diff Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga @ 0:4a47903bb4df draft

planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 48b020a0d2f7
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,445 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for remapping in Use Cases 1-1,2,3", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Read fastq files"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 199.53128051757812, 
+                "top": 207.51737213134766
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Read fastq files\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "19eaa717-5b9a-4b27-a1c4-a895fc673970"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Nora Virus Genomes"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 661.5451812744141, 
+                "top": 554.5312805175781
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Nora Virus Genomes\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "46b1caea-3a7c-4663-b2e1-6536a346567a"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 2, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 387.51739501953125, 
+                "top": 324.53126525878906
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 1, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 955.729248046875, 
+                "top": 691.7187805175781
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 4, 
+            "input_connections": {
+                "input": {
+                    "id": 2, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 552.5173950195312, 
+                "top": 226.54515075683594
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "clipped Reads"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 5, 
+            "input_connections": {
+                "input": {
+                    "id": 4, 
+                    "output_name": "out_file1"
+                }, 
+                "refGenomeSource|ownFile": {
+                    "id": 1, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 846.5451965332031, 
+                "top": 264.53126525878906
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionunaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 6, 
+            "input_connections": {
+                "input": {
+                    "id": 5, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 1188.7500610351562, 
+                "top": 518.7500305175781
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "tabular"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Read Re-mapping"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "wc_gnu", 
+            "id": 7, 
+            "input_connections": {
+                "input1": {
+                    "id": 5, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Line/Word/Character count", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1352.5174560546875, 
+                "top": 307.5173797607422
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "nbre of remapped reads"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "wc_gnu", 
+            "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"True\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.0.0", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "cdd91e78-45f2-4ec2-b426-93e20d238c4b"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", 
+            "id": 8, 
+            "input_connections": {
+                "refGenomeSource|ownFile": {
+                    "id": 3, 
+                    "output_name": "out_file1"
+                }, 
+                "refGenomeSource|series_0|input": {
+                    "id": 6, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Generate readmap and histograms from alignment files", 
+            "outputs": [
+                {
+                    "name": "readmap_dataframe", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "size_distribution_dataframe", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "readmap_PDF", 
+                    "type": "pdf"
+                }, 
+                {
+                    "name": "size_PDF", 
+                    "type": "pdf"
+                }, 
+                {
+                    "name": "combi_PDF", 
+                    "type": "pdf"
+                }
+            ], 
+            "position": {
+                "left": 1562.4827270507812, 
+                "top": 554.982666015625
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionreadmap_dataframe": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "readmap_dataframe"
+                }, 
+                "HideDatasetActionsize_distribution_dataframe": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "size_distribution_dataframe"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", 
+            "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}", 
+            "tool_version": "1.1.5", 
+            "type": "tool", 
+            "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "size_PDF", 
+                    "uuid": "51ecda12-a282-4c56-8bd9-66f22742b301"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "combi_PDF", 
+                    "uuid": "f9345f64-7f9b-440a-b12a-6d123a46800f"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "readmap_PDF", 
+                    "uuid": "eb151acd-9d6d-4c30-8bc5-9124a9a3d815"
+                }
+            ]
+        }
+    }, 
+    "uuid": "35f7ef15-bb91-4eca-b8a7-345dc5cb3136"
+}
\ No newline at end of file