Mercurial > repos > galaxyp > pepquery

comparison pepquery.xml @ 2:5b5a9f59e2c7 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproteomics/tools-galaxyp/tree/master/tools/pepquery commit 8b553bb3e585b03c670a3689d4fe6eef7e464407"
author galaxyp
date Mon, 15 Mar 2021 12:52:03 +0000
parents 528bcf03e561
children
comparison
equal deleted inserted replaced
1:528bcf03e561 2:5b5a9f59e2c7
1 <tool id="pepquery" name="PepQuery" version="@VERSION@.0"> 1 <tool id="pepquery" name="PepQuery" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@">
2 <description>Peptide-centric search engine for novel peptide identification and validation.</description> 2 <description>Peptide-centric search engine for novel peptide identification and validation.</description>
3 <macros> 3 <macros>
4 <import>macros.xml</import> 4 <import>macros.xml</import>
5 </macros> 5 </macros>
6 <requirements> 6 <requirements>
7 <requirement type="package" version="@VERSION@">pepquery</requirement> 7 <requirement type="package" version="@TOOL_VERSION@">pepquery</requirement>
8 </requirements> 8 </requirements>
9 <stdio> 9 <stdio>
10 <exit_code range="1:" level="fatal" description="Failed" /> 10 <exit_code range="1:" level="fatal" description="Failed" />
11 <regex match="Exception" 11 <regex match="Exception"
12 source="stderr" 12 source="stderr"
17 #import re 17 #import re
18 #set $spectrum_file = $re.sub('\s','_',$re.sub('[.][^.]*$','',$req_inputs.spectrum_file.display_name.split('/')[-1])) + ".mgf" 18 #set $spectrum_file = $re.sub('\s','_',$re.sub('[.][^.]*$','',$req_inputs.spectrum_file.display_name.split('/')[-1])) + ".mgf"
19 #set $db_file = $re.sub('\s','_',$re.sub('[.][^.]*$','',$req_inputs.db_file.display_name.split('/')[-1])) + ".fa" 19 #set $db_file = $re.sub('\s','_',$re.sub('[.][^.]*$','',$req_inputs.db_file.display_name.split('/')[-1])) + ".fa"
20 ln -s '$req_inputs.spectrum_file' '$spectrum_file' && 20 ln -s '$req_inputs.spectrum_file' '$spectrum_file' &&
21 ln -s '$req_inputs.db_file' '$db_file' && 21 ln -s '$req_inputs.db_file' '$db_file' &&
22 #if $req_inputs.tags.tagType == 'pFind':
23 pepquery main.java.util.generateTags '$req_inputs.tags.qry_res' > qry.tags &&
24 #end if
22 pepquery 25 pepquery
23 -ms '$spectrum_file' 26 -ms '$spectrum_file'
24 -db '$db_file' 27 -db '$db_file'
25 #if $req_inputs.input_type.input_type_selector == 'peptide' 28 #if $req_inputs.input_type.input_type_selector == 'peptide'
26 -pep '$req_inputs.input_type.multiple.input' 29 -pep '$req_inputs.input_type.multiple.input'
40 -anno '$req_inputs.input_type.anno' 43 -anno '$req_inputs.input_type.anno'
41 #end if 44 #end if
42 #end if 45 #end if
43 #end if 46 #end if
44 -indexType $req_inputs.indexType 47 -indexType $req_inputs.indexType
48 #if $req_inputs.tags.tagType == 'PepQuery':
49 -tag '$req_inputs.tags.tag_file'
50 -tagIndexType $req_inputs.tags.tagIndexType
51 #elif $req_inputs.tags.tagType == 'pFind':
52 -tag qry.tags
53 -tagIndexType 2
54 #end if
45 #if $modifications.fixed_mod 55 #if $modifications.fixed_mod
46 -fixMod '$modifications.fixed_mod' 56 -fixMod '$modifications.fixed_mod'
47 #end if 57 #end if
48 #if $modifications.var_mod 58 #if $modifications.var_mod
49 -varMod '$modifications.var_mod' 59 -varMod '$modifications.var_mod'
71 ]]> 81 ]]>
72 </command> 82 </command>
73 <inputs> 83 <inputs>
74 <section name="req_inputs" title="Input Data" expanded="true"> 84 <section name="req_inputs" title="Input Data" expanded="true">
75 <conditional name="input_type"> 85 <conditional name="input_type">
76 <param name="input_type_selector" type="select" label="Input Type" argument="-t" help="" > 86 <param name="input_type_selector" argument="-t" type="select" label="Input Type" help="" >
77 <option value="peptide">peptide</option> 87 <option value="peptide">peptide</option>
78 <option value="1">protein</option> 88 <option value="1">protein</option>
79 <option value="2">DNA (translate to protein sequences)</option> 89 <option value="2">DNA (translate to protein sequences)</option>
80 <!-- these are not working with pepquery version 1.3 90 <!-- these are not working with pepquery version 1.6
81 <option value="3">VCF (translate to protein sequences)</option> 91 <option value="3">VCF (translate to protein sequences)</option>
82 <option value="4">BED (translate to protein sequences)</option> 92 <option value="4">BED (translate to protein sequences)</option>
83 <option value="5">GTF (translate to protein sequences)</option> 93 <option value="5">GTF (translate to protein sequences)</option>
84 --> 94 -->
85 </param> 95 </param>
88 <param name="peptide_input_selector" type="select" label="Peptides?"> 98 <param name="peptide_input_selector" type="select" label="Peptides?">
89 <option value="multiple">Peptide list from your history</option> 99 <option value="multiple">Peptide list from your history</option>
90 <option value="single">Single peptide entered as text</option> 100 <option value="single">Single peptide entered as text</option>
91 </param> 101 </param>
