id": 6,
287 "output_name": "output" 341 "output_name": "output"
288 } 342 }
289 }, 343 },
290 "inputs": [], 344 "inputs": [
345 {
346 "description": "runtime parameter for tool fasta - tabular",
347 "name": "switch"
348 }
349 ],
291 "label": null, 350 "label": null,
292 "name": "fasta - tabular", 351 "name": "fasta - tabular",
293 "outputs": [ 352 "outputs": [
294 { 353 {
295 "name": "output", 354 "name": "output",
309 "output_name": "output" 368 "output_name": "output"
310 } 369 }
311 }, 370 },
312 "tool_errors": null, 371 "tool_errors": null,
313 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 372 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
314 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}", 373 "tool_shed_repository": {
374 "changeset_revision": "330dd8a8c31a",
375 "name": "msp_fasta_tabular_converter",
376 "owner": "drosofff",
377 "tool_shed": "toolshed.g2.bx.psu.edu"
378 },
379 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 2, \\\"conversionType\\\": \\\"tabular2fastaweight\\\"}\", \"__rerun_remap_job_id__\": null}",
315 "tool_version": "1.1.0", 380 "tool_version": "1.1.0",
316 "type": "tool", 381 "type": "tool",
317 "uuid": "7cc53603-6876-4f15-919d-177218404620", 382 "uuid": "7cc53603-6876-4f15-919d-177218404620",
318 "workflow_outputs": [ 383 "workflow_outputs": [
319 { 384 {
331 "input": { 396 "input": {
332 "id": 7, 397 "id": 7,
333 "output_name": "output" 398 "output_name": "output"
334 } 399 }
335 }, 400 },
336 "inputs": [], 401 "inputs": [
402 {
403 "description": "runtime parameter for tool sRbowtie",
404 "name": "input"
405 }
406 ],
337 "label": null, 407 "label": null,
338 "name": "sRbowtie", 408 "name": "sRbowtie",
339 "outputs": [ 409 "outputs": [
340 { 410 {
341 "name": "output", 411 "name": "output",
373 "output_name": "unaligned" 443 "output_name": "unaligned"
374 } 444 }
375 }, 445 },
376 "tool_errors": null, 446 "tool_errors": null,
377 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 447 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
378 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 448 "tool_shed_repository": {
449 "changeset_revision": "c1bfa227bbb6",
450 "name": "msp_sr_bowtie",
451 "owner": "drosofff",
452 "tool_shed": "toolshed.g2.bx.psu.edu"
453 },
454 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}",
379 "tool_version": "1.1.2", 455 "tool_version": "1.1.2",
380 "type": "tool", 456 "type": "tool",
381 "uuid": "e22c6843-8125-49d6-9dcd-546155536f78", 457 "uuid": "e22c6843-8125-49d6-9dcd-546155536f78",
382 "workflow_outputs": [ 458 "workflow_outputs": [
383 { 459 {
387 } 463 }
388 ] 464 ]
389 }, 465 },
390 "9": { 466 "9": {
391 "annotation": "", 467 "annotation": "",
392 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 468 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.5",
393 "id": 9, 469 "id": 9,
394 "input_connections": { 470 "input_connections": {
395 "inputs_0|input": { 471 "inputs_0|input": {
396 "id": 8, 472 "id": 8,
397 "output_name": "unaligned" 473 "output_name": "unaligned"
418 "action_type": "RenameDatasetAction", 494 "action_type": "RenameDatasetAction",
419 "output_name": "transcripts" 495 "output_name": "transcripts"
420 } 496 }
421 }, 497 },
422 "tool_errors": null, 498 "tool_errors": null,
423 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 499 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.5",
424 "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 500 "tool_shed_repository": {
425 "tool_version": "1.1.4", 501 "changeset_revision": "dc684e37f668",
502 "name": "msp_oases",
503 "owner": "drosofff",
504 "tool_shed": "toolshed.g2.bx.psu.edu"
505 },
506 "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}",
507 "tool_version": "1.1.5",
426 "type": "tool", 508 "type": "tool",
427 "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c", 509 "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c",
428 "workflow_outputs": [ 510 "workflow_outputs": [
429 { 511 {
430 "label": null, 512 "label": null,
445 "query": { 527 "query": {
446 "id": 9, 528 "id": 9,
447 "output_name": "transcripts" 529 "output_name": "transcripts"
448 } 530 }
449 }, 531 },
450 "inputs": [], 532 "inputs": [
533 {
534 "description": "runtime parameter for tool NCBI BLAST+ blastn",
535 "name": "db_opts"
536 },
537 {
538 "description": "runtime parameter for tool NCBI BLAST+ blastn",
539 "name": "query"
540 }
