changeset 0:4a47903bb4df draft

planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 3d8eb2c065c7
files Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-1.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-3.ga Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga repository_dependencies.xml
diffstat 12 files changed, 6825 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,786 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 1-1", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Input Dataset Collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 211.9375, 
+                "top": 200
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "a0c5d574-7761-452f-b8ac-5e789bfdced8"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 1024.96875, 
+                "top": 963.984375
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "id": 2, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Retrieve FASTA from NCBI", 
+            "outputs": [
+                {
+                    "name": "outfilename", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "logfile", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1643.5, 
+                "top": 945.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionlogfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "logfile"
+                }, 
+                "RenameDatasetActionoutfilename": {
+                    "action_arguments": {
+                        "newname": "${ncbi_guide_ID}"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}", 
+            "tool_version": "0.9.4", 
+            "type": "tool", 
+            "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "outfilename", 
+                    "uuid": "c465ab57-4258-47c4-b7f6-5cbd4fb5db7a"
+                }
+            ]
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 420.484375, 
+                "top": 292.5
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "4d0de010-c3af-4f43-96e8-13d30f2d9e1b"
+                }
+            ]
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "id": 4, 
+            "input_connections": {
+                "input_file": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ makeblastdb", 
+            "outputs": [
+                {
+                    "name": "outfile", 
+                    "type": "data"
+                }
+            ], 
+            "position": {
+                "left": 1914.484375, 
+                "top": 1065.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "outfile"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"False\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 5, 
+            "input_connections": {
+                "input": {
+                    "id": 3, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 452.5, 
+                "top": 463.484375
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a", 
+            "workflow_outputs": []
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 6, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 5, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 602, 
+                "top": 607.5
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "32ec6fba-fb02-4edd-a3c3-3bd617e78ff2", 
+            "workflow_outputs": []
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 7, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 6, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 764, 
+                "top": 787.5
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Initial Clipped sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "7cc53603-6876-4f15-919d-177218404620", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "76dbe6c7-d553-4958-9e36-5e1c5ca41c09"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 8, 
+            "input_connections": {
+                "input": {
+                    "id": 7, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 830.484375, 
+                "top": 288.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "e22c6843-8125-49d6-9dcd-546155536f78", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "unaligned", 
+                    "uuid": "e927b3ae-279d-46fe-b099-0e22a728bfe7"
+                }
+            ]
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 9, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 8, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1099.484375, 
+                "top": 509.484375
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "31b0804f-a2bd-4d23-9a8a-d544777a92c8"
+                }
+            ]
+        }, 
+        "10": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 10, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 9, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1273.484375, 
+                "top": 800.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", 
+            "workflow_outputs": []
+        }, 
+        "11": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 11, 
+            "input_connections": {
+                "blast": {
+                    "id": 10, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 9, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1563.984375, 
+                "top": 513.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "84989771-81db-4d86-bff6-cfda892b1959", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "64263e2f-a180-42be-a440-26dea6a26ec3"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "fastaOutput", 
+                    "uuid": "fa7a0f9d-679d-4040-af20-1112aad1f73c"
+                }
+            ]
+        }, 
+        "12": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "id": 12, 
+            "input_connections": {
+                "inputSequences": {
+                    "id": 11, 
+                    "output_name": "fastaOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "cap3", 
+            "outputs": [
+                {
+                    "name": "contigsandsinglets", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "cap3stdout", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigs", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "contigsqual", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigslink", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "ace", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "info", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "singlets", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1879.484375, 
+                "top": 596.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionace": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "ace"
+                }, 
+                "HideDatasetActioncap3stdout": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "cap3stdout"
+                }, 
+                "HideDatasetActioncontigs": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigs"
+                }, 
+                "HideDatasetActioncontigslink": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigslink"
+                }, 
+                "HideDatasetActioncontigsqual": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigsqual"
+                }, 
+                "HideDatasetActioninfo": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "info"
+                }, 
+                "HideDatasetActionsinglets": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "singlets"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "1.2.0", 
+            "type": "tool", 
+            "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "contigsandsinglets", 
+                    "uuid": "d11435c3-354c-497e-8deb-b389b11a59c5"
+                }
+            ]
+        }, 
+        "13": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 13, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 4, 
+                    "output_name": "outfile"
+                }, 
+                "query": {
+                    "id": 12, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 2234.484375, 
+                "top": 956.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939", 
+            "workflow_outputs": []
+        }, 
+        "14": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "id": 14, 
+            "input_connections": {
+                "blast_tab": {
+                    "id": 13, 
+                    "output_name": "output1"
+                }, 
+                "guideSequence": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }, 
+                "sequences": {
+                    "id": 12, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "blast_to_scaffold", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 2547, 
+                "top": 838.5
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}", 
+            "tool_version": "0.9.0", 
+            "type": "tool", 
+            "uuid": "4e68c3e8-b825-40bd-ae22-a74ca7048737", 
+            "workflow_outputs": []
+        }, 
+        "15": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "id": 15, 
+            "input_connections": {
+                "input": {
+                    "id": 14, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Regex Find And Replace", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 2726.984375, 
+                "top": 1140
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Nora_MV_${ncbi_guide_ID}_guided"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_MV\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}", 
+            "tool_version": "0.1.0", 
+            "type": "tool", 
+            "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "d180a0a7-c5ff-4ab4-99ef-9bd8589dd378"
+                }
+            ]
+        }
+    }, 
+    "uuid": "6d905af0-243a-42b9-8951-a5477cfa6d88"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,709 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 1-2", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Input Dataset Collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 211.9375, 
+                "top": 200
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "940fadea-7557-4c56-a6df-c58db232b6f0"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 1024.9375, 
+                "top": 963.984375
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "9a03415f-fd4b-43ea-ae2d-c9004b97d703"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "id": 2, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Retrieve FASTA from NCBI", 
+            "outputs": [
+                {
+                    "name": "outfilename", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "logfile", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1587.5, 
+                "top": 994.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionlogfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "logfile"
+                }, 
+                "RenameDatasetActionoutfilename": {
+                    "action_arguments": {
+                        "newname": "${ncbi_guide_ID}"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}", 
+            "tool_version": "0.9.4", 
+            "type": "tool", 
+            "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "outfilename", 
+                    "uuid": "4a4625bf-6029-4f4d-b110-3bec39c97ef3"
+                }
+            ]
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 420.46875, 
+                "top": 292.5
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "54f9c80d-225e-4239-b813-bdebca04d857"
+                }
+            ]
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "id": 4, 
+            "input_connections": {
+                "input_file": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ makeblastdb", 
+            "outputs": [
+                {
+                    "name": "outfile", 
+                    "type": "data"
+                }
+            ], 
+            "position": {
+                "left": 1866.484375, 
+                "top": 1084.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "outfile"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"False\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 5, 
+            "input_connections": {
+                "input": {
+                    "id": 3, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 576.5, 
+                "top": 418.484375
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a", 
+            "workflow_outputs": []
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 6, 
+            "input_connections": {
+                "input": {
