Mercurial > repos > drosofff > metavisitor_workflows
view Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga @ 3:ba15c770fd40 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit 9e3f79e20670526453bbed9f5b028aabb1bb7ae4
author | drosofff |
---|---|
date | Thu, 17 Nov 2016 07:27:04 -0500 |
parents | 48b020a0d2f7 |
children |
line wrap: on
line source
{ "a_galaxy_workflow": "true", "annotation": "", "format-version": "0.1", "name": "Metavisitor: Workflow for remapping in Use Cases 1-1,2,3", "steps": { "0": { "annotation": "", "content_id": null, "id": 0, "input_connections": {}, "inputs": [ { "description": "", "name": "Read fastq files" } ], "label": null, "name": "Input dataset collection", "outputs": [], "position": { "left": 199.53128051757812, "top": 207.51737213134766 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"collection_type\": \"list\", \"name\": \"Read fastq files\"}", "tool_version": null, "type": "data_collection_input", "uuid": "ca202c6a-46b7-4f3a-a2ab-dbc781f331b7", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "19eaa717-5b9a-4b27-a1c4-a895fc673970" } ] }, "1": { "annotation": "", "content_id": null, "id": 1, "input_connections": {}, "inputs": [ { "description": "", "name": "Nora Virus Genomes" } ], "label": null, "name": "Input dataset collection", "outputs": [], "position": { "left": 661.5451812744141, "top": 554.5312805175781 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"collection_type\": \"list\", \"name\": \"Nora Virus Genomes\"}", "tool_version": null, "type": "data_collection_input", "uuid": "e8e196c7-c854-4bd9-ace2-345a0d797090", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "46b1caea-3a7c-4663-b2e1-6536a346567a" } ] }, "2": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", "id": 2, "input_connections": { "input": { "id": 0, "output_name": "output" } }, "inputs": [], "label": null, "name": "Clip adapter", "outputs": [ { "name": "output", "type": "fasta" } ], "position": { "left": 387.51739501953125, "top": 324.53126525878906 }, "post_job_actions": { "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", "tool_shed_repository": { "changeset_revision": "91cce7c1436d", "name": "yac_clipper", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}", "tool_version": "1.3.6", "type": "tool", "uuid": "afa187ce-544c-4287-8699-a9efe8ce45ab", "workflow_outputs": [] }, "3": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "id": 3, "input_connections": { "input": { "id": 1, "output_name": "output" } }, "inputs": [], "label": null, "name": "Concatenate multiple datasets", "outputs": [ { "name": "out_file1", "type": "input" } ], "position": { "left": 955.729248046875, "top": 691.7187805175781 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { "action_arguments": { "newtype": "fasta" }, "action_type": "ChangeDatatypeAction", "output_name": "out_file1" }, "HideDatasetActionout_file1": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "out_file1" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "tool_shed_repository": { "changeset_revision": "201c568972c3", "name": "concatenate_multiple_datasets", "owner": "mvdbeek", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", "tool_version": "0.2", "type": "tool", "uuid": "73d5e37a-8a61-4bab-8bf5-12b12fc45988", "workflow_outputs": [] }, "4": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "id": 4, "input_connections": { "input": { "id": 2, "output_name": "output" } }, "inputs": [], "label": null, "name": "Concatenate multiple datasets", "outputs": [ { "name": "out_file1", "type": "input" } ], "position": { "left": 552.5173950195312, "top": 226.54515075683594 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { "action_arguments": { "newtype": "fasta" }, "action_type": "ChangeDatatypeAction", "output_name": "out_file1" }, "HideDatasetActionout_file1": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "out_file1" }, "RenameDatasetActionout_file1": { "action_arguments": { "newname": "clipped Reads" }, "action_type": "RenameDatasetAction", "output_name": "out_file1" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "tool_shed_repository": { "changeset_revision": "201c568972c3", "name": "concatenate_multiple_datasets", "owner": "mvdbeek", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", "tool_version": "0.2", "type": "tool", "uuid": "f15e8add-3a18-4607-b5e2-51448dcdeb77", "workflow_outputs": [] }, "5": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", "id": 5, "input_connections": { "input": { "id": 