92 <when value="multiple"> 102 <when value="multiple">
93 <param name="input" type="data" format="txt" label="Peptide Sequences (.txt)" argument="-pep" help="Peptide sequence file containing peptides which you want to search (no column header, 1 peptide per line)." /> 103 <param name="input" argument="-pep" type="data" format="txt" label="Peptide Sequences (.txt)" help="Peptide sequence file containing peptides which you want to search (no column header, 1 peptide per line)." />
94 </when> 104 </when>
95 <when value="single"> 105 <when value="single">
96 <param name="input" type="text" label="Peptide Sequence" argument="-pep" help="Peptide sequence which you want to search"> 106 <param name="input" argument="-pep" type="text" label="Peptide Sequence" help="Peptide sequence which you want to search">
97 <validator type="regex" message="Must be AA letters">^[AC-IK-NP-TV-Yac-ik-np-tv-y]+$</validator> 107 <validator type="regex" message="Must be AA letters">^[AC-IK-NP-TV-Yac-ik-np-tv-y]+$</validator>
98 </param> 108 </param>
99 </when> 109 </when>
100 </conditional> 110 </conditional>
101 </when> 111 </when>
104 <param name="protein_input_selector" type="select" label="Proteins?"> 114 <param name="protein_input_selector" type="select" label="Proteins?">
105 <option value="multiple">Protein fasta from your history</option> 115 <option value="multiple">Protein fasta from your history</option>
106 <option value="single">Single protein entered as text</option> 116 <option value="single">Single protein entered as text</option>
107 </param> 117 </param>
108 <when value="multiple"> 118 <when value="multiple">
109 <param name="input" type="data" format="fasta" label="Protein Sequences (.txt)" argument="-i" help="Protein fasta file containing proteins which you want to search." /> 119 <param name="input" argument="-i" type="data" format="fasta" label="Protein Sequences (.txt)" help="Protein fasta file containing proteins which you want to search." />
110 </when> 120 </when>
111 <when value="single"> 121 <when value="single">
112 <param name="input" type="text" label="Protein Sequence" argument="-i" help="Protein sequence which you want to search"> 122 <param name="input" argument="-i" type="text" label="Protein Sequence" help="Protein sequence which you want to search">
113 <validator type="regex" message="Must be AA letters">^[AC-IK-NP-TV-Yac-ik-np-tv-y]+$</validator> 123 <validator type="regex" message="Must be AA letters">^[AC-IK-NP-TV-Yac-ik-np-tv-y]+$</validator>
114 </param> 124 </param>
115 </when> 125 </when>
116 </conditional> 126 </conditional>
117 </when> 127 </when>
118 <when value="2"> 128 <when value="2">
119 <param name="input" type="text" label="DNA Sequence (at least 60 bp)" argument="-i" help="DNA sequence which you want to search"> 129 <param name="input" argument="-i" type="text" label="DNA Sequence (at least 60 bp)" help="DNA sequence which you want to search">
120 <validator type="regex" message="Must be at least 60bp">^[acgtuAGCTU]{60}[acgtuAGCTU]*$</validator> 130 <validator type="regex" message="Must be at least 60bp">^[acgtuAGCTU]{60}[acgtuAGCTU]*$</validator>
121 </param> 131 </param>
122 <param name="frame" type="select" label="Frame(s) for DNA translation" argument="-f" multiple="true" help="The frame(s) to translate DNA sequence to protein. Selecting nothing (default) keeps the longest frame"> 132 <param name="frame" argument="-f" type="select" label="Frame(s) for DNA translation" multiple="true" help="The frame(s) to translate DNA sequence to protein. Selecting nothing (default) keeps the longest frame">
123 <option value="1">1</option> 133 <option value="1">1</option>
124 <option value="2">2</option> 134 <option value="2">2</option>
125 <option value="3">3</option> 135 <option value="3">3</option>
126 <option value="4">4</option> 136 <option value="4">4</option>
127 <option value="5">5</option> 137 <option value="5">5</option>
128 <option value="6">6</option> 138 <option value="6">6</option>
129 </param> 139 </param>
130 </when> 140 </when>
131 <!-- these are not working with pepquery version 1.3 141 <!-- these are not working with pepquery version 1.6
132 <when value="3"> 142 <when value="3">
133 <param name="input" type="data" format="vcf" label="VCF File" argument="-i" help="" /> 143 <param name="input" type="data" format="vcf" label="VCF File" argument="-i" help="" />
134 <param name="anno" type="data_collection" label="Annotation Files" argument="-anno" help="Annotation files for the VCF file. Please follow preparation instructions here: http://bioconductor.org/packages/devel/bioc/html/PGA.html" /> 144 <param name="anno" type="data_collection" label="Annotation Files" argument="-anno" help="Annotation files for the VCF file. Please follow preparation instructions here: http://bioconductor.org/packages/devel/bioc/html/PGA.html" />
135 </when> 145 </when>
136 <when value="4"> 146 <when value="4">
141 <param name="input" type="data" format="gtf" label="GTF File" argument="-i" help="" /> 151 <param name="input" type="data" format="gtf" label="GTF File" argument="-i" help="" />