+                    "id": 5, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 830.46875, 
+                "top": 288.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "e22c6843-8125-49d6-9dcd-546155536f78", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "unaligned", 
+                    "uuid": "48d4c763-e2ec-40d5-8eec-a19107d5c41c"
+                }
+            ]
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 7, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 6, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1099.46875, 
+                "top": 509.484375
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "0e1ec8f7-c026-4982-b854-6d406ffb5d10"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 8, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 7, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1273.484375, 
+                "top": 800.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", 
+            "workflow_outputs": []
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 9, 
+            "input_connections": {
+                "blast": {
+                    "id": 8, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 7, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1563.984375, 
+                "top": 513.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "84989771-81db-4d86-bff6-cfda892b1959", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "d53d4680-1c8c-4397-8369-936ca8f283c1"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "fastaOutput", 
+                    "uuid": "082373bd-ddaf-472f-b669-0eca37d75d80"
+                }
+            ]
+        }, 
+        "10": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "id": 10, 
+            "input_connections": {
+                "inputSequences": {
+                    "id": 9, 
+                    "output_name": "fastaOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "cap3", 
+            "outputs": [
+                {
+                    "name": "contigsandsinglets", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "cap3stdout", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigs", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "contigsqual", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigslink", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "ace", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "info", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "singlets", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1924.484375, 
+                "top": 666.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionace": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "ace"
+                }, 
+                "HideDatasetActioncap3stdout": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "cap3stdout"
+                }, 
+                "HideDatasetActioncontigs": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigs"
+                }, 
+                "HideDatasetActioncontigslink": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigslink"
+                }, 
+                "HideDatasetActioncontigsqual": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigsqual"
+                }, 
+                "HideDatasetActioninfo": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "info"
+                }, 
+                "HideDatasetActionsinglets": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "singlets"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "1.2.0", 
+            "type": "tool", 
+            "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "contigsandsinglets", 
+                    "uuid": "029bd9db-59a4-4683-8136-86c80fb5e8d6"
+                }
+            ]
+        }, 
+        "11": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 11, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 4, 
+                    "output_name": "outfile"
+                }, 
+                "query": {
+                    "id": 10, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 2234.484375, 
+                "top": 956.484375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939", 
+            "workflow_outputs": []
+        }, 
+        "12": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "id": 12, 
+            "input_connections": {
+                "blast_tab": {
+                    "id": 11, 
+                    "output_name": "output1"
+                }, 
+                "guideSequence": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }, 
+                "sequences": {
+                    "id": 10, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "blast_to_scaffold", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 2535, 
+                "top": 774.5
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}", 
+            "tool_version": "0.9.0", 
+            "type": "tool", 
+            "uuid": "ca2b5401-fc07-4d46-8d5e-3a77a3e3b174", 
+            "workflow_outputs": []
+        }, 
+        "13": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "id": 13, 
+            "input_connections": {
+                "input": {
+                    "id": 12, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Regex Find And Replace", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 2726.984375, 
+                "top": 1140
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Nora_raw_reads_${ncbi_guide_ID}_guided"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_raw_reads\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}", 
+            "tool_version": "0.1.0", 
+            "type": "tool", 
+            "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "b5cf0dd9-bfe3-4021-99fe-12faf47d29e0"
+                }
+            ]
+        }
+    }, 
+    "uuid": "52976d74-fcd5-4e3c-a474-cd7aaf6e1047"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,819 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 1-3", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Input Dataset Collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 211.9271240234375, 
+                "top": 200
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "af22e150-8299-44ee-be79-a749377663ce"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 1024.9827423095703, 
+                "top": 963.9930725097656
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "71520953-6fe2-410d-a217-556ea72142e7"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "id": 2, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Retrieve FASTA from NCBI", 
+            "outputs": [
+                {
+                    "name": "outfilename", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "logfile", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1587.5001220703125, 
+                "top": 994.4965515136719
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionlogfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "logfile"
+                }, 
+                "RenameDatasetActionoutfilename": {
+                    "action_arguments": {
+                        "newname": "${ncbi_guide_ID}"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}", 
+            "tool_version": "0.9.4", 
+            "type": "tool", 
+            "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "outfilename", 
+                    "uuid": "db6977fd-e017-4f30-8be3-e20d500e45de"
+                }
+            ]
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 420.43408203125, 
+                "top": 292.50001525878906
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "f539c29e-feed-4631-9c25-83aac8ba6209"
+                }
+            ]
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "id": 4, 
+            "input_connections": {
+                "input_file": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ makeblastdb", 
+            "outputs": [
+                {
+                    "name": "outfile", 
+                    "type": "data"
+                }
+            ], 
+            "position": {
+                "left": 1866.4931640625, 
+                "top": 1084.4965515136719
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "outfile"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"False\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 5, 
+            "input_connections": {
+                "input": {
+                    "id": 3, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 382.3785400390625, 
+                "top": 522.5000228881836
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "9e2e996f-02a1-4b58-b88b-050caac31037"
+                }
+            ]
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/khmer_normalize_by_median/khmer_normalize_by_median/2.0.0", 
+            "id": 6, 
+            "input_connections": {
+                "inputs": {
+                    "id": 5, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Normalize By Median", 
+            "outputs": [
+                {
+                    "name": "sequences", 
+                    "type": "input"
+                }, 
+                {
+                    "name": "countgraph", 
+                    "type": "oxlicg"
+                }, 
+                {
+                    "name": "report", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 522.9688110351562, 
+                "top": 658.9930877685547
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionsequences": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "sequences"
+                }, 
+                "HideDatasetActioncountgraph": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "countgraph"
+                }, 
+                "HideDatasetActionreport": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "report"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/khmer_normalize_by_median/khmer_normalize_by_median/2.0.0", 
+            "tool_state": "{\"force_single_switch\": \"\\\"True\\\"\", \"cutoff\": \"\\\"20\\\"\", \"save_countgraph\": \"\\\"False\\\"\", \"parameters\": \"{\\\"type\\\": \\\"simple\\\", \\\"tablesize\\\": \\\"2e9\\\", \\\"__current_case__\\\": 0}\", \"inputs\": \"null\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"paired_switch\": \"\\\"False\\\"\", \"countgraph_to_load\": \"null\", \"unpaired_reads_filename\": \"null\"}", 
+            "tool_version": "2.0.0", 
+            "type": "tool", 
+            "uuid": "834cfd60-e0df-40e3-9d01-ecfa4296960b", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "sequences", 
+                    "uuid": "b5b133ed-e16a-43f6-bb08-796748547b5f"
+                }
+            ]
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 7, 
+            "input_connections": {
+                "input": {
+                    "id": 6, 
+                    "output_name": "sequences"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 753.9931640625, 
+                "top": 511.9965515136719
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "8480cd00-f3b5-4ddb-a140-370a0b6e8c99", 
+            "workflow_outputs": []
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 8, 
+            "input_connections": {
+                "input": {
+                    "id": 7, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 830.4341125488281, 
+                "top": 288.4895935058594
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "e22c6843-8125-49d6-9dcd-546155536f78", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "unaligned", 
+                    "uuid": "1186f277-578c-4b5c-8a62-ee2e01be8d0d"
+                }
+            ]
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 9, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 8, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1099.461898803711, 
+                "top": 509.4965515136719
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "36a26500-824f-4a91-97c1-e24a2cbdfbb5"
+                }
+            ]
+        }, 
+        "10": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 10, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 9, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1273.4896919727325, 
+                "top": 800.4861450195312
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", 
+            "workflow_outputs": []
+        }, 
+        "11": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 11, 
+            "input_connections": {
+                "blast": {
+                    "id": 10, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 9, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1563.9931640625, 