4, "output_name": "out_file1" }, "refGenomeSource|ownFile": { "id": 1, "output_name": "output" } }, "inputs": [], "label": null, "name": "sRbowtie", "outputs": [ { "name": "output", "type": "tabular" }, { "name": "aligned", "type": "fasta" }, { "name": "unaligned", "type": "fasta" } ], "position": { "left": 846.5451965332031, "top": 264.53126525878906 }, "post_job_actions": { "HideDatasetActionaligned": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "aligned" }, "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" }, "HideDatasetActionunaligned": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "unaligned" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", "tool_shed_repository": { "changeset_revision": "615d2550977f", "name": "msp_sr_bowtie", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}", "tool_version": "1.1.2.1", "type": "tool", "uuid": "a9880e4e-f47f-4a21-ad20-5aefb83b57ad", "workflow_outputs": [] }, "6": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "id": 6, "input_connections": { "input": { "id": 5, "output_name": "output" } }, "inputs": [], "label": null, "name": "Concatenate multiple datasets", "outputs": [ { "name": "out_file1", "type": "input" } ], "position": { "left": 1188.7500610351562, "top": 518.7500305175781 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { "action_arguments": { "newtype": "tabular" }, "action_type": "ChangeDatatypeAction", "output_name": "out_file1" }, "HideDatasetActionout_file1": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "out_file1" }, "RenameDatasetActionout_file1": { "action_arguments": { "newname": "Read Re-mapping" }, "action_type": "RenameDatasetAction", "output_name": "out_file1" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "tool_shed_repository": { "changeset_revision": "201c568972c3", "name": "concatenate_multiple_datasets", "owner": "mvdbeek", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", "tool_version": "0.2", "type": "tool", "uuid": "afeb8258-2959-4b81-bec4-aaa342dd930d", "workflow_outputs": [] }, "7": { "annotation": "", "content_id": "wc_gnu", "id": 7, "input_connections": { "input1": { "id": 5, "output_name": "output" } }, "inputs": [], "label": null, "name": "Line/Word/Character count", "outputs": [ { "name": "out_file1", "type": "tabular" } ], "position": { "left": 1352.5174560546875, "top": 307.5173797607422 }, "post_job_actions": { "RenameDatasetActionout_file1": { "action_arguments": { "newname": "nbre of remapped reads" }, "action_type": "RenameDatasetAction", "output_name": "out_file1" } }, "tool_errors": null, "tool_id": "wc_gnu", "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"true\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", "tool_version": "1.0.0", "type": "tool", "uuid": "98092466-d430-48bd-b285-770aeee41153", "workflow_outputs": [ { "label": null, "output_name": "out_file1", "uuid": "cdd91e78-45f2-4ec2-b426-93e20d238c4b" } ] }, "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", "id": 8, "input_connections": { "refGenomeSource|ownFile": { "id": 3, "output_name": "out_file1" }, "refGenomeSource|series_0|input": { "id": 6, "output_name": "out_file1" } }, "inputs": [], "label": null, "name": "Generate readmap and histograms from alignment files", "outputs": [ { "name": "readmap_dataframe", "type": "tabular" }, { "name": "size_distribution_dataframe", "type": "tabular" }, { "name": "readmap_PDF", "type": "pdf" }, { "name": "size_PDF", "type": "pdf" }, { "name": "combi_PDF", "type": "pdf" } ], "position": { "left": 1562.4827270507812, "top": 554.982666015625 }, "post_job_actions": { "HideDatasetActionreadmap_dataframe": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "readmap_dataframe" }, "HideDatasetActionsize_distribution_dataframe": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "size_distribution_dataframe" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", "tool_shed_repository": { "changeset_revision": "92898cc3ea19", "name": "msp_sr_readmap_and_size_histograms", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}", "tool_version": "1.2.0", "type": "tool", "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", "workflow_outputs": [ { "label": null, "output_name": "size_PDF", "uuid": "51ecda12-a282-4c56-8bd9-66f22742b301" }, { "label": null, "output_name": "combi_PDF", "uuid": "f9345f64-7f9b-440a-b12a-6d123a46800f" }, { "label": null, "output_name": "readmap_PDF", "uuid": "eb151acd-9d6d-4c30-8bc5-9124a9a3d815" } ] } }, "uuid": "35f7ef15-bb91-4eca-b8a7-345dc5cb3136" }