142 <param name="anno" type="data_collection" label="Annotation Files" argument="-anno" help="Annotation files for the GTF file. Please follow preparation instructions here: http://bioconductor.org/packages/devel/bioc/html/PGA.html" /> 152 <param name="anno" type="data_collection" label="Annotation Files" argument="-anno" help="Annotation files for the GTF file. Please follow preparation instructions here: http://bioconductor.org/packages/devel/bioc/html/PGA.html" />
143 </when> 153 </when>
144 --> 154 -->
145 </conditional> 155 </conditional>
146 <param name="db_file" type="data" format="fasta" label="Protein Reference Database File" argument="-db" help="an input sequence that matches a reference will be ignored." /> 156 <param name="db_file" argument="-db" type="data" format="fasta" label="Protein Reference Database File" help="an input sequence that matches a reference will be ignored." />
147 <param name="spectrum_file" type="data" format="mgf" label="Spectrum File" argument="-ms" help="Spectrum file used for identification, mgf format" /> 157 <param name="spectrum_file" argument="-ms" type="data" format="mgf" label="Spectrum File" help="Spectrum file used for identification, mgf format" />
148 <param name="indexType" type="select" label="Report Spectrum Scan as" argument="-indexType" help="" > 158 <param name="indexType" argument="-indexType" type="select" label="Report Spectrum Scan as" help="" >
149 <option value="1" selected="true">index (1-based) in MGF</option> 159 <option value="1" selected="true">index (1-based) in MGF</option>
150 <option value="2">spectrum title in MGF</option> 160 <option value="2">spectrum title in MGF</option>
151 </param> 161 </param>
162 <conditional name="tags">
163 <param name="tagType" type="select" label="Tag File">
164 <option value="None">None</option>
165 <option value="PepQuery">PepQuery</option>
166 <option value="pFind">pFind</option>
167 </param>
168 <when value="None"/>
169 <when value="PepQuery">
170 <param name="tag_file" argument="-tag" type="data" format="txt" label="PepPuery Tag File"/>
171 <param name="tagIndexType" argument="-tagIndexType" type="select" label="Tag File Index Type" help="pFind uses the spectrum title" >
172 <option value="1">index (1-based) in MGF</option>
173 <option value="2" selected="true">spectrum title in MGF</option>
174 </param>
175 </when>
176 <when value="pFind">
177 <param name="qry_res" type="data" format="txt" label="pFind .qry.res" help="pFind can be used to generate a tags file for no-enzyme immunopeptidomics search" />
178 </when>
179 </conditional>
152 </section> 180 </section>
181
182 <!--
183 <section name="tags" title="Tags File" expanded="false">
184 <param name="qry_res" type="data" format="txt" optional="true" label="pFind .qry.res" help="pFind can be used to generate a tags file for no-enzyme immunopeptidomics search" />
185 </section>
186 -->
153 <section name="modifications" title="Modifications" expanded="false"> 187 <section name="modifications" title="Modifications" expanded="false">
154 <param name="fixed_mod" type="select" label="Fixed modification(s)" multiple="true" argument="-fixMod" help="Fixed modification"> 188 <param name="fixed_mod" argument="-fixMod" type="select" label="Fixed modification(s)" multiple="true" help="Fixed modification">
155 <option value="6" selected="true">Carbamidomethylation of C (57.02146372057) modaa</option> 189 <option value="6" selected="true">Carbamidomethylation of C (57.02146372057) modaa</option>
156 <option value="117">Oxidation of M (15.99491461956) modaa</option> 190 <option value="117">Oxidation of M (15.99491461956) modaa</option>
157 <expand macro="modifications" /> 191 <expand macro="modifications" />
158 </param> 192 </param>
159 <param name="var_mod" type="select" label="Variable modification(s)" multiple="true" argument="-varMod" help="Variable modification" > 193 <param name="var_mod" argument="-varMod" type="select" label="Variable modification(s)" multiple="true" help="Variable modification" >
160 <option value="117" selected="true">Oxidation of M (15.99491461956) modaa</option> 194 <option value="117" selected="true">Oxidation of M (15.99491461956) modaa</option>
161 <option value="6">Carbamidomethylation of C (57.02146372057) modaa</option> 195 <option value="6">Carbamidomethylation of C (57.02146372057) modaa</option>
162 <expand macro="modifications" /> 196 <expand macro="modifications" />
163 </param> 197 </param>
164 <param name="max_mods" type="integer" label="Max Modifications" value="3" argument="-maxVar" help="Max number of variable modifications" /> 198 <param name="max_mods" argument="-maxVar" type="integer" label="Max Modifications" value="3" help="Max number of variable modifications" />
165 <param name="unmodified" type="boolean" truevalue="-um" falsevalue="" checked="false" label="Unmodified?" argument="-um" help="Validation with unrestricted modification searching" /> 199 <param name="unmodified" argument="-um" type="boolean" truevalue="-um" falsevalue="" checked="false" label="Unmodified?" help="Validation with unrestricted modification searching" />
