diff Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga @ 0:4a47903bb4df draft

planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 48b020a0d2f7
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,709 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 1-2", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Input Dataset Collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 211.9375, 
+                "top": 200
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "940fadea-7557-4c56-a6df-c58db232b6f0"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 1024.9375, 
+                "top": 963.984375
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "9a03415f-fd4b-43ea-ae2d-c9004b97d703"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "id": 2, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Retrieve FASTA from NCBI", 
+            "outputs": [
+                {
+                    "name": "outfilename", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "logfile", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1587.5, 
+                "top": 994.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionlogfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "logfile"
+                }, 
+                "RenameDatasetActionoutfilename": {
+                    "action_arguments": {
+                        "newname": "${ncbi_guide_ID}"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}", 
+            "tool_version": "0.9.4", 
+            "type": "tool", 
+            "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "outfilename", 
+                    "uuid": "4a4625bf-6029-4f4d-b110-3bec39c97ef3"
+                }
+            ]
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 420.46875, 
+                "top": 292.5
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "54f9c80d-225e-4239-b813-bdebca04d857"
+                }
+            ]
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "id": 4, 
+            "input_connections": {
+                "input_file": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ makeblastdb", 
+            "outputs": [
+                {
+                    "name": "outfile", 
+                    "type": "data"
+                }
+            ], 
+            "position": {
+                "left": 1866.484375, 
+                "top": 1084.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "outfile"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"False\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 5, 
+            "input_connections": {
+                "input": {
+                    "id": 3, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 576.5, 
+                "top": 418.484375
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a", 
+            "workflow_outputs": []
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 6, 
+            "input_connections": {
+                "input": {
+                    "id": 5, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 830.46875, 
+                "top": 288.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "e22c6843-8125-49d6-9dcd-546155536f78", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "unaligned", 
+                    "uuid": "48d4c763-e2ec-40d5-8eec-a19107d5c41c"
+                }
+            ]
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 7, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 6, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1099.46875, 
+                "top": 509.484375
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "0e1ec8f7-c026-4982-b854-6d406ffb5d10"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 8, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 7, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1273.484375, 
+                "top": 800.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", 
+            "workflow_outputs": []
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 9, 
+            "input_connections": {
+                "blast": {
+                    "id": 8, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 7, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1563.984375, 
+                "top": 513.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "84989771-81db-4d86-bff6-cfda892b1959", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "d53d4680-1c8c-4397-8369-936ca8f283c1"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "fastaOutput", 
+                    "uuid": "082373bd-ddaf-472f-b669-0eca37d75d80"
+                }
+            ]
+        }, 
+        "10": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "id": 10, 
+            "input_connections": {
+                "inputSequences": {
+                    "id": 9, 
+                    "output_name": "fastaOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "cap3", 
+            "outputs": [
+                {
+                    "name": "contigsandsinglets", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "cap3stdout", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigs", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "contigsqual", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigslink", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "ace", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "info", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "singlets", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1924.484375, 
+                "top": 666.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionace": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "ace"
+                }, 
+                "HideDatasetActioncap3stdout": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "cap3stdout"
+                }, 
+                "HideDatasetActioncontigs": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigs"
+                }, 
+                "HideDatasetActioncontigslink": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigslink"
+                }, 
+                "HideDatasetActioncontigsqual": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigsqual"
+                }, 
+                "HideDatasetActioninfo": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "info"
+                }, 
+                "HideDatasetActionsinglets": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "singlets"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "1.2.0", 
+            "type": "tool", 
+            "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "contigsandsinglets", 
+                    "uuid": "029bd9db-59a4-4683-8136-86c80fb5e8d6"
+                }
+            ]
+        }, 
+        "11": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 11, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 4, 
+                    "output_name": "outfile"
+                }, 
+                "query": {
+                    "id": 10, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 2234.484375, 
+                "top": 956.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939", 
+            "workflow_outputs": []
+        }, 
+        "12": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "id": 12, 
+            "input_connections": {
+                "blast_tab": {
+                    "id": 11, 
+                    "output_name": "output1"
+                }, 
+                "guideSequence": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }, 
+                "sequences": {
+                    "id": 10, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "blast_to_scaffold", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 2535, 
+                "top": 774.5
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}", 
+            "tool_version": "0.9.0", 
+            "type": "tool", 
+            "uuid": "ca2b5401-fc07-4d46-8d5e-3a77a3e3b174", 
+            "workflow_outputs": []
+        }, 
+        "13": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "id": 13, 
+            "input_connections": {
+                "input": {
+                    "id": 12, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Regex Find And Replace", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 2726.984375, 
+                "top": 1140
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Nora_raw_reads_${ncbi_guide_ID}_guided"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_raw_reads\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}", 
+            "tool_version": "0.1.0", 
+            "type": "tool", 
+            "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "b5cf0dd9-bfe3-4021-99fe-12faf47d29e0"
+                }
+            ]
+        }
+    }, 
+    "uuid": "52976d74-fcd5-4e3c-a474-cd7aaf6e1047"
+}
\ No newline at end of file