view query.xml @ 16:b71df3e43248 draft

Uploaded 20180201
author fabio
date Thu, 01 Feb 2018 17:28:21 -0500
parents e780b47013df
children dd3c4fd64402
line wrap: on
line source

<?xml version="1.0"?>
<tool name="Query" id="sbtas_se_query" version="1.0.0">
    <description>the AllSome Sequence Bloom Tree</description>
    <requirements>
        <requirement type="package" version="2.7.10">python</requirement>
        <requirement type="package" version="2.18.4">requests</requirement>
    </requirements>
    <command detect_errors="exit_code">
<![CDATA[
    python '$__tool_directory__/query.py'
    
    --search 'rrr'
    --sthreshold ${sthreshold}
    --exact 0
    
    #if $conditional_input.inputtype == '0':
        #set file_paths = ','.join( [ str( $f ) for $f in $conditional_input.txtfiles ] )
        #if $file_paths is not 'None':
            --files '${file_paths}'
            #set file_names = ','.join( [ str( $f.name ) for $f in $conditional_input.txtfiles ] )
                --names '${file_names}'
        #end if
    #elif $conditional_input.inputtype == '1':
        --sequences '${conditional_input.sequences}'
    #end if

    --outputdir 'collection_content'
    --errorfile 'Error Log File'
]]>
    </command>
    <inputs>
        <conditional name="conditional_input">
            <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input">
                <option value="0" selected="true">By file</option>
                <option value="1">By manually inserted text</option>
            </param>
            <when value="0">
                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="false" help="Select one or more tabular files containing (ID, TRANSCRIPT) couples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
            </when>
            <when value="1">
                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="false" help="Insert a list of (ID, TRANSCRIPT) couples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
            </when>
        </conditional>            
        <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
    </inputs>
    <outputs>
        <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection">
            <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="auto" />
        </collection>
    </outputs>

    <help><![CDATA[
The AllSome Sequence Bloom Tree Search Engine is a fast querying tool to identify all publicly available 
sequenced samples which express a transcript of interest.

----

The input for this tool is a list of (ID, TRANSCRIPT) couples, one for each line,
in a tab delimited format::
    
    id0  CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA
    id1  TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT
    ...
    idn  CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC

The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets.
Any additional characters will be trimmed out.

The output of the tool is a collection that contains a file for each ID with a list of
accession numbers representing the samples that express one particular transcript.

----

.. class:: infomark

**Notes**

This Galaxy tool has been developed by Fabio Cumbo.

Please visit this GithHub_repository_ for more information about the AllSome Sequence Bloom Tree Search Engine

.. _GithHub_repository: https://github.com/fabio-cumbo/bloomtree-allsome-search-engine
    ]]></help>

    <citations>
        <citation type="doi">10.1101/090464</citation>
    </citations>
</tool>