166 <param name="aa" type="boolean" truevalue="-aa" falsevalue="" checked="false" label="Consider amino acid substitution modifications?" argument="-aa" help="Whether or not to consider aa substitution modifications when perform modification filtering." /> 200 <param name="aa" argument="-aa" type="boolean" truevalue="-aa" falsevalue="" checked="false" label="Consider amino acid substitution modifications?" help="Whether or not to consider aa substitution modifications when perform modification filtering." />
167 </section> 201 </section>
168 <section name="ms_params" title="Mass spectrometer" expanded="false"> 202 <section name="ms_params" title="Mass spectrometer" expanded="false">
169 <section name="tolerance_params" title="Tolerance" expanded="true"> 203 <section name="tolerance_params" title="Tolerance" expanded="true">
170 <param name="precursor_tolerance" type="integer" value="10" label="Precursor Tolerance" argument="-tol" help="the error window on experimental peptide mass values. This parameter is usually set according to the mass spectrometer which was used to generate the MS/MS data." /> 204 <param name="precursor_tolerance" argument="-tol" type="integer" value="10" label="Precursor Tolerance" help="the error window on experimental peptide mass values. This parameter is usually set according to the mass spectrometer which was used to generate the MS/MS data." />
171 <param name="precursor_unit" type="select" label="Precursor Unit" argument="-tolu" help="The unit of precursor ion m/z tolerance"> 205 <param name="precursor_unit" argument="-tolu" type="select" label="Precursor Unit" help="The unit of precursor ion m/z tolerance">
172 <option value="ppm" selected="true">ppm</option> 206 <option value="ppm" selected="true">ppm</option>
173 <option value="Da">Da</option> 207 <option value="Da">Da</option>
174 </param> 208 </param>
175 <param name="tolerance" type="float" value="0.6" label="Tolerance" argument="-itol" help="Error window for MS/MS fragment ion mass values in Da unit." /> 209 <param name="tolerance" argument="-itol" type="float" value="0.6" label="Tolerance" help="Error window for MS/MS fragment ion mass values in Da unit." />
176 </section> 210 </section>
177 <section name="digestion" title="Digestion" expanded="false"> 211 <section name="digestion" title="Digestion" expanded="false">
178 <param name="enzyme" type="select" label="Enzyme" argument="-e" help="Enzyme used for protein digestion" > 212 <param name="enzyme" argument="-e" type="select" label="Enzyme" help="Enzyme used for protein digestion" >
179 <option value="0">Non enzyme</option> 213 <option value="0">Non enzyme</option>
180 <option value="1" selected="true">Trypsin</option> 214 <option value="1" selected="true">Trypsin</option>
181 <option value="2">Trypsin (no P rule)</option> 215 <option value="2">Trypsin (no P rule)</option>
182 <option value="3">Arg-C</option> 216 <option value="3">Arg-C</option>
183 <option value="4">Arg-C (no P rule)</option> 217 <option value="4">Arg-C (no P rule)</option>
184 <option value="5">Arg-N</option> 218 <option value="5">Arg-N</option>
185 <option value="6">Glu-C</option> 219 <option value="6">Glu-C</option>
186 <option value="7">Lys-C</option> 220 <option value="7">Lys-C</option>
187 </param> 221 </param>
188 <param name="max_missed_cleavages" type="integer" value="2" label="Max Missed Cleavages" argument="-c" help="The max missed cleavages" /> 222 <param name="max_missed_cleavages" argument="-c" type="integer" value="2" label="Max Missed Cleavages" help="The max missed cleavages" />
189 </section> 223 </section>
190 <section name="search" title="PSM" expanded="false"> 224 <section name="search" title="PSM" expanded="false">
191 <param name="frag_method" type="select" label="Fragmentation Method" argument="-fragmentMethod"> 225 <param name="frag_method" argument="-fragmentMethod" type="select" label="Fragmentation Method">
192 <option value="1" selected="true">CID/HCD</option> 226 <option value="1" selected="true">CID/HCD</option>
193 <option value="2">ETD</option> 227 <option value="2">ETD</option>
194 </param> 228 </param>
195 <param name="scoring_method" type="select" label="Scoring Method" argument="-m"> 229 <param name="scoring_method" argument="-m" type="select" label="Scoring Method">
196 <option value="1" selected="true">HyperScore</option> 230 <option value="1" selected="true">HyperScore</option>
197 <option value="2">MVH</option> 231 <option value="2">MVH</option>
198 </param> 232 </param>
199 <param name="max_charge" type="integer" value="3" label="Max Charge" argument="-maxCharge" help="The maximum charge to consider if the charge state is not available" /> 233 <param name="max_charge" argument="-maxCharge" type="integer" value="3" label="Max Charge" help="The maximum charge to consider if the charge state is not available" />
