# HG changeset patch
# User fabio
# Date 1519418714 18000
# Node ID 7944301895cb4beb9399ae3351b5798bc16f66bf
# Parent  604e373b3b45452fb26e7affe656ef52328317b6
Uploaded 20180223

diff -r 604e373b3b45 -r 7944301895cb ._.shed.yml
Binary file ._.shed.yml has changed
diff -r 604e373b3b45 -r 7944301895cb ._example.tsv
Binary file ._example.tsv has changed
diff -r 604e373b3b45 -r 7944301895cb ._query.py
Binary file ._query.py has changed
diff -r 604e373b3b45 -r 7944301895cb ._query.xml
Binary file ._query.xml has changed
diff -r 604e373b3b45 -r 7944301895cb query.xml
--- a/query.xml	Fri Feb 23 13:21:20 2018 -0500
+++ b/query.xml	Fri Feb 23 15:45:14 2018 -0500
@@ -64,7 +64,7 @@
     idn  CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC
 
 The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets.
-Any additional characters will be trimmed out.
+Any additional character will be trimmed out.
 
 The output of the tool is a collection that contains a file for each ID with a list of
 accession numbers representing the samples that express one particular transcript.