+                "top": 513.4896087646484
+            }, 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "84989771-81db-4d86-bff6-cfda892b1959", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "3a780445-58ca-491d-8634-b9c700e26218"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "fastaOutput", 
+                    "uuid": "975aa4eb-7087-4751-8d01-723f5017ec2c"
+                }
+            ]
+        }, 
+        "12": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "id": 12, 
+            "input_connections": {
+                "inputSequences": {
+                    "id": 11, 
+                    "output_name": "fastaOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "cap3", 
+            "outputs": [
+                {
+                    "name": "contigsandsinglets", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "cap3stdout", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigs", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "contigsqual", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigslink", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "ace", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "info", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "singlets", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1902.5001220703125, 
+                "top": 655.4861450195312
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionace": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "ace"
+                }, 
+                "HideDatasetActioncap3stdout": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "cap3stdout"
+                }, 
+                "HideDatasetActioncontigs": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigs"
+                }, 
+                "HideDatasetActioncontigslink": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigslink"
+                }, 
+                "HideDatasetActioncontigsqual": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigsqual"
+                }, 
+                "HideDatasetActioninfo": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "info"
+                }, 
+                "HideDatasetActionsinglets": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "singlets"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "1.2.0", 
+            "type": "tool", 
+            "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "contigsandsinglets", 
+                    "uuid": "de30b0c5-c501-433e-a4d4-e1b4441d2bb1"
+                }
+            ]
+        }, 
+        "13": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 13, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 4, 
+                    "output_name": "outfile"
+                }, 
+                "query": {
+                    "id": 12, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 2234.4967041015625, 
+                "top": 956.4930725097656
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939", 
+            "workflow_outputs": []
+        }, 
+        "14": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "id": 14, 
+            "input_connections": {
+                "blast_tab": {
+                    "id": 13, 
+                    "output_name": "output1"
+                }, 
+                "guideSequence": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }, 
+                "sequences": {
+                    "id": 12, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "blast_to_scaffold", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 2553.0731201171875, 
+                "top": 876.5625305175781
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}", 
+            "tool_version": "0.9.0", 
+            "type": "tool", 
+            "uuid": "031fbacb-303d-421d-84ee-24c9474c26d2", 
+            "workflow_outputs": []
+        }, 
+        "15": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "id": 15, 
+            "input_connections": {
+                "input": {
+                    "id": 14, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Regex Find And Replace", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 2726.9967041015625, 
+                "top": 1140.0000305175781
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Nora_Median-Norm-reads_${ncbi_guide_ID}_guided"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_Median-Norm-reads\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}", 
+            "tool_version": "0.1.0", 
+            "type": "tool", 
+            "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "dc8227de-395d-4410-98ec-b176432b5ee8"
+                }
+            ]
+        }
+    }, 
+    "uuid": "dab2601e-a95f-4f94-accc-28d265c7001e"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,462 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 1-4", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Input Dataset Collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 211.94445514678955, 
+                "top": 200.00001525878906
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "f9af6731-280d-4606-b7c3-ff6e5bc0870e"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 1024.9826965332031, 
+                "top": 963.9931259155273
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "89f3e51c-db84-4ff4-85f3-d3030a160685"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 2, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 420.4861297607422, 
+                "top": 292.5000228881836
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "5d28fac9-5b17-48b1-927d-5ae3fbcd2790"
+                }
+            ]
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 2, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 452.50001525878906, 
+                "top": 463.48961639404297
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a", 
+            "workflow_outputs": []
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 4, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 3, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 631.5972595214844, 
+                "top": 605.5903244018555
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "c700f2a8-231e-4792-a0cc-0e542d36b414", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 5, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 4, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 740.5729675292969, 
+                "top": 786.5799179077148
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Initial Clipped sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "a51f4a8a-2bea-4fc8-97a5-97af74cd4144", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "28b7e800-5b85-4a42-9af3-7399c7306071"
+                }
+            ]
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 6, 
+            "input_connections": {
+                "input": {
+                    "id": 5, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 830.4861755371094, 
+                "top": 288.4896011352539
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "e22c6843-8125-49d6-9dcd-546155536f78", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "unaligned", 
+                    "uuid": "ffe3bdf3-dea8-420a-8e04-498463c26691"
+                }
+            ]
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 7, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 6, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1099.4965515136719, 
+                "top": 509.49654388427734
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "f5bf1efc-241a-4b48-8fda-5d83ca3eb956"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 8, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 7, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1273.4895935058594, 
+                "top": 800.4861679077148
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output1", 
+                    "uuid": "c53ba510-461f-4f0d-a075-d8c97924beab"
+                }
+            ]
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 9, 
+            "input_connections": {
+                "blast": {
+                    "id": 8, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 7, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1564.9827575683594, 
+                "top": 513.489616394043
+            }, 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "fastaOutput"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"use_filters\\\": \\\"no\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "84989771-81db-4d86-bff6-cfda892b1959", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "8b327d4e-27c9-4ec3-a4f7-be8f8ea27452"
+                }
+            ]
+        }
+    }, 
+    "uuid": "50e69b15-e7a2-4e1d-8fc4-47f35223efd4"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,1006 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 2-1", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Input Dataset Collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 110.9375, 
+                "top": 269.37501525878906
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "4e1d736b-a314-441c-95ef-c4e7fbde52e6"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Blast Protein database"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 1088.5938110351562, 
+                "top": 839.96533203125
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"Blast Protein database\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "ee9f8f76-6682-4688-88ad-8263109cf051", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "18d27e4d-ada8-48e3-b69a-ce878a19d260"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.3", 
+            "id": 2, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Retrieve FASTA from NCBI", 
+            "outputs": [
+                {
+                    "name": "outfilename", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "logfile", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1736.5973052978516, 
+                "top": 1034.4966125488281
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionlogfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "logfile"
+                }, 
+                "HideDatasetActionoutfilename": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "outfilename"
+                }, 
+                "RenameDatasetActionoutfilename": {
+                    "action_arguments": {
+                        "newname": "DCV NC_001834.1 Guide"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.3", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"NC_001834.1\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}", 
+            "tool_version": "0.9.3", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 254.84375, 
+                "top": 419.3750247955322
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"50\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"accept\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "id": 4, 
+            "input_connections": {
+                "input_file": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ makeblastdb", 
+            "outputs": [
+                {
+                    "name": "outfile", 
+                    "type": "data"
+                }
+            ], 
+            "position": {
+                "left": 2035.6077270507812, 
+                "top": 918.4896545410156
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "outfile"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", 
+            "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"title\": \"\\\"DCV NC_001834.1\\\"\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"input_file\": \"null\", \"parse_seqids\": \"\\\"False\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 5, 
+            "input_connections": {
+                "input": {
+                    "id": 3, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 312.77783203125, 
+                "top": 621.3715667724609
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 6, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 5, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 482.5694580078125, 
+                "top": 420.9722480773926
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "890947a5-b6c3-4905-9659-9f4cb58ae3de", 
+            "workflow_outputs": []
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 7, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 6, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 729.6007080078125, 
+                "top": 374.9653015136719