200 <param name="min_charge" type="integer" value="2" label="Minimum Charge" argument="-minCharge" help="The minimum charge to consider if the charge state is not available" /> 234 <param name="min_charge" argument="-minCharge" type="integer" value="2" label="Minimum Charge" help="The minimum charge to consider if the charge state is not available" />
201 <param name="min_peaks" type="integer" value="10" label="Minimum Peaks" argument="-minPeaks" help="Min peaks in spectrum" /> 235 <param name="min_peaks" argument="-minPeaks" type="integer" value="10" label="Minimum Peaks" help="Min peaks in spectrum" />
202 <param name="min_score" type="integer" value="12" label="Minimum Score" argument="-minScore" help="Minimum score to consider for peptide searching" /> 236 <param name="min_score" argument="-minScore" type="integer" value="12" label="Minimum Score" help="Minimum score to consider for peptide searching" />
203 <param name="max_length" type="integer" value="45" label="Maximum length of peptide" argument="-maxLength" help="The maximum length of peptide to consider." /> 237 <param name="max_length" argument="-maxLength" type="integer" value="45" label="Maximum length of peptide" help="The maximum length of peptide to consider." />
204 <param name="num_random_peptides" type="integer" value="1000" label="Number of Random Peptides" argument="-n" help="The number of random peptides" /> 238 <param name="num_random_peptides" argument="-n" type="integer" value="1000" label="Number of Random Peptides" help="The number of random peptides" />
205 </section> 239 </section>
206 </section> 240 </section>
207 <param name="report_spectrum_file" type="boolean" truevalue="spectrum_file," falsevalue="" checked="false" label="Add spectrum_file column" help="Add a spectrum_file column before the spectrum_title column. Useful for combining pepquery outputs." /> 241 <param name="report_spectrum_file" type="boolean" truevalue="spectrum_file," falsevalue="" checked="false" label="Add spectrum_file column" help="Add a spectrum_file column before the spectrum_title column. Useful for combining pepquery outputs." />
208 </inputs> 242 </inputs>
209 <outputs> 243 <outputs>
210 <data format="tabular" name="psm_annotation" from_work_dir="pepquery_output/psm_annotation.txt" label="${tool.name} on ${on_string}: PSM Annotation"> 244 <data name="query_tags" format="tabular" from_work_dir="qry.tags" label="${tool.name} on ${on_string}: tag file">
245 <filter>req_inputs['tags']['tagType'] in ['pFind']</filter>
246 </data>
247 <data name="psm_annotation" format="tabular" from_work_dir="pepquery_output/psm_annotation.txt" label="${tool.name} on ${on_string}: PSM Annotation">
211 <actions> 248 <actions>
212 <action name="comment_lines" type="metadata" default="1" /> 249 <action name="comment_lines" type="metadata" default="1" />
213 <action name="column_names" type="metadata" default="peptide,Query,calc_mr,observed_mz,charge,pepSeq,m_label,m_mz,m_intensity,mz,intensity" /> 250 <action name="column_names" type="metadata" default="peptide,Query,calc_mr,observed_mz,charge,pepSeq,m_label,m_mz,m_intensity,mz,intensity" />
214 </actions> 251 </actions>
215 </data> 252 </data>
216 <data format="tabular" name="detail" from_work_dir="pepquery_output/detail.txt" label="${tool.name} on ${on_string}: Detail"> 253 <data name="detail" format="tabular" from_work_dir="pepquery_output/detail.txt" label="${tool.name} on ${on_string}: Detail">
217 <actions> 254 <actions>
218 <action name="comment_lines" type="metadata" default="1" /> 255 <action name="comment_lines" type="metadata" default="1" />
219 <action name="column_names" type="metadata" default="${report_spectrum_file}spectrum_title,peptide,modification,pep_mass,score" /> 256 <action name="column_names" type="metadata" default="${report_spectrum_file}spectrum_title,peptide,modification,pep_mass,score" />
220 </actions> 257 </actions>
221 </data> 258 </data>
222 <data format="tabular" name="psm" from_work_dir="pepquery_output/psm.txt" label="${tool.name} on ${on_string}: PSM"> 259 <data name="psm" format="tabular" from_work_dir="pepquery_output/psm.txt" label="${tool.name} on ${on_string}: PSM">
223 <actions> 260 <actions>
224 <action name="comment_lines" type="metadata" default="1" /> 261 <action name="comment_lines" type="metadata" default="1" />
225 <action name="column_names" type="metadata" default="peptide,modification,n,${report_spectrum_file}spectrum_title,charge,exp_mass,ppm,pep_mass,mz,score,n_db,total_db,n_random,total_random,pvalue" /> 262 <action name="column_names" type="metadata" default="peptide,modification,n,${report_spectrum_file}spectrum_title,charge,exp_mass,ppm,pep_mass,mz,score,n_db,total_db,n_random,total_random,pvalue" />
226 </actions> 263 </actions>
227 </data> 264 </data>
228 <data format="tabular" name="psm_rank_txt" from_work_dir="pepquery_output/psm_rank.txt" label="${tool.name} on ${on_string}: PSM Rank (txt)"> 265 <data name="psm_rank_txt" format="tabular" from_work_dir="pepquery_output/psm_rank.txt" label="${tool.name} on ${on_string}: PSM Rank (txt)">
