Mercurial > repos > fabio > sbtas_se
diff query.py @ 4:35593423c2e2 draft
Uploaded 20180131
author | fabio |
---|---|
date | Wed, 31 Jan 2018 11:28:53 -0500 |
parents | |
children | 97dd57f81d77 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/query.py Wed Jan 31 11:28:53 2018 -0500 @@ -0,0 +1,174 @@ +#!/usr/bin/env python + +# https://github.com/ross/requests-futures +# http://docs.python-requests.org/en/master/user/quickstart/#more-complicated-post-requests + +import os, uuid, optparse, requests, json, time +#from requests_futures.sessions import FuturesSession + +#### NN14 #### +service_url = "http://nn14.galaxyproject.org:8080/"; +#service_url = "http://127.0.0.1:8082/"; +query_url = service_url+"tree/0/query"; +status_url = service_url+"status/<task_id>"; +############## + +def query_request( options, args, payload ): + # add additional parameters to the payload + #payload["tree_id"] = str(options.treeid); + payload["search_mode"] = str(options.search); + payload["exact_algorithm"] = int(options.exact); + payload["search_threshold"] = float(options.sthreshold); + # set the content type to application/json + headers = {'Content-type': 'application/json'}; + + # create a session + session = requests.Session(); + # make a synchronous post request to the query route + req = session.post(query_url, headers=headers, json=payload); + resp_code = req.status_code; + #print(str(req.content)+"\n\n"); + if resp_code == requests.codes.ok: + resp_content = str(req.content); + # convert out to json + json_content = json.loads(resp_content); + # retrieve task id + task_id = json_content['task_id']; + task_processed = False; + # results json content + json_status_content = None; + task_status = None; + while task_processed is False: + # create a new session + session = requests.Session(); + # make a synchronous get request to the status route + status_query_url = status_url.replace("<task_id>", task_id); + status_req = session.get(status_query_url); + status_resp_content = str(status_req.content); + #print(status_resp_content+"\n\n"); + # convert out to json + json_status_content = json.loads(status_resp_content); + # take a look at the state + # state attribute is always available + if json_status_content['state'] == 'SUCCESS': + task_processed = True; + break; + elif json_status_content['state'] in ['FAILURE', 'REVOKED']: + return "Task status: "+str(json_status_content['state']); + else: + time.sleep(60); # in seconds + + # get output dir (collection) path + output_dir_path = options.outputdir; + if not os.path.exists(output_dir_path): + os.makedirs(output_dir_path); + out_file_format = "txt"; + + for block in json_status_content['results']: + seq_id = block['sequence_id']; + accessions = block['accession_numbers']; + # put response block in the output collection + output_file_path = os.path.join(output_dir_path, seq_id + "_" + out_file_format); + accessions_list = ""; + for accession_number in accessions: + accessions_list = accessions_list + accession_number + "\n"; + with open(output_file_path, 'w') as out: + out.write(accessions_list.strip()); + else: + return "Unable to query the remote server. Please try again in a while."; + +def query( options, args ): + multiple_data = {}; + comma_sep_file_paths = options.files; + #print("files: "+str(comma_sep_file_paths)+" - "+str(type(comma_sep_file_paths))); + # check if options.files contains at least one file path + if comma_sep_file_paths is not None: + # split file paths + file_paths = comma_sep_file_paths.split(","); + # split file names + comma_sep_file_names = str(options.names); + #print("names: "+str(comma_sep_file_names)); + file_names = comma_sep_file_names.split(","); + for idx, file_path in enumerate(file_paths): + #file_name = file_names[idx]; + with open(file_path, 'r') as content_file: + for line in content_file: + if line.strip() != "": + line_split = line.strip().split("__tc__"); # split on tab + if len(line_split) == 2: # 0:id , 1:seq , otherwise skip line + seq_id = line_split[0]; + seq_text = line_split[1]; + if seq_id in multiple_data: + return "Error: the id '"+seq_id+"' is duplicated"; + multiple_data[seq_id] = seq_text; + if len(multiple_data) > 0: + return async_request( options, args, multiple_data ); + #return echo( options, args ); + else: + return "An error has occurred. Please be sure that your input files are valid."; + else: + # try with the sequence in --sequence + text_content = options.sequences; + #print("sequences: "+text_content); + # check if options.sequences contains a list of sequences (one for each row) + if text_content is not None: + text_content = str(text_content); + if text_content.strip(): + # populate a dictionary with the files containing the sequences to query + text_content = text_content.strip().split("__cn__"); # split on new line + for line in text_content: + if line.strip() != "": + line_split = line.strip().split("__tc__"); # split on tab + if len(line_split) == 2: # 0:id , 1:seq , otherwise skip line + seq_id = line_split[0]; + seq_text = line_split[1]; + if seq_id in multiple_data: + return "Error: the id '"+seq_id+"' is duplicated"; + multiple_data[seq_id] = seq_text; + if len(multiple_data) > 0: + return async_request( options, args, multiple_data ); + #return echo( options, args ); + else: + return "An error has occurred. Please be sure that your input files are valid."; + else: + return "You have to insert at least one row formatted as a tab delimited <id, sequence> touple"; + return -1; + +def __main__(): + # Parse the command line options + usage = "Usage: query.py --files comma_sep_file_paths --names comma_seq_file_names --sequences sequences_text --search search_mode --exact exact_alg --sthreshold threshold --outputdir output_dir_path"; + parser = optparse.OptionParser(usage = usage); + parser.add_option("-f", "--files", type="string", + action="store", dest="files", help="comma separated files path"); + parser.add_option("-n", "--names", type="string", + action="store", dest="names", help="comma separated names associated to the files specified in --files"); + parser.add_option("-s", "--sequences", type="string", + action="store", dest="sequences", help="contains a list of sequences (one for each row)"); + parser.add_option("-a", "--fasta", type="string", + action="store", dest="fasta", help="contains the content of a fasta file"); + parser.add_option("-x", "--search", type="string", default=0, + action="store", dest="search", help="search mode"); + parser.add_option("-e", "--exact", type="int", default=0, + action="store", dest="exact", help="exact algorithm (required if search is 1 only)"); + parser.add_option("-t", "--sthreshold", type="float", + action="store", dest="sthreshold", help="threshold applied to the search algrithm"); + parser.add_option("-o", "--outputdir", type="string", + action="store", dest="outputdir", help="output directory (collection) path"); + + #parser.add_option("-k", "--outfile", type="string", + #action="store", dest="outfile", help="output file"); + + # TEST + #--search 'rrr' + #--sthreshold 0.5 + #--exact 0 + #--sequences 'id0__tc__CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC' + #--outputdir 'collection_content' + #sequences = 'id0__tc__CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC'; + #print(sequences); + #(options, args) = parser.parse_args(['-x', 'rrr', '-t', 0.5, '-s', sequences, '-o', 'collection_content']); + + (options, args) = parser.parse_args(); + return query( options, args ); + +if __name__ == "__main__": __main__()