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Initial Clipped sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "5807c11d-856f-466a-80b3-2854a13ed901", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "0104c422-daac-45f9-b56c-2b899f4f4c6f"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 8, 
+            "input_connections": {
+                "input": {
+                    "id": 7, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 722.482666015625, 
+                "top": 602.3785095214844
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "action_arguments": {
+                        "newname": "Non A. gambiae sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"AgamP4\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "unaligned", 
+                    "uuid": "e00fc25f-c655-4854-a3e3-e1f6ae204302"
+                }
+            ]
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 9, 
+            "input_connections": {
+                "input": {
+                    "id": 8, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 724.96533203125, 
+                "top": 780.3819885253906
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionunaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "unaligned"
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "action_arguments": {
+                        "newname": "unmatched Plasmodium Berghei"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "10": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 10, 
+            "input_connections": {
+                "input": {
+                    "id": 9, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 725.920166015625, 
+                "top": 996.3889465332031
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionunaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "unaligned"
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "action_arguments": {
+                        "newname": "Unaligned PhiX174"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "11": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 11, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 10, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1090.4688110351562, 
+                "top": 339.39238357543945
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "68909f85-3532-47e2-956b-73dfad6bdc5f"
+                }
+            ]
+        }, 
+        "12": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.1.06", 
+            "id": 12, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 11, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastx", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1149.49658203125, 
+                "top": 607.3785095214844
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": 0, \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"query\": \"null\", \"query_gencode\": \"\\\"1\\\"\", \"blast_type\": \"\\\"blastx\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output1", 
+                    "uuid": "2bcd52a4-3023-4f30-918d-0383c0ef4455"
+                }
+            ]
+        }, 
+        "13": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 13, 
+            "input_connections": {
+                "blast": {
+                    "id": 12, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 11, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1454.5486907958984, 
+                "top": 436.9097480773926
+            }, 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"use_filters\\\": \\\"no\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"verbose\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "32401021-0c03-4c16-a8a3-b08c54d34ce5", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "0ecb04ea-b8fe-45ce-aa11-c4a67f1e17dd"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "fastaOutput", 
+                    "uuid": "f37bfebc-7b87-4dfc-a98c-2cdc3b18a84a"
+                }
+            ]
+        }, 
+        "14": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/cherry_pick_fasta/cherry_pick_fasta/0.9.0", 
+            "id": 14, 
+            "input_connections": {
+                "input": {
+                    "id": 13, 
+                    "output_name": "fastaOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Pick Fasta sequences", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1746.0938415527344, 
+                "top": 672.5000305175781
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/cherry_pick_fasta/cherry_pick_fasta/0.9.0", 
+            "tool_state": "{\"__page__\": 0, \"input\": \"null\", \"__rerun_remap_job_id__\": null, \"query\": \"\\\"Drosophila_C_virus\\\"\"}", 
+            "tool_version": "0.9.0", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "15": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/cherry_pick_fasta/cherry_pick_fasta/0.9.0", 
+            "id": 15, 
+            "input_connections": {
+                "input": {
+                    "id": 13, 
+                    "output_name": "fastaOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Pick Fasta sequences", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1745.104248046875, 
+                "top": 765.4861450195312
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/cherry_pick_fasta/cherry_pick_fasta/0.9.0", 
+            "tool_state": "{\"__page__\": 0, \"input\": \"null\", \"__rerun_remap_job_id__\": null, \"query\": \"\\\"Cricket_paralysis_virus\\\"\"}", 
+            "tool_version": "0.9.0", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "16": {
+            "annotation": "", 
+            "content_id": "cat1", 
+            "id": 16, 
+            "input_connections": {
+                "input1": {
+                    "id": 14, 
+                    "output_name": "output"
+                }, 
+                "queries_0|input2": {
+                    "id": 15, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 1983.5938415527344, 
+                "top": 680.4861450195312
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Dicistroviridae Hits"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "cat1", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"input1\": \"null\", \"queries\": \"[{\\\"input2\\\": null, \\\"__index__\\\": 0}]\"}", 
+            "tool_version": "1.0.0", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "f73ab6cc-279f-4a9e-8860-73e3b206b9ca"
+                }
+            ]
+        }, 
+        "17": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "id": 17, 
+            "input_connections": {
+                "inputSequences": {
+                    "id": 16, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "cap3", 
+            "outputs": [
+                {
+                    "name": "contigsandsinglets", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "cap3stdout", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigs", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "contigsqual", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "contigslink", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "ace", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "info", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "singlets", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 2192.100830078125, 
+                "top": 513.489616394043
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionace": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "ace"
+                }, 
+                "HideDatasetActioncap3stdout": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "cap3stdout"
+                }, 
+                "HideDatasetActioncontigs": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigs"
+                }, 
+                "HideDatasetActioncontigslink": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigslink"
+                }, 
+                "HideDatasetActioncontigsqual": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "contigsqual"
+                }, 
+                "HideDatasetActioninfo": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "info"
+                }, 
+                "HideDatasetActionsinglets": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "singlets"
+                }, 
+                "RenameDatasetActioncontigs": {
+                    "action_arguments": {
+                        "newname": "CAP assemblies of Dicistroviridae hits"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "contigs"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", 
+            "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"null\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": 0}", 
+            "tool_version": "1.2.0", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "contigsandsinglets", 
+                    "uuid": "e413fdea-3b18-40c1-b423-cf2bd33eeadf"
+                }
+            ]
+        }, 
+        "18": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_tblastx_wrapper/0.1.06", 
+            "id": 18, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 4, 
+                    "output_name": "outfile"
+                }, 
+                "query": {
+                    "id": 17, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ tblastx", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 2424.0973510742188, 
+                "top": 837.5000305175781
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_tblastx_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": 0, \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"query\": \"null\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output1", 
+                    "uuid": "7ad377ba-ad8f-421f-af4c-6835a1994f46"
+                }
+            ]
+        }, 
+        "19": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "id": 19, 
+            "input_connections": {
+                "blast_tab": {
+                    "id": 18, 
+                    "output_name": "output1"
+                }, 
+                "guideSequence": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }, 
+                "sequences": {
+                    "id": 17, 
+                    "output_name": "contigsandsinglets"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "blast_to_scaffold", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 2718.003662109375, 
+                "top": 597.9167022705078
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "New AnCV sequences in DCV scaffold"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}", 
+            "tool_version": "0.9.0", 
+            "type": "tool", 
+            "uuid": "d6fcfcf9-1b9b-4ac3-8217-f7ddbc84be91", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "c052be17-d78e-4a17-891c-7154936c7935"
+                }
+            ]
+        }
+    }, 
+    "uuid": "ac35209c-d243-403c-95c7-5500b022ae10"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-2.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,517 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 2-2", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Input Dataset Collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 199.91314697265625, 
+                "top": 183.5937557220459
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "3b7db228-7d72-4b8a-9296-5e51ceda8cdd", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "dd803215-4fa9-4444-83df-06e42912b545"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Protein Blast database"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 1887.9861450195312, 
+                "top": 619.5659847259521
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"Protein Blast database\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "9f28fc2b-f552-4021-b6fc-ba95f6f3e8dd", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "8d19a7b0-6b52-46ee-be47-cce18eca9453"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", 
+            "id": 2, 
+            "input_connections": {
+                "library|input_1": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Bowtie2", 
+            "outputs": [
+                {
+                    "name": "output_unaligned_reads_l", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_aligned_reads_l", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_aligned_reads_r", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_unaligned_reads_r", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output", 
+                    "type": "bam"
+                }, 
+                {
+                    "name": "output_sam", 
+                    "type": "sam"
+                }, 
+                {