541 ],
451 "label": null, 542 "label": null,
452 "name": "NCBI BLAST+ blastn", 543 "name": "NCBI BLAST+ blastn",
453 "outputs": [ 544 "outputs": [
454 { 545 {
455 "name": "output1", 546 "name": "output1",
467 "output_name": "output1" 558 "output_name": "output1"
468 } 559 }
469 }, 560 },
470 "tool_errors": null, 561 "tool_errors": null,
471 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 562 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
472 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 563 "tool_shed_repository": {
564 "changeset_revision": "577d9c12411a",
565 "name": "ncbi_blast_plus",
566 "owner": "devteam",
567 "tool_shed": "toolshed.g2.bx.psu.edu"
568 },
569 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"false\\\", \\\"filter_query\\\": \\\"true\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
473 "tool_version": "0.1.06", 570 "tool_version": "0.1.06",
474 "type": "tool", 571 "type": "tool",
475 "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", 572 "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748",
476 "workflow_outputs": [] 573 "workflow_outputs": []
477 }, 574 },
487 "sequences": { 584 "sequences": {
488 "id": 9, 585 "id": 9,
489 "output_name": "transcripts" 586 "output_name": "transcripts"
490 } 587 }
491 }, 588 },
492 "inputs": [], 589 "inputs": [
590 {
591 "description": "runtime parameter for tool Parse blast output and compile hits",
592 "name": "blast"
593 },
594 {
595 "description": "runtime parameter for tool Parse blast output and compile hits",
596 "name": "sequences"
597 }
598 ],
493 "label": null, 599 "label": null,
494 "name": "Parse blast output and compile hits", 600 "name": "Parse blast output and compile hits",
495 "outputs": [ 601 "outputs": [
496 { 602 {
497 "name": "tabularOutput", 603 "name": "tabularOutput",
526 "output_name": "un_sequences" 632 "output_name": "un_sequences"
527 } 633 }
528 }, 634 },
529 "tool_errors": null, 635 "tool_errors": null,
530 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 636 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
531 "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 637 "tool_shed_repository": {
638 "changeset_revision": "6dfa79a6908a",
639 "name": "msp_blastparser_and_hits",
640 "owner": "drosofff",
641 "tool_shed": "toolshed.g2.bx.psu.edu"
642 },
643 "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}",
532 "tool_version": "2.4.3", 644 "tool_version": "2.4.3",
533 "type": "tool", 645 "type": "tool",
534 "uuid": "84989771-81db-4d86-bff6-cfda892b1959", 646 "uuid": "84989771-81db-4d86-bff6-cfda892b1959",
535 "workflow_outputs": [ 647 "workflow_outputs": [
536 { 648 {
553 "inputSequences": { 665 "inputSequences": {
554 "id": 11, 666 "id": 11,
555 "output_name": "fastaOutput" 667 "output_name": "fastaOutput"
556 } 668 }
557 }, 669 },
558 "inputs": [], 670 "inputs": [
671 {
672 "description": "runtime parameter for tool cap3",
673 "name": "inputSequences"
674 }
675 ],
559 "label": null, 676 "label": null,
560 "name": "cap3", 677 "name": "cap3",
561 "outputs": [ 678 "outputs": [
562 { 679 {
563 "name": "contigsandsinglets", 680 "name": "contigsandsinglets",
633 "output_name": "singlets" 750 "output_name": "singlets"
634 } 751 }
635 }, 752 },
636 "tool_errors": null, 753 "tool_errors": null,
637 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 754 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0",
638 "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 755 "tool_shed_repository": {
756 "changeset_revision": "ddb463fdf57e",
757 "name": "msp_cap3",
758 "owner": "drosofff",
759 "tool_shed": "toolshed.g2.bx.psu.edu"
760 },
761 "tool_state": "{\"__page__\": 0, \"inputSequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
639 "tool_version": "1.2.0", 762 "tool_version": "1.2.0",
640 "type": "tool", 763 "type": "tool",
641 "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360", 764 "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360",
642 "workflow_outputs": [ 765 "workflow_outputs": [
643 { 766 {
659 "query": { 782 "query": {
660 "id": 12, 783 "id": 12,
661 "output_name": "contigsandsinglets" 784 "output_name": "contigsandsinglets"
662 } 785 }
663 }, 786 },
664 "inputs": [], 787 "inputs": [
788 {
789 "description": "runtime parameter for tool NCBI BLAST+ blastn",
790 "name": "db_opts"
791 },
792 {
793 "description": "runtime parameter for tool NCBI BLAST+ blastn",
