Mercurial > repos > fabio > sbtas_se
diff query.xml @ 4:35593423c2e2 draft
Uploaded 20180131
| author | fabio |
|---|---|
| date | Wed, 31 Jan 2018 11:28:53 -0500 |
| parents | |
| children | 027f2e9d4a25 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/query.xml Wed Jan 31 11:28:53 2018 -0500 @@ -0,0 +1,86 @@ +<?xml version="1.0"?> +<tool name="Query" id="sbtas_se_query" version="1.0.0"> + <description>the AllSome Sequence Bloom Tree</description> + <requirements> + <requirement type="package" version="2.7.10">python</requirement> + <requirement type="package" version="2.18.4">requests</requirement> + </requirements> + <command detect_errors="exit_code"> +<![CDATA[ + python '$__tool_directory__/query.py' + + --search 'rrr' + --sthreshold ${sthreshold} + --exact 0 + + #if $conditional_input.inputtype == '0': + #set file_paths = ','.join( [ str( $f ) for $f in $conditional_input.txtfiles ] ) + #if $file_paths is not 'None': + --files '${file_paths}' + #set file_names = ','.join( [ str( $f.name ) for $f in $conditional_input.txtfiles ] ) + --names '${file_names}' + #end if + #elif $conditional_input.inputtype == '1': + --sequences '${conditional_input.sequences}' + #end if + + --outputdir 'collection_content' +]]> + </command> + <inputs> + <conditional name="conditional_input"> + <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input"> + <option value="0" selected="true">By file</option> + <option value="1">By manually inserted text</option> + </param> + <when value="0"> + <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." /> + </when> + <when value="1"> + <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." /> + </when> + </conditional> + <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." /> + </inputs> + <outputs> + <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection"> + <discover_datasets pattern="(?P<identifier_0>[^_]+)_(?P<ext>[^_]+)" directory="collection_content" ext="tabular" /> + </collection> + </outputs> + + <help><![CDATA[ +The AllSome Sequence Bloom Tree Search Engine is a fast querying tool to identify all publicly available +sequenced samples which express a transcript of interest. + +---- + +**Example** + +The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line, +in a tab delimited format:: + + seq_id_0 CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA + seq_id_1 TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT + ... + seq_id_n CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC + +The output of the tool is a collection that contains a file for each ID with a list of +accession numbers representing the samples that express one particular transcript. + +---- + +.. class:: infomark + +**Notes** + +This Galaxy tool has been developed by Fabio Cumbo. + +Please visit this GithHub_repository_ for more information about the AllSome Sequence Bloom Tree Search Engine + +.. _GithHub_repository: https://github.com/fabio-cumbo/bloomtree-allsome-search-engine + ]]></help> + + <citations> + <citation type="doi">10.1101/090464</citation> + </citations> +</tool>