+                    "name": "mapping_stats", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 433.48956298828125, 
+                "top": 367.6389217376709
+            }, 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "output_name": "output_unaligned_reads_l"
+                }, 
+                "HideDatasetActionmapping_stats": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "mapping_stats"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionoutput_aligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_aligned_reads_l"
+                }, 
+                "HideDatasetActionoutput_aligned_reads_r": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_aligned_reads_r"
+                }, 
+                "HideDatasetActionoutput_sam": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_sam"
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_unaligned_reads_l"
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_r": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_unaligned_reads_r"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"aligned_file\\\": \\\"False\\\", \\\"unaligned_file\\\": \\\"True\\\", \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"indexed\\\", \\\"__current_case__\\\": 0, \\\"index\\\": \\\"AgamP4\\\"}\", \"rg\": \"{\\\"rg_selector\\\": \\\"do_not_set\\\", \\\"__current_case__\\\": 3}\", \"save_mapping_stats\": \"\\\"False\\\"\", \"analysis_type\": \"{\\\"alignment_options\\\": {\\\"alignment_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"effort_options\\\": {\\\"effort_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"sam_options\\\": {\\\"sam_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"other_options\\\": {\\\"other_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"scoring_options\\\": {\\\"scoring_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"reporting_options\\\": {\\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\", \\\"__current_case__\\\": 1}, \\\"__current_case__\\\": 1, \\\"sam_opt\\\": \\\"True\\\", \\\"input_options\\\": {\\\"int_quals\\\": \\\"False\\\", \\\"solexa_quals\\\": \\\"False\\\", \\\"skip\\\": \\\"0\\\", \\\"input_options_selector\\\": \\\"yes\\\", \\\"qv_encoding\\\": \\\"--phred33\\\", \\\"__current_case__\\\": 0, \\\"trim3\\\": \\\"20\\\", \\\"qupto\\\": \\\"100000000\\\", \\\"trim5\\\": \\\"0\\\"}}\"}", 
+            "tool_version": "2.2.6.2", 
+            "type": "tool", 
+            "uuid": "15edcf5f-9b38-4b7e-ad04-f816d1d4d126", 
+            "workflow_outputs": []
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastq_to_fasta/cshl_fastq_to_fasta/1.0.0", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 2, 
+                    "output_name": "output_unaligned_reads_l"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "FASTQ to FASTA", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 774.4097290039062, 
+                "top": 315.97223472595215
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastq_to_fasta/cshl_fastq_to_fasta/1.0.0", 
+            "tool_state": "{\"__page__\": 0, \"RENAMESEQ\": \"\\\"-r\\\"\", \"SKIPN\": \"\\\"\\\"\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.0.0", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 4, 
+            "input_connections": {
+                "input": {
+                    "id": 3, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 1005.4166717529297, 
+                "top": 303.00348472595215
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 5, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 4, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1290.5555725097656, 
+                "top": 296.59723472595215
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "1d78a822-0e08-4e92-a9f7-bc80166e36a1", 
+            "workflow_outputs": []
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 6, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 5, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1517.5521240234375, 
+                "top": 302.5868282318115
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "d6d8e36c-641a-4662-b615-0745b9d9fb55", 
+            "workflow_outputs": []
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 7, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 6, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1778.4375610351562, 
+                "top": 339.0625057220459
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"end_hash_length\": \"\\\"69\\\"\", \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"__rerun_remap_job_id__\": null, \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"start_hash_length\": \"\\\"25\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "e679f97f-a15b-479d-9154-59cd57642674"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "id": 8, 
+            "input_connections": {
+                "input": {
+                    "id": 7, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Filter sequences by length", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1956.4236450195312, 
+                "top": 213.05556297302246
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", 
+            "tool_state": "{\"__page__\": 0, \"input\": \"null\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"5000\\\"\"}", 
+            "tool_version": "1.1", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "0b517cd3-6991-4968-91e3-894446dd6d8b"
+                }
+            ]
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.1.06", 
+            "id": 9, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 8, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastx", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 2225.451416015625, 
+                "top": 313.00348472595215
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"blast_type\": \"\\\"blastx\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output1", 
+                    "uuid": "65223b13-b6fa-45ae-a927-bb96b184bb75"
+                }
+            ]
+        }, 
+        "10": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 10, 
+            "input_connections": {
+                "blast": {
+                    "id": 9, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 8, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 2559.5313720703125, 
+                "top": 128.57639122009277
+            }, 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "fastaOutput"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"use_filters\\\": \\\"no\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"verbose\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "30288e33-ff64-4089-9b45-428027744176", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "6b25acfc-474c-4852-b196-a14a4cf619e3"
+                }
+            ]
+        }
+    }, 
+    "uuid": "ea5b1974-4efa-4a30-a29c-4cfa9fd7da83"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-1.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,579 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 3-1", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Fever Patient Sequences collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 207.96875, 
+                "top": 199.90625
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Fever Patient Sequences collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "21bdc466-e175-4b9c-aacc-9ba72a877535", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "0abd6e13-fa30-4dd4-ad60-90b7fef1a8bf"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Nucleotide Viral Blast Database"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 876.109375, 
+                "top": 1158.046875
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"Nucleotide Viral Blast Database\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "8a789998-8ad6-495f-b923-d7bfd02896f4", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "05aef397-b0f5-4556-adb5-be963df7d67f"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastq_to_fasta/cshl_fastq_to_fasta/1.0.0", 
+            "id": 2, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "FASTQ to FASTA", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 256.5625, 
+                "top": 327.625
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastq_to_fasta/cshl_fastq_to_fasta/1.0.0", 
+            "tool_state": "{\"input\": \"null\", \"RENAMESEQ\": \"\\\"-r\\\"\", \"SKIPN\": \"\\\"-n\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "1.0.0", 
+            "type": "tool", 
+            "uuid": "c7160a54-8152-41b9-870e-89ecbcbcb7dc", 
+            "workflow_outputs": []
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastx_trimmer/cshl_fastx_trimmer/1.0.0", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 2, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Trim sequences", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 356.671875, 
+                "top": 500.65625
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionoutput": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastx_trimmer/cshl_fastx_trimmer/1.0.0", 
+            "tool_state": "{\"__page__\": 0, \"input\": \"null\", \"__rerun_remap_job_id__\": null, \"last\": \"\\\"27\\\"\", \"first\": \"\\\"1\\\"\"}", 
+            "tool_version": "1.0.0", 
+            "type": "tool", 
+            "uuid": "5c3a9936-166d-4cf8-9df2-db679c306d4f", 
+            "workflow_outputs": []
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 4, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 3, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 536.46875, 
+                "top": 332.515625
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "7c179cc4-e0a4-4e8a-be6f-c445d70c721e", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 5, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 4, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 773.484375, 
+                "top": 283.515625
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "reduced input dataset"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "f73e38bc-8998-4e77-9d4e-77c8748f3a71", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "2bee83a0-f312-474a-be28-8c90f7313f9f"
+                }
+            ]
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 6, 
+            "input_connections": {
+                "input": {
+                    "id": 5, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 772.625, 
+                "top": 461.625
+            }, 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionunaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"hg19\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "41108f94-dbf9-4cbe-8bd4-acdc16c9c06c", 
+            "workflow_outputs": []
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 7, 
+            "input_connections": {
+                "input": {
+                    "id": 6, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 933.671875, 
+                "top": 691.625
+            }, 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionunaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"al\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"vir1\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "3d252e09-bbcc-45d3-9878-32e4fd8a43e5", 
+            "workflow_outputs": []
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 8, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 7, 
+                    "output_name": "aligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1302.109375, 
+                "top": 849.03125
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "action_arguments": {
+                        "newname": "Oases viral contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"27\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"11\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "b73a2fa1-bf72-4ad3-b82c-e342a21a5275", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "3395237c-c08b-4623-9172-15b52e82034c"
+                }
+            ]
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.07", 
+            "id": 9, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 8, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1442.09375, 
+                "top": 1084.03125
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput1": {
+                    "action_arguments": {
+                        "newname": "blastN of oases contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.07", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": 0, \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"blast_type\": \"\\\"blastn\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"query\": \"null\"}", 
