Mercurial > repos > fabio > btman
comparison query.xml @ 0:315246810bfa draft
Uploaded 20180404
author | fabio |
---|---|
date | Tue, 03 Apr 2018 20:27:39 -0400 |
parents | |
children | a4abcc1e7459 |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:315246810bfa |
---|---|
1 <?xml version="1.0"?> | |
2 <tool name="BloomTree Manager - Query" id="btman_query" version="1.0.0"> | |
3 <description>the Sequence Bloom Tree</description> | |
4 <requirements> | |
5 <requirement type="package" version="2.7.10">python</requirement> | |
6 <requirement type="package" version="2.18.4">requests</requirement> | |
7 </requirements> | |
8 <command detect_errors="exit_code"> | |
9 <![CDATA[ | |
10 python '$__tool_directory__/query.py' | |
11 | |
12 --search 'rrr' | |
13 --sthreshold ${sthreshold} | |
14 --exact 0 | |
15 | |
16 #if $conditional_input.inputtype == '0': | |
17 #set file_paths = ','.join( [ str( $f ) for $f in $conditional_input.txtfiles ] ) | |
18 #if $file_paths is not 'None': | |
19 --files '${file_paths}' | |
20 #set file_names = ','.join( [ str( $f.name ) for $f in $conditional_input.txtfiles ] ) | |
21 --names '${file_names}' | |
22 #end if | |
23 #elif $conditional_input.inputtype == '1': | |
24 --sequences '${conditional_input.sequences}' | |
25 #end if | |
26 | |
27 --outputdir 'collection_content' | |
28 --errorfile 'Error Log File' | |
29 ]]> | |
30 </command> | |
31 <inputs> | |
32 <conditional name="conditional_input"> | |
33 <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input"> | |
34 <option value="0" selected="true">By file</option> | |
35 <option value="1">By manually inserted text</option> | |
36 </param> | |
37 <when value="0"> | |
38 <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="false" help="Select one or more tabular files containing (ID, TRANSCRIPT) couples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." /> | |
39 </when> | |
40 <when value="1"> | |
41 <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="false" help="Insert a list of (ID, TRANSCRIPT) couples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." /> | |
42 </when> | |
43 </conditional> | |
44 <param name="sthreshold" size="3" type="float" value="0.7" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." /> | |
45 </inputs> | |
46 <outputs> | |
47 <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection"> | |
48 <discover_datasets pattern="(?P<identifier_0>[^_]+)_(?P<ext>[^_]+)" directory="collection_content" ext="auto" /> | |
49 </collection> | |
50 </outputs> | |
51 | |
52 <help><![CDATA[ | |
53 This Query tool is part of the BloomTree Manager Framework that allow to rapidly identify all publicly available | |
54 sequenced samples which express a transcript of interest. | |
55 | |
56 ---- | |
57 | |
58 The input for this tool is a list of (ID, TRANSCRIPT) couples, one for each line, | |
59 in a tab delimited format:: | |
60 | |
61 id0 CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA | |
62 id1 TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT | |
63 ... | |
64 idn CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC | |
65 | |
66 The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets. | |
67 Any additional character will be trimmed out. | |
68 | |
69 The output of the tool is a collection that contains a file for each ID with a list of | |
70 accession numbers representing the samples that express one particular transcript. | |
71 | |
72 ---- | |
73 | |
74 .. class:: infomark | |
75 | |
76 **Notes** | |
77 | |
78 This Galaxy tool has been developed by Fabio Cumbo. | |
79 | |
80 Please visit this GithHub_repository_ for more information about the BloomTree Manager | |
81 | |
82 .. _GithHub_repository: https://github.com/fabio-cumbo/bloomtree-manager | |
83 ]]></help> | |
84 | |
85 <citations> | |
86 <citation type="doi">10.1101/090464</citation> | |
87 </citations> | |
88 </tool> |