229 <actions> 266 <actions>
230 <action name="comment_lines" type="metadata" default="1" /> 267 <action name="comment_lines" type="metadata" default="1" />
231 <action name="column_names" type="metadata" default="peptide,modification,n,${report_spectrum_file}spectrum_title,charge,exp_mass,ppm,pep_mass,mz,score,n_db,total_db,n_random,total_random,pvalue,rank,n_ptm" /> 268 <action name="column_names" type="metadata" default="peptide,modification,n,${report_spectrum_file}spectrum_title,charge,exp_mass,ppm,pep_mass,mz,score,n_db,total_db,n_random,total_random,pvalue,rank,n_ptm" />
232 </actions> 269 </actions>
233 </data> 270 </data>
234 <data format="mgf" name="psm_rank_mgf" from_work_dir="pepquery_output/psm_rank.mgf" label="${tool.name} on ${on_string}: PSM Rank (mgf)"/> 271 <data name="psm_rank_mgf" format="mgf" from_work_dir="pepquery_output/psm_rank.mgf" label="${tool.name} on ${on_string}: PSM Rank (mgf)"/>
235 </outputs> 272 </outputs>
236 <tests> 273 <tests>
274 <!-- Test-1 -->
237 <test> 275 <test>
238 <section name="req_inputs"> 276 <section name="req_inputs">
239 <conditional name="input_type"> 277 <conditional name="input_type">
240 <param name="input_type_selector" value="peptide"/> 278 <param name="input_type_selector" value="peptide"/>
241 <conditional name="multiple"> 279 <conditional name="multiple">
276 </section> 314 </section>
277 <param name="report_spectrum_file" value="true"/> 315 <param name="report_spectrum_file" value="true"/>
278 <output name="psm_rank_txt"> 316 <output name="psm_rank_txt">
279 <assert_contents> 317 <assert_contents>
280 <has_text text="ELGSSDLTAR" /> 318 <has_text text="ELGSSDLTAR" />
319 <has_line_matching expression="ELGSSDLTAR\tiTRAQ 4-plex of peptide N-term@0\S+\t2\tiTRAQ_f4.mgf\t2\t2\t1191.6\d+\t2.0\d+\t1191.62\d+\t596.81\d+\t18.68\d+\t0\t20\t5\t995\t0.006\d+\t1"/>
281 </assert_contents> 320 </assert_contents>
282 </output> 321 </output>
283 </test> 322 </test>
284 323
324 <!-- Test-2 -->
285 <test> 325 <test>
286 <section name="req_inputs"> 326 <section name="req_inputs">
287 <conditional name="input_type"> 327 <conditional name="input_type">
288 <param name="input_type_selector" value="peptide"/> 328 <param name="input_type_selector" value="peptide"/>
289 <conditional name="multiple"> 329 <conditional name="multiple">
325 <param name="report_spectrum_file" value="true"/> 365 <param name="report_spectrum_file" value="true"/>
326 <output name="psm_rank_txt"> 366 <output name="psm_rank_txt">
327 <assert_contents> 367 <assert_contents>
328 <has_text text="ELGSSDLTAR" /> 368 <has_text text="ELGSSDLTAR" />
329 <has_text text="SPYREFTDHLVK" /> 369 <has_text text="SPYREFTDHLVK" />
370 <has_line_matching expression="SPYREFTDHLVK\tiTRAQ 4-plex of K@12\S+;iTRAQ 4-plex of peptide N-term@0\S+\t1\tiTRAQ_f4.mgf\t4\t3\t1778.\d+\t3.02\d+\t1778.95\d+\t593.99\d+\t12.17\d+\t2\t14\t-1\t-1\t100.0\t1"/>
330 </assert_contents> 371 </assert_contents>
331 </output> 372 </output>
332 </test> 373 </test>
333 374
375 <!-- Test-3 -->
376 <test>
377 <section name="req_inputs">
378 <conditional name="input_type">
379 <param name="input_type_selector" value="peptide"/>
380 <conditional name="multiple">
381 <param name="peptide_input_selector" value="multiple" />
382 <param name="input" ftype="tabular" value="novel_peptides"/>
383 </conditional>
384 </conditional>
385 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
386 <param name="spectrum_file" ftype="mgf" value="iTRAQ_f4.mgf"/>
387 </section>
388 <section name="modifications">
389 <param name="fixed_mod" value="6,103,157"/>
390 <param name="var_mod" value="117"/>
391 <param name="max_mods" value="3"/>
392 <param name="unmodified" value="True"/>
393 <param name="aa" value="True"/>
394 </section>
395 <section name="ms_params">
396 <section name="tolerance_params">
397 <param name="precursor_tolerance" value="10"/>
398 <param name="precursor_unit" value="ppm"/>
399 <param name="tolerance" value="0.6"/>
400 </section>
401 <section name="digestion">
402 <param name="enzyme" value="0"/>
403 <param name="max_missed_cleavages" value="1"/>
404 </section>
405 <section name="search">
406 <param name="frag_method" value="1"/>
407 <param name="scoring_method" value="1"/>
408 <param name="max_charge" value="3"/>
409 <param name="min_charge" value="2"/>
410 <param name="min_peaks" value="7"/>
411 <param name="min_score" value="10"/>
412 <param name="max_length" value="45"/>
413 <param name="num_random_peptides" value="1000"/>
414 </section>
415 </section>
416 <param name="report_spectrum_file" value="false"/>
417 <output name="psm_rank_txt">
418 <assert_contents>
419 <has_text text="ELGSSDLTAR" />
420 <has_text text="SPYREFTDHLVK" />
421 <has_line_matching expression="ELGSSDLTAR\tiTRAQ 4-plex of peptide N-term@0\S+\t2\t3\t2\t1191.6\d+\t-3.04\d+\t1191.62\d+\t596.8\d+\t24.18\d+\t0\t22\t1\t995\t0.002\d+\t1\t0\tYes" />
422 </assert_contents>
423 </output>
424 </test>
425
426 <!-- Test-4 -->
334 <test> 427 <test>
335 <section name="req_inputs"> 428 <section name="req_inputs">