+            "tool_version": "0.1.07", 
+            "type": "tool", 
+            "uuid": "0e8b01bc-d919-4bc4-ba28-c2fde37de6b6", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output1", 
+                    "uuid": "e24552f8-47ea-44fa-b339-254d7902e2aa"
+                }
+            ]
+        }, 
+        "10": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 10, 
+            "input_connections": {
+                "blast": {
+                    "id": 9, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 8, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1837.1875, 
+                "top": 854.625
+            }, 
+            "post_job_actions": {
+                "DeleteIntermediatesActiontabularOutput": {
+                    "action_arguments": {}, 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "output_name": "tabularOutput"
+                }, 
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "fastaOutput"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"Patent\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "4acd0e30-b867-43e3-99e9-88d0c602c8f3", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "2ee6f85d-cc71-4ed1-8a40-16e98ff3d27a"
+                }
+            ]
+        }, 
+        "11": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 11, 
+            "input_connections": {
+                "input": {
+                    "id": 10, 
+                    "output_name": "tabularOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 2180.5, 
+                "top": 1016.5
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Virus identification by patient"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "b4a09441-4f8f-46ec-81ff-c2a87928d1d6", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "12afc0c5-36d1-4876-bd60-3b61e5c278f6"
+                }
+            ]
+        }
+    }, 
+    "uuid": "2757d825-19dc-4e6d-964d-724eef88b5b7"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-2.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,503 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 3-2", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Patient sequences collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 116.09375, 
+                "top": 130.59375
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Patient sequences collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "4c996dac-b8a2-4b4c-bb98-ab708c076e4e", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "13712bd9-2bed-4542-8137-737866b8537a"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Nucleotide Viral BLAST database"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 1352.578125, 
+                "top": 992.578125
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"Nucleotide Viral BLAST database\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "39d691fe-ba93-4eb1-a714-4133f03728b1", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "d92490ff-273f-4145-bc3d-ade5fca45255"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", 
+            "id": 2, 
+            "input_connections": {
+                "library|input_1": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Bowtie2", 
+            "outputs": [
+                {
+                    "name": "output_unaligned_reads_l", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_aligned_reads_l", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_aligned_reads_r", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_unaligned_reads_r", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output", 
+                    "type": "bam"
+                }, 
+                {
+                    "name": "output_sam", 
+                    "type": "sam"
+                }, 
+                {
+                    "name": "mapping_stats", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 426.5625, 
+                "top": 258.609375
+            }, 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "output_name": "output_unaligned_reads_l"
+                }, 
+                "HideDatasetActionmapping_stats": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "mapping_stats"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionoutput_aligned_reads_r": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_aligned_reads_r"
+                }, 
+                "HideDatasetActionoutput_sam": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_sam"
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_unaligned_reads_l"
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_r": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_unaligned_reads_r"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"aligned_file\\\": \\\"False\\\", \\\"unaligned_file\\\": \\\"True\\\", \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"indexed\\\", \\\"__current_case__\\\": 0, \\\"index\\\": \\\"hg19\\\"}\", \"rg\": \"{\\\"rg_selector\\\": \\\"do_not_set\\\", \\\"__current_case__\\\": 3}\", \"save_mapping_stats\": \"\\\"False\\\"\", \"analysis_type\": \"{\\\"alignment_options\\\": {\\\"alignment_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"effort_options\\\": {\\\"effort_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"sam_options\\\": {\\\"sam_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"other_options\\\": {\\\"other_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"scoring_options\\\": {\\\"scoring_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"reporting_options\\\": {\\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\", \\\"__current_case__\\\": 1}, \\\"__current_case__\\\": 1, \\\"sam_opt\\\": \\\"True\\\", \\\"input_options\\\": {\\\"input_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}}\"}", 
+            "tool_version": "2.2.6.2", 
+            "type": "tool", 
+            "uuid": "76fe9f4e-cf0b-4480-aadf-ba461c595414", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output_aligned_reads_l", 
+                    "uuid": "ec776ac8-cd59-4d76-9ad8-d82905393ad7"
+                }
+            ]
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", 
+            "id": 3, 
+            "input_connections": {
+                "library|input_1": {
+                    "id": 2, 
+                    "output_name": "output_unaligned_reads_l"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Bowtie2", 
+            "outputs": [
+                {
+                    "name": "output_unaligned_reads_l", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_aligned_reads_l", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_aligned_reads_r", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_unaligned_reads_r", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output", 
+                    "type": "bam"
+                }, 
+                {
+                    "name": "output_sam", 
+                    "type": "sam"
+                }, 
+                {
+                    "name": "mapping_stats", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 776.53125, 
+                "top": 379.59375
+            }, 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "output_name": "output_unaligned_reads_l"
+                }, 
+                "HideDatasetActionmapping_stats": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "mapping_stats"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionoutput_aligned_reads_r": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_aligned_reads_r"
+                }, 
+                "HideDatasetActionoutput_sam": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_sam"
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_unaligned_reads_l"
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_r": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_unaligned_reads_r"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"aligned_file\\\": \\\"True\\\", \\\"unaligned_file\\\": \\\"False\\\", \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"indexed\\\", \\\"__current_case__\\\": 0, \\\"index\\\": \\\"vir1\\\"}\", \"rg\": \"{\\\"rg_selector\\\": \\\"do_not_set\\\", \\\"__current_case__\\\": 3}\", \"save_mapping_stats\": \"\\\"False\\\"\", \"analysis_type\": \"{\\\"alignment_options\\\": {\\\"alignment_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"effort_options\\\": {\\\"effort_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"sam_options\\\": {\\\"sam_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"other_options\\\": {\\\"other_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"scoring_options\\\": {\\\"scoring_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"reporting_options\\\": {\\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\", \\\"__current_case__\\\": 1}, \\\"__current_case__\\\": 1, \\\"sam_opt\\\": \\\"True\\\", \\\"input_options\\\": {\\\"input_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}}\"}", 
+            "tool_version": "2.2.6.2", 
+            "type": "tool", 
+            "uuid": "5f6b3d0e-06eb-4e75-9139-b41a4d88f79a", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output_aligned_reads_l", 
+                    "uuid": "5ab6ffef-583a-4509-9732-41075eb5ed98"
+                }
+            ]
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastq_to_fasta/cshl_fastq_to_fasta/1.0.0", 
+            "id": 4, 
+            "input_connections": {
+                "input": {
+                    "id": 3, 
+                    "output_name": "output_aligned_reads_l"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "FASTQ to FASTA", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1132.09375, 
+                "top": 572.609375
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastq_to_fasta/cshl_fastq_to_fasta/1.0.0", 
+            "tool_state": "{\"input\": \"null\", \"RENAMESEQ\": \"\\\"-r\\\"\", \"SKIPN\": \"\\\"-n\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "1.0.0", 
+            "type": "tool", 
+            "uuid": "7a97429a-2900-49f1-b218-35c650a71390", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "72347b83-e33d-48e0-950e-4f9ea61d14ea"
+                }
+            ]
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 5, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 4, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1346.5625, 
+                "top": 731.578125
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"69\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "b525a58a-dd2d-48c4-ac0e-516184a53ced", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "f51ee1b3-fcfe-4db4-b341-713c1f7590dd"
+                }
+            ]
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.07", 
+            "id": 6, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 5, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1579.5625, 
+                "top": 887.59375
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.07", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": 0, \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"blast_type\": \"\\\"blastn\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"query\": \"null\"}", 
+            "tool_version": "0.1.07", 
+            "type": "tool", 
+            "uuid": "da354a9b-03b3-4aa9-b409-0689f6a3e15b", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output1", 
+                    "uuid": "a63b93b5-5870-4e7b-81bc-345ede8af734"
+                }
+            ]
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 7, 
+            "input_connections": {
+                "blast": {
+                    "id": 6, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 5, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1893.5625, 
+                "top": 649.59375
+            }, 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "fastaOutput"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"Patent\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "a2b3cb8f-ce9e-4a65-913c-44adbb1f2b41", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "beee945b-3fb7-4340-a727-06c3146717bf"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 8, 
+            "input_connections": {
+                "input": {
+                    "id": 7, 
+                    "output_name": "tabularOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 2231.5, 
+                "top": 744.5
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Virus identification by patient"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "9a01734f-c0e7-42c2-b7d6-6ed69bcf728e", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "a177238a-37d7-469b-a243-1330acc04024"