794 "name": "query"
795 }
796 ],
665 "label": null, 797 "label": null,
666 "name": "NCBI BLAST+ blastn", 798 "name": "NCBI BLAST+ blastn",
667 "outputs": [ 799 "outputs": [
668 { 800 {
669 "name": "output1", 801 "name": "output1",
681 "output_name": "output1" 813 "output_name": "output1"
682 } 814 }
683 }, 815 },
684 "tool_errors": null, 816 "tool_errors": null,
685 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 817 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
686 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 818 "tool_shed_repository": {
819 "changeset_revision": "577d9c12411a",
820 "name": "ncbi_blast_plus",
821 "owner": "devteam",
822 "tool_shed": "toolshed.g2.bx.psu.edu"
823 },
824 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
687 "tool_version": "0.1.06", 825 "tool_version": "0.1.06",
688 "type": "tool", 826 "type": "tool",
689 "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939", 827 "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939",
690 "workflow_outputs": [] 828 "workflow_outputs": []
691 }, 829 },
705 "sequences": { 843 "sequences": {
706 "id": 12, 844 "id": 12,
707 "output_name": "contigsandsinglets" 845 "output_name": "contigsandsinglets"
708 } 846 }
709 }, 847 },
710 "inputs": [], 848 "inputs": [
849 {
850 "description": "runtime parameter for tool blast_to_scaffold",
851 "name": "guideSequence"
852 },
853 {
854 "description": "runtime parameter for tool blast_to_scaffold",
855 "name": "blast_tab"
856 },
857 {
858 "description": "runtime parameter for tool blast_to_scaffold",
859 "name": "sequences"
860 }
861 ],
711 "label": null, 862 "label": null,
712 "name": "blast_to_scaffold", 863 "name": "blast_to_scaffold",
713 "outputs": [ 864 "outputs": [
714 { 865 {
715 "name": "output", 866 "name": "output",
727 "output_name": "output" 878 "output_name": "output"
728 } 879 }
729 }, 880 },
730 "tool_errors": null, 881 "tool_errors": null,
731 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 882 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0",
732 "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}", 883 "tool_shed_repository": {
884 "changeset_revision": "3288cc5a57e5",
885 "name": "blast_to_scaffold",
886 "owner": "drosofff",
887 "tool_shed": "toolshed.g2.bx.psu.edu"
888 },
889 "tool_state": "{\"__page__\": 0, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}",
733 "tool_version": "0.9.0", 890 "tool_version": "0.9.0",
734 "type": "tool", 891 "type": "tool",
735 "uuid": "4e68c3e8-b825-40bd-ae22-a74ca7048737", 892 "uuid": "4e68c3e8-b825-40bd-ae22-a74ca7048737",
736 "workflow_outputs": [] 893 "workflow_outputs": []
737 }, 894 },
743 "input": { 900 "input": {
744 "id": 14, 901 "id": 14,
745 "output_name": "output" 902 "output_name": "output"
746 } 903 }
747 }, 904 },
748 "inputs": [], 905 "inputs": [
906 {
907 "description": "runtime parameter for tool Regex Find And Replace",
908 "name": "input"
909 }
910 ],
749 "label": null, 911 "label": null,
750 "name": "Regex Find And Replace", 912 "name": "Regex Find And Replace",
751 "outputs": [ 913 "outputs": [
752 { 914 {
753 "name": "out_file1", 915 "name": "out_file1",
767 "output_name": "out_file1" 929 "output_name": "out_file1"
768 } 930 }
769 }, 931 },
770 "tool_errors": null, 932 "tool_errors": null,
771 "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 933 "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0",
772 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_MV\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}", 934 "tool_shed_repository": {
935 "changeset_revision": "9ea374bb0350",
936 "name": "regex_find_replace",
937 "owner": "jjohnson",
938 "tool_shed": "toolshed.g2.bx.psu.edu"
939 },
940 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_MV\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}",
773 "tool_version": "0.1.0", 941 "tool_version": "0.1.0",
774 "type": "tool", 942 "type": "tool",
775 "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", 943 "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf",
776 "workflow_outputs": [ 944 "workflow_outputs": [
777 { 945 {
780 "uuid": "d180a0a7-c5ff-4ab4-99ef-9bd8589dd378" 948 "uuid": "d180a0a7-c5ff-4ab4-99ef-9bd8589dd378"
781 } 949 }
782 ] 950 ]
783 } 951 }
784 }, 952 },
785 "uuid": "6d905af0-243a-42b9-8951-a5477cfa6d88" 953 "uuid": "5c90686e-2dd0-43c4-bd64-a5ed21bcf2ff"
786 } 954 }