336 <conditional name="input_type"> 429 <conditional name="input_type">
337 <param name="input_type_selector" value="1"/> 430 <param name="input_type_selector" value="1"/>
338 <conditional name="multiple"> 431 <conditional name="multiple">
378 <has_text text="SPYREFTDHLVK" /> 471 <has_text text="SPYREFTDHLVK" />
379 </assert_contents> 472 </assert_contents>
380 </output> 473 </output>
381 </test> 474 </test>
382 475
476 <!-- Test-5 -->
383 <test> 477 <test>
384 <section name="req_inputs"> 478 <section name="req_inputs">
385 <conditional name="input_type"> 479 <conditional name="input_type">
386 <param name="input_type_selector" value="2"/> 480 <param name="input_type_selector" value="2"/>
387 <param name="input" value="gaactgggcagcagcgatctgaccgcgcgcagcccgtatcgcgaatttaccgatcatctggtgaaa"/> 481 <param name="input" value="gaactgggcagcagcgatctgaccgcgcgcagcccgtatcgcgaatttaccgatcatctggtgaaa"/>
423 <has_text text="ELGSSDLTAR" /> 517 <has_text text="ELGSSDLTAR" />
424 </assert_contents> 518 </assert_contents>
425 </output> 519 </output>
426 </test> 520 </test>
427 521
522 <!-- Test-6 -->
523 <test>
524 <section name="req_inputs">
525 <conditional name="input_type">
526 <param name="input_type_selector" value="peptide"/>
527 <conditional name="multiple">
528 <param name="peptide_input_selector" value="multiple" />
529 <param name="input" ftype="tabular" value="novel_peptides"/>
530 </conditional>
531 </conditional>
532 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
533 <param name="spectrum_file" ftype="mgf" value="immunopeptidomics.mgf"/>
534 <param name="indexType" value="2"/>
535 <conditional name="tags">
536 <param name="tagType" value="PepQuery"/>
537 <param name="tag_file" ftype="tabular" value="test.tags"/>
538 <param name="tagIndexType" value="2"/>
539 </conditional>
540 </section>
541 <section name="modifications">
542 <param name="fixed_mod" value=""/>
543 <param name="var_mod" value="117,114,118,128"/>
544 <param name="max_mods" value="3"/>
545 <param name="unmodified" value="True"/>
546 <param name="aa" value="True"/>
547 </section>
548 <section name="ms_params">
549 <section name="tolerance_params">
550 <param name="precursor_tolerance" value="20"/>
551 <param name="precursor_unit" value="ppm"/>
552 <param name="tolerance" value="0.02"/>
553 </section>
554 <section name="digestion">
555 <param name="enzyme" value="0"/>
556 <param name="max_missed_cleavages" value="0"/>
557 </section>
558 <section name="search">
559 <param name="frag_method" value="1"/>
560 <param name="scoring_method" value="1"/>
561 <param name="max_charge" value="3"/>
562 <param name="min_charge" value="2"/>
563 <param name="min_peaks" value="10"/>
564 <param name="min_score" value="12"/>
565 <param name="max_length" value="25"/>
566 <param name="num_random_peptides" value="1000"/>
567 </section>
568 </section>
569 <param name="report_spectrum_file" value="true"/>
570 <output name="psm_rank_txt">
571 <assert_contents>
572 <has_text text="MTDRHAGTY" />
573 <has_text text="controllerType=0 controllerNumber=1 scan=19905" />
574 </assert_contents>
575 </output>
576 </test>
577
578 <!-- Test-7 -->
579 <test>
580 <section name="req_inputs">
581 <conditional name="input_type">
582 <param name="input_type_selector" value="peptide"/>
583 <conditional name="multiple">
584 <param name="peptide_input_selector" value="multiple" />
585 <param name="input" ftype="tabular" value="novel_peptides"/>
586 </conditional>
587 </conditional>
588 <param name="db_file" ftype="fasta" value="Uniprot.fasta"/>
589 <param name="spectrum_file" ftype="mgf" value="immunopeptidomics.mgf"/>
590 <param name="indexType" value="2"/>
591 <conditional name="tags">
592 <param name="tagType" value="pFind"/>
593 <param name="qry_res" ftype="txt" value="pFind.qry.res"/>
594 </conditional>
595 </section>
596 <section name="modifications">
597 <param name="fixed_mod" value=""/>
598 <param name="var_mod" value="117,114,118,128"/>
599 <param name="max_mods" value="3"/>
600 <param name="unmodified" value="True"/>
601 <param name="aa" value="True"/>
602 </section>
603 <section name="ms_params">
604 <section name="tolerance_params">
605 <param name="precursor_tolerance" value="20"/>
606 <param name="precursor_unit" value="ppm"/>
607 <param name="tolerance" value="0.02"/>
608 </section>
609 <section name="digestion">
610 <param name="enzyme" value="0"/>
611 <param name="max_missed_cleavages" value="0"/>
612 </section>
613 <section name="search">
614 <param name="frag_method" value="1"/>
615 <param name="scoring_method" value="1"/>
616 <param name="max_charge" value="3"/>
617 <param name="min_charge" value="2"/>
618 <param name="min_peaks" value="10"/>
619 <param name="min_score" value="12"/>
620 <param name="max_length" value="25"/>
621 <param name="num_random_peptides" value="1000"/>
622 </section>
623 </section>
624 <param name="report_spectrum_file" value="true"/>
625 <output name="psm_rank_txt">
626 <assert_contents>
627 <has_text text="MTDRHAGTY" />
