Mercurial > repos > drosofff > metavisitor_workflows
diff Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga @ 0:4a47903bb4df draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author | drosofff |
---|---|
date | Tue, 05 Apr 2016 06:42:47 -0400 |
parents | |
children | 48b020a0d2f7 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga Tue Apr 05 06:42:47 2016 -0400 @@ -0,0 +1,445 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "Metavisitor: Workflow for remapping in Use Cases 1-1,2,3", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Read fastq files" + } + ], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 199.53128051757812, + "top": 207.51737213134766 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"collection_type\": \"list\", \"name\": \"Read fastq files\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "None", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "19eaa717-5b9a-4b27-a1c4-a895fc673970" + } + ] + }, + "1": { + "annotation": "", + "content_id": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Nora Virus Genomes" + } + ], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 661.5451812744141, + "top": 554.5312805175781 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"collection_type\": \"list\", \"name\": \"Nora Virus Genomes\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "None", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "46b1caea-3a7c-4663-b2e1-6536a346567a" + } + ] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", + "id": 2, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Clip adapter", + "outputs": [ + { + "name": "output", + "type": "fasta" + } + ], + "position": { + "left": 387.51739501953125, + "top": 324.53126525878906 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", + "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}", + "tool_version": "1.3.6", + "type": "tool", + "uuid": "None", + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "id": 3, + "input_connections": { + "input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate multiple datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 955.729248046875, + "top": 691.7187805175781 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "fasta" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", + "tool_version": "0.2", + "type": "tool", + "uuid": "None", + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate multiple datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 552.5173950195312, + "top": 226.54515075683594 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "fasta" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "clipped Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", + "tool_version": "0.2", + "type": "tool", + "uuid": "None", + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", + "id": 5, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + }, + "refGenomeSource|ownFile": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "sRbowtie", + "outputs": [ + { + "name": "output", + "type": "tabular" + }, + { + "name": "aligned", + "type": "fasta" + }, + { + "name": "unaligned", + "type": "fasta" + } + ], + "position": { + "left": 846.5451965332031, + "top": 264.53126525878906 + }, + "post_job_actions": { + "HideDatasetActionaligned": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "aligned" + }, + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionunaligned": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "unaligned" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", + "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "None", + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "id": 6, + "input_connections": { + "input": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate multiple datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1188.7500610351562, + "top": 518.7500305175781 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "tabular" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Read Re-mapping" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", + "tool_version": "0.2", + "type": "tool", + "uuid": "None", + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "wc_gnu", + "id": 7, + "input_connections": { + "input1": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1352.5174560546875, + "top": 307.5173797607422 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "nbre of remapped reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_errors": null, + "tool_id": "wc_gnu", + "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"True\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "None", + "workflow_outputs": [ + { + "label": null, + "output_name": "out_file1", + "uuid": "cdd91e78-45f2-4ec2-b426-93e20d238c4b" + } + ] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", + "id": 8, + "input_connections": { + "refGenomeSource|ownFile": { + "id": 3, + "output_name": "out_file1" + }, + "refGenomeSource|series_0|input": { + "id": 6, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Generate readmap and histograms from alignment files", + "outputs": [ + { + "name": "readmap_dataframe", + "type": "tabular" + }, + { + "name": "size_distribution_dataframe", + "type": "tabular" + }, + { + "name": "readmap_PDF", + "type": "pdf" + }, + { + "name": "size_PDF", + "type": "pdf" + }, + { + "name": "combi_PDF", + "type": "pdf" + } + ], + "position": { + "left": 1562.4827270507812, + "top": 554.982666015625 + }, + "post_job_actions": { + "HideDatasetActionreadmap_dataframe": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "readmap_dataframe" + }, + "HideDatasetActionsize_distribution_dataframe": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "size_distribution_dataframe" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", + "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}", + "tool_version": "1.1.5", + "type": "tool", + "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", + "workflow_outputs": [ + { + "label": null, + "output_name": "size_PDF", + "uuid": "51ecda12-a282-4c56-8bd9-66f22742b301" + }, + { + "label": null, + "output_name": "combi_PDF", + "uuid": "f9345f64-7f9b-440a-b12a-6d123a46800f" + }, + { + "label": null, + "output_name": "readmap_PDF", + "uuid": "eb151acd-9d6d-4c30-8bc5-9124a9a3d815" + } + ] + } + }, + "uuid": "35f7ef15-bb91-4eca-b8a7-345dc5cb3136" +} \ No newline at end of file