--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/query.py	Wed Jan 31 11:28:53 2018 -0500
@@ -0,0 +1,174 @@
+#!/usr/bin/env python
+
+# https://github.com/ross/requests-futures
+# http://docs.python-requests.org/en/master/user/quickstart/#more-complicated-post-requests
+
+import os, uuid, optparse, requests, json, time
+#from requests_futures.sessions import FuturesSession
+
+#### NN14 ####
+service_url = "http://nn14.galaxyproject.org:8080/";
+#service_url = "http://127.0.0.1:8082/";
+query_url = service_url+"tree/0/query";
+status_url = service_url+"status/<task_id>";
+##############
+
+def query_request( options, args, payload ):
+    # add additional parameters to the payload
+    #payload["tree_id"] = str(options.treeid);
+    payload["search_mode"] = str(options.search);
+    payload["exact_algorithm"] = int(options.exact);
+    payload["search_threshold"] = float(options.sthreshold);
+    # set the content type to application/json
+    headers = {'Content-type': 'application/json'};
+
+    # create a session
+    session = requests.Session();
+    # make a synchronous post request to the query route
+    req = session.post(query_url, headers=headers, json=payload);
+    resp_code = req.status_code;
+    #print(str(req.content)+"\n\n");
+    if resp_code == requests.codes.ok:
+        resp_content = str(req.content);
+        # convert out to json
+        json_content = json.loads(resp_content);
+        # retrieve task id
+        task_id = json_content['task_id'];
+        task_processed = False;
+        # results json content
+        json_status_content = None;
+        task_status = None;
+        while task_processed is False:
+            # create a new session
+            session = requests.Session();
+            # make a synchronous get request to the status route
+            status_query_url = status_url.replace("<task_id>", task_id);
+            status_req = session.get(status_query_url);
+            status_resp_content = str(status_req.content);
+            #print(status_resp_content+"\n\n");
+            # convert out to json
+            json_status_content = json.loads(status_resp_content);
+            # take a look at the state
+            # state attribute is always available
+            if json_status_content['state'] == 'SUCCESS':
+                task_processed = True;
+                break;
+            elif json_status_content['state'] in ['FAILURE', 'REVOKED']:
+                return "Task status: "+str(json_status_content['state']);
+            else:
+                time.sleep(60); # in seconds
+        
+        # get output dir (collection) path
+        output_dir_path = options.outputdir;
+        if not os.path.exists(output_dir_path):
+            os.makedirs(output_dir_path);
+        out_file_format = "txt";
+
+        for block in json_status_content['results']:
+            seq_id = block['sequence_id'];
+            accessions = block['accession_numbers'];
+            # put response block in the output collection
+            output_file_path = os.path.join(output_dir_path, seq_id + "_" + out_file_format);
+            accessions_list = "";
+            for accession_number in accessions:
+                accessions_list = accessions_list + accession_number + "\n";
+            with open(output_file_path, 'w') as out:
+                out.write(accessions_list.strip());
+    else:
+        return "Unable to query the remote server. Please try again in a while.";
+
+def query( options, args ):
+    multiple_data = {};
+    comma_sep_file_paths = options.files;
+    #print("files: "+str(comma_sep_file_paths)+" - "+str(type(comma_sep_file_paths)));
+    # check if options.files contains at least one file path
+    if comma_sep_file_paths is not None:
+        # split file paths
+        file_paths = comma_sep_file_paths.split(",");
+        # split file names
+        comma_sep_file_names = str(options.names);
+        #print("names: "+str(comma_sep_file_names));
+        file_names = comma_sep_file_names.split(",");
+        for idx, file_path in enumerate(file_paths):
+            #file_name = file_names[idx];
+            with open(file_path, 'r') as content_file:
+                for line in content_file:
+                    if line.strip() != "":
+                        line_split = line.strip().split("__tc__"); # split on tab
+                        if len(line_split) == 2: # 0:id , 1:seq , otherwise skip line
+                            seq_id = line_split[0];
+                            seq_text = line_split[1];
+                            if seq_id in multiple_data:
+                                return "Error: the id '"+seq_id+"' is duplicated";
+                            multiple_data[seq_id] = seq_text;
+        if len(multiple_data) > 0:
+            return async_request( options, args,  multiple_data );
+            #return echo( options, args );
+        else:
+            return "An error has occurred. Please be sure that your input files are valid.";
+    else:
+        # try with the sequence in --sequence
+        text_content = options.sequences;
+        #print("sequences: "+text_content);
+        # check if options.sequences contains a list of sequences (one for each row)
+        if text_content is not None:
+            text_content = str(text_content);
+            if text_content.strip():
+                # populate a dictionary with the files containing the sequences to query
+                text_content = text_content.strip().split("__cn__"); # split on new line
+                for line in text_content:
+                    if line.strip() != "":
+                        line_split = line.strip().split("__tc__"); # split on tab
+                        if len(line_split) == 2: # 0:id , 1:seq , otherwise skip line
+                            seq_id = line_split[0];
+                            seq_text = line_split[1];
+                            if seq_id in multiple_data:
+                                return "Error: the id '"+seq_id+"' is duplicated";
+                            multiple_data[seq_id] = seq_text;
+                if len(multiple_data) > 0:
+                    return async_request( options, args, multiple_data );
+                    #return echo( options, args );
+                else:
+                    return "An error has occurred. Please be sure that your input files are valid.";
+            else:
+                return "You have to insert at least one row formatted as a tab delimited <id, sequence> touple";
+    return -1;
+
+def __main__():
+    # Parse the command line options
+    usage = "Usage: query.py --files comma_sep_file_paths --names comma_seq_file_names --sequences sequences_text --search search_mode --exact exact_alg --sthreshold threshold --outputdir output_dir_path";
+    parser = optparse.OptionParser(usage = usage);
+    parser.add_option("-f", "--files", type="string",
+                    action="store", dest="files", help="comma separated files path");
+    parser.add_option("-n", "--names", type="string",
+                    action="store", dest="names", help="comma separated names associated to the files specified in --files");
+    parser.add_option("-s", "--sequences", type="string",
+                    action="store", dest="sequences", help="contains a list of sequences (one for each row)");
+    parser.add_option("-a", "--fasta", type="string",
+                    action="store", dest="fasta", help="contains the content of a fasta file");
+    parser.add_option("-x", "--search", type="string", default=0,
+                    action="store", dest="search", help="search mode");
+    parser.add_option("-e", "--exact", type="int", default=0,
+                    action="store", dest="exact", help="exact algorithm (required if search is 1 only)");
+    parser.add_option("-t", "--sthreshold", type="float",
+                    action="store", dest="sthreshold", help="threshold applied to the search algrithm");
+    parser.add_option("-o", "--outputdir", type="string",
+                    action="store", dest="outputdir", help="output directory (collection) path");
+
+    #parser.add_option("-k", "--outfile", type="string",
+                    #action="store", dest="outfile", help="output file");
+    
+    # TEST
+    #--search 'rrr'
+    #--sthreshold 0.5
+    #--exact 0
+    #--sequences 'id0__tc__CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC'
+    #--outputdir 'collection_content'
+    #sequences = 'id0__tc__CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC';
+    #print(sequences);
+    #(options, args) = parser.parse_args(['-x', 'rrr', '-t', 0.5, '-s', sequences, '-o', 'collection_content']);
+    
+    (options, args) = parser.parse_args();
+    return query( options, args );
+
+if __name__ == "__main__": __main__()