+                }
+            ]
+        }
+    }, 
+    "uuid": "c56c85ae-7cca-44ff-b732-50f75db00d0b"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-3.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,647 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 3-3", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Patient sequence collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 199.84375, 
+                "top": 200
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Patient sequence collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "21bdc466-e175-4b9c-aacc-9ba72a877535", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "0abd6e13-fa30-4dd4-ad60-90b7fef1a8bf"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Nucleotide Viral Blast Database"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 929.90625, 
+                "top": 1307.984375
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"Nucleotide Viral Blast Database\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "8a789998-8ad6-495f-b923-d7bfd02896f4", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "05aef397-b0f5-4556-adb5-be963df7d67f"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "id": 2, 
+            "input_connections": {}, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Retrieve FASTA from NCBI", 
+            "outputs": [
+                {
+                    "name": "outfilename", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "logfile", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 1234.46875, 
+                "top": 1247.96875
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionlogfile": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "logfile"
+                }, 
+                "HideDatasetActionoutfilename": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "outfilename"
+                }, 
+                "RenameDatasetActionoutfilename": {
+                    "action_arguments": {
+                        "newname": "${reference_virus}"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${reference_virus}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}", 
+            "tool_version": "0.9.4", 
+            "type": "tool", 
+            "uuid": "9f37ac80-1ccf-4b1a-8f31-41b01bf249fb", 
+            "workflow_outputs": []
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", 
+            "id": 3, 
+            "input_connections": {
+                "library|input_1": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Bowtie2", 
+            "outputs": [
+                {
+                    "name": "output_unaligned_reads_l", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_aligned_reads_l", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_aligned_reads_r", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output_unaligned_reads_r", 
+                    "type": "fastqsanger"
+                }, 
+                {
+                    "name": "output", 
+                    "type": "bam"
+                }, 
+                {
+                    "name": "output_sam", 
+                    "type": "sam"
+                }, 
+                {
+                    "name": "mapping_stats", 
+                    "type": "txt"
+                }
+            ], 
+            "position": {
+                "left": 422.96875, 
+                "top": 327.96875
+            }, 
+            "post_job_actions": {
+                "DeleteIntermediatesActionoutput_unaligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "output_name": "output_unaligned_reads_l"
+                }, 
+                "HideDatasetActionmapping_stats": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "mapping_stats"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionoutput_aligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_aligned_reads_l"
+                }, 
+                "HideDatasetActionoutput_aligned_reads_r": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_aligned_reads_r"
+                }, 
+                "HideDatasetActionoutput_sam": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_sam"
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_l": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_unaligned_reads_l"
+                }, 
+                "HideDatasetActionoutput_unaligned_reads_r": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output_unaligned_reads_r"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", 
+            "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"aligned_file\\\": \\\"True\\\", \\\"unaligned_file\\\": \\\"False\\\", \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"indexed\\\", \\\"__current_case__\\\": 0, \\\"index\\\": \\\"vir1\\\"}\", \"rg\": \"{\\\"rg_selector\\\": \\\"do_not_set\\\", \\\"__current_case__\\\": 3}\", \"save_mapping_stats\": \"\\\"False\\\"\", \"analysis_type\": \"{\\\"alignment_options\\\": {\\\"alignment_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"effort_options\\\": {\\\"effort_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"sam_options\\\": {\\\"sam_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"other_options\\\": {\\\"other_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"scoring_options\\\": {\\\"scoring_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}, \\\"analysis_type_selector\\\": \\\"full\\\", \\\"reporting_options\\\": {\\\"k\\\": \\\"1\\\", \\\"reporting_options_selector\\\": \\\"k\\\", \\\"__current_case__\\\": 1}, \\\"__current_case__\\\": 1, \\\"sam_opt\\\": \\\"True\\\", \\\"input_options\\\": {\\\"input_options_selector\\\": \\\"no\\\", \\\"__current_case__\\\": 1}}\"}", 
+            "tool_version": "2.2.6.2", 
+            "type": "tool", 
+            "uuid": "d8ac3b32-882b-4761-affd-b3f71ddb3fcb", 
+            "workflow_outputs": []
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.07", 
+            "id": 4, 
+            "input_connections": {
+                "input_file": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ makeblastdb", 
+            "outputs": [
+                {
+                    "name": "outfile", 
+                    "type": "data"
+                }
+            ], 
+            "position": {
+                "left": 1500.96875, 
+                "top": 1043.96875
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.07", 
+            "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"title\": \"\\\"reference virus blast nucleotide database\\\"\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"input_file\": \"null\", \"parse_seqids\": \"\\\"False\\\"\"}", 
+            "tool_version": "0.1.07", 
+            "type": "tool", 
+            "uuid": "6271cf86-2fa0-4f3c-8870-d1f315fb46b8", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "outfile", 
+                    "uuid": "b75966f5-1ca8-434b-9b3c-df52c467303e"
+                }
+            ]
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/anmoljh/trinityrnaseq/trinityrnaseq/r20140717", 
+            "id": 5, 
+            "input_connections": {
+                "inputs|input": {
+                    "id": 3, 
+                    "output_name": "output_aligned_reads_l"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Trinity", 
+            "outputs": [
+                {
+                    "name": "trinity_log", 
+                    "type": "txt"
+                }, 
+                {
+                    "name": "assembled_transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 765.515625, 
+                "top": 493.5
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionassembled_transcripts": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "assembled_transcripts"
+                }, 
+                "HideDatasetActiontrinity_log": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "trinity_log"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/anmoljh/trinityrnaseq/trinityrnaseq/r20140717", 
+            "tool_state": "{\"__page__\": 0, \"JM\": \"\\\"1G\\\"\", \"__rerun_remap_job_id__\": null, \"additional_params\": \"{\\\"use_additional\\\": \\\"no\\\", \\\"__current_case__\\\": 0}\", \"inputs\": \"{\\\"paired_or_single\\\": \\\"single\\\", \\\"input\\\": null, \\\"path_reinforcement_distance\\\": \\\"40\\\", \\\"__current_case__\\\": 1, \\\"library_type\\\": \\\"None\\\"}\"}", 
+            "tool_version": "r20140717", 
+            "type": "tool", 
+            "uuid": "400add87-e5bc-470a-bc3c-6d7bbff41b78", 
+            "workflow_outputs": []
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "id": 6, 
+            "input_connections": {
+                "input": {
+                    "id": 5, 
+                    "output_name": "assembled_transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Regex Find And Replace", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 794.015625, 
+                "top": 762.546875
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">\\\\\\\\1\\\", \\\"pattern\\\": \\\">(.+) len=.+\\\"}]\", \"__page__\": 0}", 
+            "tool_version": "0.1.0", 
+            "type": "tool", 
+            "uuid": "6d243d3c-511c-465a-93ee-f8df9657d4d7", 
+            "workflow_outputs": []
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.07", 
+            "id": 7, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 6, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1076.9375, 
+                "top": 1045
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput1": {
+                    "action_arguments": {
+                        "newname": "blastN of oases contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.07", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": 0, \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"blast_type\": \"\\\"blastn\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"query\": \"null\"}", 
+            "tool_version": "0.1.07", 
+            "type": "tool", 
+            "uuid": "0e8b01bc-d919-4bc4-ba28-c2fde37de6b6", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output1", 
+                    "uuid": "e24552f8-47ea-44fa-b339-254d7902e2aa"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 8, 
+            "input_connections": {
+                "blast": {
+                    "id": 7, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 6, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1266.015625, 
+                "top": 700.546875
+            }, 
+            "post_job_actions": {
+                "DeleteIntermediatesActiontabularOutput": {
+                    "action_arguments": {}, 
+                    "action_type": "DeleteIntermediatesAction", 
+                    "output_name": "tabularOutput"
+                }, 
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"0\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"Patent\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"100.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"${target_virus}\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "4acd0e30-b867-43e3-99e9-88d0c602c8f3", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "2ee6f85d-cc71-4ed1-8a40-16e98ff3d27a"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "fastaOutput", 
+                    "uuid": "237c9ef0-0371-47ee-bce3-adb65950a11b"
+                }
+            ]
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 9, 
+            "input_connections": {
+                "input": {
+                    "id": 8, 
+                    "output_name": "tabularOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 1641.5, 
+                "top": 719.5
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Global report for ${target_virus}"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "4706c38f-6012-41f5-a415-09db4d3756f3", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "cc22be79-7bf4-4c6d-888c-0620f6357564"
+                }
+            ]
+        }, 
+        "10": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.07", 
+            "id": 10, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 4, 
+                    "output_name": "outfile"
+                }, 
+                "query": {
+                    "id": 8, 
+                    "output_name": "fastaOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1813.4375, 
+                "top": 837.96875
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.07", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": 0, \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"blast_type\": \"\\\"blastn\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"query\": \"null\"}", 
