Mercurial > repos > drosofff > yac_clipper

comparison yac.xml @ 0:307cd074fa95 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://bitbucket.org/drosofff/gedtools/
author drosofff
date Wed, 27 May 2015 17:40:52 -0400
parents
children 8a8f62b4bf27
comparison
equal deleted inserted replaced
-1:000000000000 0:307cd074fa95
1 <tool id="yac" name="Clip adapter" version="1.3.3">
2 <description />
3 <command interpreter="python">yac.py --input $input
4 --output $output
5 --output_format "$out_format"
6 --adapter_to_clip $clip_source.clip_sequence
7 --min $min
8 --max $max
9 --Nmode $Nmode
10 </command>
11 <inputs>
12 <param format="fastq" label="Source file" name="input" type="data" />
13 <param label="min size" name="min" size="4" type="integer" value="15" />
14 <param label="max size" name="max" size="4" type="integer" value="36" />
15 <param label="Select output format" name="out_format" type="select">
16 <option selected="true" value="fasta">Fasta format</option>
17 <option value="fastq">Fastq format</option>
18 </param>
19 <param label="Accept reads containing N?" name="Nmode" type="select">
20 <option selected="True" value="accept">accept</option>
21 <option value="reject">reject</option>
22 </param>
23 <conditional name="clip_source">
24 <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select">
25 <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option>
26 <option value="user">Use custom sequence</option>
27 </param>
28 <when value="prebuilt">
29 <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select">
30 <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option>
31 <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option>
32 <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option>
33 <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option>
34 </param>
35 </when>
36 <when value="user">
37 <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" />
38 </when>
39 </conditional>
40 </inputs>
41 <outputs>
42 <data format="fasta" metadata="input" name="output" />
43 <change_format>
44 <when format="fastq" input="out_format" value="fastq" />
45 </change_format>
46 </outputs>
47 <tests>
48 <test>
49 <param ftype="fastqsanger" name="input" value="yac.fastq" />
50 <param name="min" value="18" />
51 <param name="max" value="29" />
52 <param name="clip_source_list" value="prebuilt" />
53 <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
54 <param name="Nmode" value="accept" />
55 <output file="yac.out" name="output" />
56 </test>
57 <test>
58 <param ftype="fastqsanger" name="input" value="yac.fastq" />
59 <param name="min" value="18" />
60 <param name="max" value="29" />
61 <param name="clip_source_list" value="prebuilt" />
62 <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
63 <param name="Nmode" value="accept" />
64 <param name="out_format" value="fastq" />
65 <output file="yac_fastq.out" name="output" />
66 </test>
67 </tests>
68 <help>
69 This tool clips adapter sequences from a fastq file and outputs either a
70 fasta or fastq file of clipped reads with renumbered fasta/fastq headers.
71
72 By defualt clipped sequences with unknown nucleotides are kept, but
73 can be discarded by setting "Accept reads containing N?" to reject.
74
75 Min size and max size filter clipped reads on their size.
76
77 Note that unclipped reads that satisfy the min and max size conditions are kept.
78 </help>
79 </tool>