628 <has_text text="controllerType=0 controllerNumber=1 scan=19905" />
629 </assert_contents>
630 </output>
631 <output name="query_tags" file="test.tags"/>
632 <!--
633 -->
634 </test>
635
428 </tests> 636 </tests>
429 <help><![CDATA[ 637 <help><![CDATA[
430 PepQuery is a peptide-centric search engine for novel peptide identification and validation. Cancer genomics studies have identified a large number of genomic alterations that may lead to novel, cancer-specific protein sequences. Proteins resulted from these genomic alterations are attractive candidates for cancer biomarkers and therapeutic targets. The leading approach to proteomic validation of genomic alterations is to analyze tandem mass spectrometry (MS/MS) data using customized proteomics databases created from genomics data. Such analysis is time-consuming and requires thorough training and detailed knowledge in proteomics data analysis, leading to a gap between MS/MS data and the cancer genomics community. PepQuery does not require customized databases and allows quick and easy proteomic validation of genomic alterations. 638 **PepQuery**
639
640 PepQuery_ is a peptide-centric search engine for novel peptide identification and validation. Cancer genomics studies have identified a large number of genomic alterations that may lead to novel, cancer-specific protein sequences. Proteins resulted from these genomic alterations are attractive candidates for cancer biomarkers and therapeutic targets. The leading approach to proteomic validation of genomic alterations is to analyze tandem mass spectrometry (MS/MS) data using customized proteomics databases created from genomics data. Such analysis is time-consuming and requires thorough training and detailed knowledge in proteomics data analysis, leading to a gap between MS/MS data and the cancer genomics community. PepQuery does not require customized databases and allows quick and easy proteomic validation of genomic alterations.
431 641
432 **Inputs** 642 **Inputs**
433 - A sequence to match, one of the following: 643 - A sequence to match, one of the following:
434 644
435 - A peptide string or a history dataset with a list of peptides 645 - A peptide string or a history dataset with a list of peptides
436 - A protein string or a history dataset with a protein fasta 646 - A protein string or a history dataset with a protein fasta
437 - A DNA string that is at least 60 base pairs in length 647 - A DNA string that is at least 60 base pairs in length
438 648
439 - A mass spectrometry MGF file 649 - A mass spectrometry MGF file
440 - A reference protein fasta database, peptides matching a reference sequence will be excluded. 650 - A reference protein fasta database, peptides matching a reference sequence will be excluded.
651 - An optional tags file for no-enzyme immunopeptidomics search
652
653 - See: http://pepquery.org/data/PepQuery_for_immunopeptidomics_data.pdf
441 654
442 **Outputs** 655 **Outputs**
443 - PSM annotation - tabular with columns: 656 - PSM annotation - tabular with columns:
444 peptide Query calc_mr observed_mz charge pepSeq m_label m_mz m_intensity mz intensity 657
658 - peptide Query calc_mr observed_mz charge pepSeq m_label m_mz m_intensity mz intensity
659
445 - Detail - tabular with columns: 660 - Detail - tabular with columns:
446 *report_spectrum_file* spectrum_title peptide modification pep_mass score 661
662 - *report_spectrum_file* spectrum_title peptide modification pep_mass score
663
447 - PSM - tabular with columns: 664 - PSM - tabular with columns:
448 peptide modification n *report_spectrum_file* spectrum_title charge exp_mass ppm pep_mass mz score n_db total_db n_random total_random pvalue 665
666 - peptide modification n *report_spectrum_file* spectrum_title charge exp_mass ppm pep_mass mz score n_db total_db n_random total_random pvalue
667
449 - PSM Rank - tabular with columns: 668 - PSM Rank - tabular with columns:
450 peptide modification n *report_spectrum_file* spectrum_title charge exp_mass ppm pep_mass mz score n_db total_db n_random total_random pvalue rank *n_ptm* 669
670 - peptide modification n *report_spectrum_file* spectrum_title charge exp_mass ppm pep_mass mz score n_db total_db n_random total_random pvalue rank *n_ptm*
671
451 - An MGF with the best matching spectrums 672 - An MGF with the best matching spectrums
452 673
453 The *report_spectrum_file* is an optional field that can be added. 674 The *report_spectrum_file* is an optional field that can be added.
675
454 The *n_ptm* field is added when using unrestricted modification searching (-um). 676 The *n_ptm* field is added when using unrestricted modification searching (-um).
455 677
678 .. _PepQuery: http://pepquery.org/document.html
456 679
457 ]]></help> 680 ]]></help>
458 <citations> 681 <citations>
459 <citation type="doi">10.1101/gr.235028.118</citation> 682 <citation type="doi">10.1101/gr.235028.118</citation>
683 <citation type="doi">10.1038/s41467-020-15456-w</citation>
460 </citations> 684 </citations>
461 </tool> 685 </tool>