# HG changeset patch
# User edward-kirton
# Date 1307482049 14400
# Node ID 38e2b656eb2808daa99aa5cc35a0b6327ff96cad

Migrated tool version 1.0.1 from old tool shed archive to new tool shed repository

diff -r 000000000000 -r 38e2b656eb28 lucy/lucy.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/lucy/lucy.xml	Tue Jun 07 17:27:29 2011 -0400
@@ -0,0 +1,62 @@
+<tool id="lucy" name="LUCY trimmer" version='1.0.1' description="Less Useful Chunks Yank">
+<command interpreter='perl'>psub -l galaxy_normal.c --fasta $fasta_infile --cat $fasta_outfile --cat $qual_outfile
+lucy -quiet -xtra 8 
+-error $max_avg_error $max_error_at_ends
+-bracket $bracket_window_size $bracket_max_avg_error
+#if $vector.vector_select == '1':
+-vector $vector.vector_fasta_infile $vector.splice_fasta_infile
+#end if
+-output $fasta_outfile $qual_outfile
+$fasta_infile $qual_infile
+</command>
+
+	<inputs>
+		<param name="fasta_infile" type="data" format="fasta" label="Read sequences (Fasta)"/>
+		<param name="qual_infile" type="data" format="qual454" label="Qual scores input file (qual454)"/>
+        <param name="max_avg_error" type="text" value='.007' label="max average error"/>
+        <param name="max_error_at_ends" type="text" value='.007' label="max error at ends"/>
+        <param name="bracket_window_size" type="integer" value='20' label="bracket window size"/>
+        <param name="bracket_max_avg_error" type="text" value='.007' label="bracket max average error"/>
+
+        <conditional name='vector'>
+            <param name="vector_select" type="select" label="Do you have vector sequence files?" >
+                <option value="0">no, just trim by quality alone</option>
+                <option value="1">yes</option>
+            </param>
+            <when value='1'>
+                <param name="vector_fasta_infile" type="data" format="fasta" label="Complete cloning vector sequence (Fasta)"/>
+                <param name="splice_fasta_infile" type="data" format="fasta" label="Subsequence before and after each insert site (Fasta)"/>
+            </when>
+            <when value='0'>
+            </when>
+        </conditional>
+	</inputs>
+	<outputs>
+		<data name="fasta_outfile" format="fasta"/>
+		<data name="qual_outfile" format="qual454"/>
+	</outputs>
+	<help>
+Less Useful Chunks Yank (lucy) is a utility that prepares raw DNA sequence fragments for sequence assembly.
+It performs quality end-trimming and optionally removal of primer/vector sequences or filtering contamination.
+
+---	
+
+Each sequence in the output sequence file begins with a header that includes its name, three pass along 
+clone length values to the fragment assembly program, and a left and right marker denoting the begin and
+end of the good quality, vector free region. The following is an example of lucy output::
+
+	&gt;GCCAA03TF 1500 3000 2000 43 490 
+	AGCCAAGTTTGCAGCCCTGCAGGTCGACTCTAGAGGATCCCCAGGATGATCAGCCACATT 
+	GGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATCTTGCGCAATGG 
+	GCGAAAGCCTGACGCAGCCATGCCGCGTGAATGATGAAGGTCTTAGGATTGTAAAATTCT 
+	TTCACCGGGGACGATAATGACGGTACCCGGAGAAGAAGCCCCGGCTAACTTCGTGCCAGC
+	...
+
+---
+
+**Manual**
+
+http://galaxy.jgi-psf.org/static/manuals/lucy.pdf
+
+	</help>
+</tool>
diff -r 000000000000 -r 38e2b656eb28 lucy/lucy_wrapper.sh
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/lucy/lucy_wrapper.sh	Tue Jun 07 17:27:29 2011 -0400
@@ -0,0 +1,2 @@
+#!/bin/bash
+$* 2>&1