Mercurial > repos > drosofff > msp_sr_bowtie
changeset 5:b2c1ffe6579a draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/msp_sr_bowtie commit 783b6d807f921a7214d53ddace3954d6eb5f2e5c
| author | drosofff | 
|---|---|
| date | Tue, 04 Jul 2017 18:29:02 -0400 | 
| parents | 615d2550977f | 
| children | b7173c0011f3 | 
| files | sRbowtie.py sRbowtie.xml test-data/al.fa test-data/output.tab tool_dependencies.xml | 
| diffstat | 5 files changed, 83 insertions(+), 216 deletions(-) [+] | 
line wrap: on
 line diff
--- a/sRbowtie.py Wed Nov 09 11:20:44 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,189 +0,0 @@ -#!/usr/bin/env python -# small RNA oriented bowtie wrapper -# version 1.5 17-7-2014: arg parser implementation -# Usage sRbowtie.py <1 input_fasta_file> <2 alignment method> <3 -v mismatches> <4 out_type> <5 buildIndexIfHistory> <6 fasta/bowtie index> <7 bowtie output> <8 ali_fasta> <9 unali_fasta> <10 --num-threads \${GALAXY_SLOTS:-4}> -# current rev: for bowtie __norc, move from --supress 2,6,7,8 to --supress 6,7,8. Future Parser must be updated to take into account this standardisation -# Christophe Antoniewski <drosofff@gmail.com> - -import sys -import os -import subprocess -import tempfile -import shutil -import argparse - - -def Parser(): - the_parser = argparse.ArgumentParser( - description="bowtie wrapper for small fasta reads") - the_parser.add_argument( - '--input', action="store", type=str, help="input file") - the_parser.add_argument( - '--input-format', dest="input_format", action="store", type=str, help="fasta or fastq") - the_parser.add_argument('--method', action="store", type=str, - help="RNA, unique, multiple, k_option, n_option, a_option") - the_parser.add_argument('--v-mismatches', dest="v_mismatches", action="store", - type=str, help="number of mismatches allowed for the alignments") - the_parser.add_argument( - '--output-format', dest="output_format", action="store", type=str, help="tabular, sam, bam") - the_parser.add_argument( - '--output', action="store", type=str, help="output file path") - the_parser.add_argument( - '--index-from', dest="index_from", action="store", type=str, help="indexed or history") - the_parser.add_argument('--index-source', dest="index_source", - action="store", type=str, help="file path to the index source") - the_parser.add_argument( - '--aligned', action="store", type=str, help="aligned read file path, maybe None") - the_parser.add_argument('--unaligned', action="store", - type=str, help="unaligned read file path, maybe None") - the_parser.add_argument('--num-threads', dest="num_threads", - action="store", type=str, help="number of bowtie threads") - args = the_parser.parse_args() - return args - - -def stop_err(msg): - sys.stderr.write('%s\n' % msg) - sys.exit() - - -def bowtieCommandLiner(alignment_method="RNA", v_mis="1", out_type="tabular", - aligned="None", unaligned="None", input_format="fasta", input="path", - index="path", output="path", pslots="4"): - if input_format == "fasta": - input_format = "-f" - elif (input_format == "fastq") or (input_format == "fastqsanger"): - input_format = "-q" - else: - raise Exception('input format must be one of fasta or fastq') - if alignment_method == "RNA": - x = "-v %s -M 1 --best --strata -p %s --norc --suppress 6,7,8" % ( - v_mis, pslots) - elif alignment_method == "unique": - x = "-v %s -m 1 -p %s --suppress 6,7,8" % (v_mis, pslots) - elif alignment_method == "multiple": - x = "-v %s -M 1 --best --strata -p %s --suppress 6,7,8" % ( - v_mis, pslots) - elif alignment_method == "k_option": - x = "-v %s -k 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots) - elif alignment_method == "n_option": - x = "-n %s -M 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots) - elif alignment_method == "a_option": - x = "-v %s -a --best -p %s --suppress 6,7,8" % (v_mis, pslots) - if aligned == "None" and unaligned == "None": - fasta_command = "" - elif aligned != "None" and unaligned == "None": - fasta_command = " --al %s" % aligned - elif aligned == "None" and unaligned != "None": - fasta_command = " --un %s" % unaligned - else: - fasta_command = " --al %s --un %s" % (aligned, unaligned) - x = x + fasta_command - if out_type == "tabular": - return "bowtie %s %s %s %s > %s" % (x, index, input_format, input, output) - elif out_type == "sam": - return "bowtie %s -S %s %s %s > %s" % (x, index, input_format, input, output) - elif out_type == "bam": - return "bowtie %s -S %s %s %s |samtools view -bS - > %s" % ( - x, index, input_format, input, output) - - -def bowtie_squash(fasta): - # make temp directory for bowtie indexes - tmp_index_dir = tempfile.mkdtemp() - ref_file = tempfile.NamedTemporaryFile(dir=tmp_index_dir) - ref_file_name = ref_file.name - # by default, delete the temporary file, but ref_file.name is now stored - # in ref_file_name - ref_file.close() - # symlink between the fasta source file and the deleted ref_file name - os.symlink(fasta, ref_file_name) - # bowtie command line, which will work after changing dir - # (cwd=tmp_index_dir) - cmd1 = 'bowtie-build -f %s %s' % (ref_file_name, ref_file_name) - try: - FNULL = open(os.devnull, 'w') - # a path string for a temp file in tmp_index_dir. Just a string - tmp = tempfile.NamedTemporaryFile(dir=tmp_index_dir).name - # creates and open a file handler pointing to the temp file - tmp_stderr = open(tmp, 'wb') - # both stderr and stdout of bowtie-build are redirected in dev/null - proc = subprocess.Popen( - args=cmd1, shell=True, cwd=tmp_index_dir, stderr=FNULL, stdout=FNULL) - returncode = proc.wait() - tmp_stderr.close() - FNULL.close() - sys.stdout.write(cmd1 + "\n") - except Exception as e: - # clean up temp dir - if os.path.exists(tmp_index_dir): - shutil.rmtree(tmp_index_dir) - stop_err('Error indexing reference sequence\n' + str(e)) - # no Cleaning if no Exception, tmp_index_dir has to be cleaned after - # bowtie_alignment() - # bowtie fashion path without extention - index_full_path = os.path.join(tmp_index_dir, ref_file_name) - return tmp_index_dir, index_full_path - - -def bowtie_alignment(command_line, flyPreIndexed=''): - # make temp directory just for stderr - tmp_index_dir = tempfile.mkdtemp() - tmp = tempfile.NamedTemporaryFile(dir=tmp_index_dir).name - tmp_stderr = open(tmp, 'wb') - # conditional statement for sorted bam generation viewable in Trackster - if "samtools" in command_line: - # recover the final output file name - target_file = command_line.split()[-1] - path_to_unsortedBam = os.path.join(tmp_index_dir, "unsorted.bam") - path_to_sortedBam = os.path.join(tmp_index_dir, "unsorted.bam.sorted") - first_command_line = " ".join( - command_line.split()[:-3]) + " -o " + path_to_unsortedBam + " - " - # example: bowtie -v 0 -M 1 --best --strata -p 12 --suppress 6,7,8 -S - # /home/galaxy/galaxy-dist/bowtie/Dmel/dmel-all-chromosome-r5.49 -f - # /home/galaxy/galaxy-dist/database/files/003/dataset_3460.dat - # |samtools view -bS -o /tmp/tmp_PgMT0/unsorted.bam - - # generates an "unsorted.bam.sorted.bam file", NOT an - # "unsorted.bam.sorted" file - second_command_line = "samtools sort %s %s" % ( - path_to_unsortedBam, path_to_sortedBam) - # fileno() method return the file descriptor number of tmp_stderr - p = subprocess.Popen( - args=first_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) - returncode = p.wait() - sys.stdout.write("%s\n" % first_command_line + str(returncode)) - p = subprocess.Popen( - args=second_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) - returncode = p.wait() - sys.stdout.write("\n%s\n" % second_command_line + str(returncode)) - if os.path.isfile(path_to_sortedBam + ".bam"): - shutil.copy2(path_to_sortedBam + ".bam", target_file) - else: - p = subprocess.Popen( - args=command_line, shell=True, stderr=tmp_stderr.fileno()) - returncode = p.wait() - sys.stdout.write(command_line + "\n") - tmp_stderr.close() - # cleaning if the index was created in the fly - if os.path.exists(flyPreIndexed): - shutil.rmtree(flyPreIndexed) - # cleaning tmp files and directories - if os.path.exists(tmp_index_dir): - shutil.rmtree(tmp_index_dir) - return - - -def __main__(): - args = Parser() - F = open(args.output, "w") - if args.index_from == "history": - tmp_dir, index_path = bowtie_squash(args.index_source) - else: - tmp_dir, index_path = "dummy/dymmy", args.index_source - command_line = bowtieCommandLiner(args.method, args.v_mismatches, args.output_format, - args.aligned, args.unaligned, args.input_format, args.input, - index_path, args.output, args.num_threads) - bowtie_alignment(command_line, flyPreIndexed=tmp_dir) - F.close() -if __name__ == "__main__": - __main__()
--- a/sRbowtie.xml Wed Nov 09 11:20:44 2016 -0500 +++ b/sRbowtie.xml Tue Jul 04 18:29:02 2017 -0400 @@ -1,28 +1,58 @@ -<tool id="bowtieForSmallRNA" name="sRbowtie" version="1.1.2.1"> +<tool id="bowtieForSmallRNA" name="sRbowtie" version="1.2"> <description>for FASTA small reads</description> <requirements> - <requirement type="package" version="1.1.2">bowtie</requirement> + <requirement type="package" version="1.1.2=py27_2">bowtie</requirement> <requirement type="package" version="1.2">samtools</requirement> </requirements> - <command><![CDATA[ - python '$__tool_directory__'/sRbowtie.py - --input '$input' - --input-format '$input.extension' - --method '$method' - --v-mismatches $v_mismatches - --output-format $output_format - --output '$output' - --index-from '$refGenomeSource.genomeSource' - ## the very source of the index (indexed or fasta file) - --index-source + <command detect_errors="exit_code"><![CDATA[ #if $refGenomeSource.genomeSource == "history": - '$refGenomeSource.ownFile' + bowtie-build -f $refGenomeSource.ownFile local_index && #else: - '$refGenomeSource.index.fields.path' + ln -f -s $refGenomeSource.index.fields.path local_index && + #end if + #if $input.extension == "fasta": + #set format = "-f" + #elif $input.extension == "fastq": + #set format = "-q" + #end if + + ## set the method_prefix + #if $method == "RNA": + #set method_prefix = "-v %s -M 1 --best --strata --norc" % str($v_mismatches) + #elif $method == "unique": + #set method_prefix = "-v %s -m 1" % str($v_mismatches) + #elif $method == "multiple": + #set method_prefix = "-v %s -M 1 --best --strata" % str($v_mismatches) + #elif $method == "k_option": + #set method_prefix = "-v %s -k 1 --best" % str($v_mismatches) + #elif $method == "n_option": + #set method_prefix = "-n %s -M 1 --best" % str($v_mismatches) + #elif $method == "a_option": + #set method_prefix = "-v %s -a --best" % str($v_mismatches) #end if - --aligned '$aligned' - --unaligned '$unaligned' - --num-threads \${GALAXY_SLOTS:-4} ## number of processors to be handled by bowtie + + ## set the extra_output + #if $additional_fasta == "No": + #set extra_output = "" + #elif $additional_fasta == "al": + #set extra_output = " --al %s " % str($aligned) + #elif $additional_fasta == "unal": + #set extra_output = " --un %s " % str($unaligned) + #else: + #set extra_output = " --al %s --un %s " % (str($aligned), str($unaligned)) + #end if + + #set $method_postfix = " %s %s " % ($method_prefix, $extra_output) + + ## run the bowtie alignement + #if $output_format == "tabular": + bowtie -p \${GALAXY_SLOTS:-4} $method_postfix --suppress 6,7,8 local_index $format '$input' > $output + #elif $output_format == "sam": + bowtie -p \${GALAXY_SLOTS:-4} $method_postfix -S local_index $format '$input' > '$output' + #elif $output_format == "bam": + bowtie -p \${GALAXY_SLOTS:-4} $method_postfix -S local_index $format '$input' | samtools view -u - | samtools sort -@ "\${GALAXY_SLOTS:-4}" -T tmp -O bam -o $output + #end if + ##### | samtools view -uS ]]></command> <inputs> <param format="fasta, fastq" help="Only with clipped, raw fasta files" label="Input fasta file: reads clipped from their adapter" name="input" type="data" /> @@ -118,6 +148,26 @@ <param name="output_format" value="bam" /> <output file="output2.bam" ftype="bam" compare="sim_size" delta="1000" name="output" /> </test> + <test> + <param name="genomeSource" value="history" /> + <param ftype="fasta" name="ownFile" value="297_reference.fa" /> + <param name="method" value="multiple" /> + <param ftype="fasta" name="input" value="input.fa" /> + <param name="v_mismatches" value="1" /> + <param name="output_format" value="tabular" /> + <output file="output.tab" ftype="tabular" name="output" /> + </test> + <test> + <param name="genomeSource" value="history" /> + <param ftype="fasta" name="ownFile" value="297_reference.fa" /> + <param name="method" value="multiple" /> + <param ftype="fasta" name="input" value="input.fa" /> + <param name="v_mismatches" value="1" /> + <param name="additional_fasta" value="al" /> + <param name="output_format" value="tabular" /> + <output file="output.tab" ftype="tabular" name="output" /> + <output file="al.fa" ftype="fasta" name="aligned" /> + </test> </tests> <help>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/al.fa Tue Jul 04 18:29:02 2017 -0400 @@ -0,0 +1,10 @@ +>1 +CATTCTGCGAAGAAGC +>2 +GGAGAGACGACGTCAATTACT +>3 +AATTTCGAAACTACACCTGGAAGGTAACCA +>4 +ATCGGATTTTCTTATTTATATTCAGGGTATTAAAGAATCTAT +>5 +TAAGATACTGATAAGGAAACTACCAATA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/output.tab Tue Jul 04 18:29:02 2017 -0400 @@ -0,0 +1,5 @@ +1 + FBgn0000005_297 1151 CATTCTGCGAAGAAGC +2 + FBgn0000005_297 1167 GGAGAGACGACGTCAATTACT +3 + FBgn0000005_297 1188 AATTTCGAAACTACACCTGGAAGGTAACCA +4 + FBgn0000005_297 1218 ATCGGATTTTCTTATTTATATTCAGGGTATTAAAGAATCTAT +5 + FBgn0000005_297 1260 TAAGATACTGATAAGGAAACTACCAATA
--- a/tool_dependencies.xml Wed Nov 09 11:20:44 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,9 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="bowtie" version="1.1.2"> - <repository changeset_revision="a1c1a92e13a6" name="package_bowtie_1_1_2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="samtools" version="1.2"> - <repository changeset_revision="f6ae3ba3f3c1" name="package_samtools_1_2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency>