+            "tool_version": "0.1.07", 
+            "type": "tool", 
+            "uuid": "6aad301d-b295-43af-ae9b-a1ec6f41da49", 
+            "workflow_outputs": []
+        }, 
+        "11": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "id": 11, 
+            "input_connections": {
+                "blast_tab": {
+                    "id": 10, 
+                    "output_name": "output1"
+                }, 
+                "guideSequence": {
+                    "id": 2, 
+                    "output_name": "outfilename"
+                }, 
+                "sequences": {
+                    "id": 8, 
+                    "output_name": "fastaOutput"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "blast_to_scaffold", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 2062.984375, 
+                "top": 1042.984375
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", 
+            "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}", 
+            "tool_version": "0.9.0", 
+            "type": "tool", 
+            "uuid": "3aea0893-96a6-427e-806b-4de7f6a3b656", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "352aeee8-286a-475d-b043-02c1e09d6a0f"
+                }
+            ]
+        }, 
+        "12": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 12, 
+            "input_connections": {
+                "input": {
+                    "id": 11, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 2401.5, 
+                "top": 1165.5
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Genome Reconstruction guided by ${reference_virus}"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "ec943b0c-8635-4f10-80fe-7b71d478d555", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "7e1c1f24-f29e-4ff1-8fd1-68dc82adb020"
+                }
+            ]
+        }
+    }, 
+    "uuid": "5d79fdae-33a6-4dd2-b0d8-eb57f2d11d32"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,445 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for remapping in Use Cases 1-1,2,3", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Read fastq files"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 199.53128051757812, 
+                "top": 207.51737213134766
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Read fastq files\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "19eaa717-5b9a-4b27-a1c4-a895fc673970"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Nora Virus Genomes"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 661.5451812744141, 
+                "top": 554.5312805175781
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Nora Virus Genomes\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "46b1caea-3a7c-4663-b2e1-6536a346567a"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 2, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 387.51739501953125, 
+                "top": 324.53126525878906
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 1, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 955.729248046875, 
+                "top": 691.7187805175781
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 4, 
+            "input_connections": {
+                "input": {
+                    "id": 2, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 552.5173950195312, 
+                "top": 226.54515075683594
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "clipped Reads"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 5, 
+            "input_connections": {
+                "input": {
+                    "id": 4, 
+                    "output_name": "out_file1"
+                }, 
+                "refGenomeSource|ownFile": {
+                    "id": 1, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 846.5451965332031, 
+                "top": 264.53126525878906
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionunaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 6, 
+            "input_connections": {
+                "input": {
+                    "id": 5, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 1188.7500610351562, 
+                "top": 518.7500305175781
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "tabular"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Read Re-mapping"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "wc_gnu", 
+            "id": 7, 
+            "input_connections": {
+                "input1": {
+                    "id": 5, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Line/Word/Character count", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1352.5174560546875, 
+                "top": 307.5173797607422
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "nbre of remapped reads"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "wc_gnu", 
+            "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"True\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.0.0", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "cdd91e78-45f2-4ec2-b426-93e20d238c4b"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", 
+            "id": 8, 
+            "input_connections": {
+                "refGenomeSource|ownFile": {
+                    "id": 3, 
+                    "output_name": "out_file1"
+                }, 
+                "refGenomeSource|series_0|input": {
+                    "id": 6, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Generate readmap and histograms from alignment files", 
+            "outputs": [
+                {
+                    "name": "readmap_dataframe", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "size_distribution_dataframe", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "readmap_PDF", 
+                    "type": "pdf"
+                }, 
+                {
+                    "name": "size_PDF", 
+                    "type": "pdf"
+                }, 
+                {
+                    "name": "combi_PDF", 
+                    "type": "pdf"
+                }
+            ], 
+            "position": {
+                "left": 1562.4827270507812, 
+                "top": 554.982666015625
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionreadmap_dataframe": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "readmap_dataframe"
+                }, 
+                "HideDatasetActionsize_distribution_dataframe": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "size_distribution_dataframe"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", 
+            "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}", 
+            "tool_version": "1.1.5", 
+            "type": "tool", 
+            "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "size_PDF", 
+                    "uuid": "51ecda12-a282-4c56-8bd9-66f22742b301"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "combi_PDF", 
+                    "uuid": "f9345f64-7f9b-440a-b12a-6d123a46800f"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "readmap_PDF", 
+                    "uuid": "eb151acd-9d6d-4c30-8bc5-9124a9a3d815"
+                }
+            ]
+        }
+    }, 
+    "uuid": "35f7ef15-bb91-4eca-b8a7-345dc5cb3136"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,348 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for remapping in Use Cases 2-1,2", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Small Read fastq files"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 199.53128051757812, 
+                "top": 207.51737785339355
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Small Read fastq files\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "bb3f50ae-6b7e-413f-bc2f-e86b8df2296b"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "AnCV genome"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 639.982666015625, 
+                "top": 510.98963737487793
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"AnCV genome\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "5551b3da-5866-4474-8bc2-0f8dfea29902", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "b0f79ec9-f874-48d0-b665-2867dfbf76ac"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 2, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 387.51739501953125, 
+                "top": 324.53126335144043
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 2, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 552.5173950195312, 
+                "top": 226.5451488494873
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }, 
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "clipped Reads"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 4, 
+            "input_connections": {
+                "input": {
+                    "id": 3, 
+                    "output_name": "out_file1"
+                }, 
+                "refGenomeSource|ownFile": {
+                    "id": 1, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 846.545166015625, 
+                "top": 264.53126335144043
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "HideDatasetActionunaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "wc_gnu", 
+            "id": 5, 
+            "input_connections": {
+                "input1": {
+                    "id": 4, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Line/Word/Character count", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1215.5208740234375, 
+                "top": 298.52430534362793
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "nbre of remapped reads"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "wc_gnu", 
+            "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"True\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.0.0", 
+            "type": "tool", 
+            "uuid": "None", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "out_file1", 
+                    "uuid": "7545c393-0ac1-4c52-b1ba-b34c2ed5462f"
+                }
+            ]
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", 
+            "id": 6, 
+            "input_connections": {
+                "refGenomeSource|ownFile": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "refGenomeSource|series_0|input": {
+                    "id": 4, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Generate readmap and histograms from alignment files", 
+            "outputs": [
+                {
+                    "name": "readmap_dataframe", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "size_distribution_dataframe", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "readmap_PDF", 
+                    "type": "pdf"
+                }, 
+                {
+                    "name": "size_PDF", 
+                    "type": "pdf"
+                }, 
+                {
+                    "name": "combi_PDF", 
+                    "type": "pdf"
+                }
+            ], 
+            "position": {
+                "left": 1204.49658203125, 
+                "top": 412.98612785339355
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionreadmap_dataframe": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "readmap_dataframe"
+                }, 
+                "HideDatasetActionsize_distribution_dataframe": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "size_distribution_dataframe"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", 
+            "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}", 
+            "tool_version": "1.1.5", 
+            "type": "tool", 
+            "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "size_PDF", 
+                    "uuid": "28a51c7e-58d9-4728-8ac0-04d252cd5943"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "combi_PDF", 
+                    "uuid": "f9aaace3-8bdb-4b83-a40b-d6d9a26fd345"
+                }, 
+                {
+                    "label": null, 
+                    "output_name": "readmap_PDF", 
+                    "uuid": "ad51fc18-9cdf-4068-bbee-269801cdbde3"
+                }
+            ]
+        }
+    }, 
+    "uuid": "e670f707-78ad-4128-8549-8a210c7dcbf1"
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/repository_dependencies.xml	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,4 @@
+<?xml version="1.0"?>
+<repositories description="These workflows require the repository suite_metavisitor_1_2">
+    <repository changeset_revision="e24919521ffb" name="suite_metavisitor_1_2" owner="drosofff" toolshed="http://toolshed.g2.bx.psu.edu" />
+</repositories>