Mercurial > repos > fabio > sbtas_se

comparison query.xml @ 10:027f2e9d4a25 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded 20180131
author fabio
date Wed, 31 Jan 2018 17:29:01 -0500
parents 35593423c2e2
children 039e8e1e8b1f
comparison
equal deleted inserted replaced
9:f9ba0b65e1fa 10:027f2e9d4a25
32 <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input"> 32 <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input">
33 <option value="0" selected="true">By file</option> 33 <option value="0" selected="true">By file</option>
34 <option value="1">By manually inserted text</option> 34 <option value="1">By manually inserted text</option>
35 </param> 35 </param>
36 <when value="0"> 36 <when value="0">
37 <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." /> 37 <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
38 </when> 38 </when>
39 <when value="1"> 39 <when value="1">
40 <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." /> 40 <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
41 </when> 41 </when>
42 </conditional> 42 </conditional>
43 <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." /> 43 <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
44 </inputs> 44 </inputs>
45 <outputs> 45 <outputs>
57 **Example** 57 **Example**
58 58
59 The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line, 59 The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line,
60 in a tab delimited format:: 60 in a tab delimited format::
61 61
62 seq_id_0 CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA 62 id0 CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA
63 seq_id_1 TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT 63 id1 TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT
64 ... 64 ...
65 seq_id_n CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC 65 idn CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC
66
67 The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets.
68 Any additional characters will be trimmed out.
66 69
67 The output of the tool is a collection that contains a file for each ID with a list of 70 The output of the tool is a collection that contains a file for each ID with a list of
68 accession numbers representing the samples that express one particular transcript. 71 accession numbers representing the samples that express one particular transcript.
69 72
70 ---- 73 ----