Mercurial > repos > idot > fastx_toolkit2
comparison fastq_to_fasta.xml @ 0:78a7d28f2a15 draft
Uploaded
author | idot |
---|---|
date | Wed, 10 Jul 2013 06:13:48 -0400 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:78a7d28f2a15 |
---|---|
1 <tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA"> | |
2 <description>converter</description> | |
3 <command> | |
4 cat '$input' | | |
5 fastq_to_fasta | |
6 #if $input.ext == "fastqsanger": | |
7 -Q 33 | |
8 #elif $input.ext == "fastq": | |
9 -Q 64 | |
10 #end if | |
11 $SKIPN $RENAMESEQ -o '$output' -v | |
12 </command> | |
13 <inputs> | |
14 <param format="fastq,fastqsanger" name="input" type="data" label="FASTQ Library to convert" /> | |
15 | |
16 <param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases "> | |
17 <option value="">yes</option> | |
18 <option value="-n">no</option> | |
19 </param> | |
20 | |
21 <param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)"> | |
22 <option value="-r">yes</option> | |
23 <option value="">no</option> | |
24 </param> | |
25 | |
26 </inputs> | |
27 | |
28 <tests> | |
29 <test> | |
30 <!-- FASTQ-To-FASTA, keep N, don't rename --> | |
31 <param name="input" value="fastq_to_fasta1.fastq" /> | |
32 <param name="SKIPN" value=""/> | |
33 <param name="RENAMESEQ" value=""/> | |
34 <output name="output" file="fastq_to_fasta1a.out" /> | |
35 </test> | |
36 <test> | |
37 <!-- FASTQ-To-FASTA, discard N, rename --> | |
38 <param name="input" value="fastq_to_fasta1.fastq" /> | |
39 <param name="SKIPN" value="no"/> | |
40 <param name="RENAMESEQ" value="yes"/> | |
41 <output name="output" file="fastq_to_fasta1b.out" /> | |
42 </test> | |
43 </tests> | |
44 | |
45 <outputs> | |
46 <data format="fasta" name="output" metadata_source="input" | |
47 /> | |
48 </outputs> | |
49 | |
50 <help> | |
51 | |
52 **What it does** | |
53 | |
54 This tool converts data from Solexa format to FASTA format (scroll down for format description). | |
55 | |
56 -------- | |
57 | |
58 **Example** | |
59 | |
60 The following data in Solexa-FASTQ format:: | |
61 | |
62 @CSHL_4_FC042GAMMII_2_1_517_596 | |
63 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT | |
64 +CSHL_4_FC042GAMMII_2_1_517_596 | |
65 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 | |
66 | |
67 Will be converted to FASTA (with 'rename sequence names' = NO):: | |
68 | |
69 >CSHL_4_FC042GAMMII_2_1_517_596 | |
70 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT | |
71 | |
72 Will be converted to FASTA (with 'rename sequence names' = YES):: | |
73 | |
74 >1 | |
75 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT | |
76 | |
77 ------ | |
78 | |
79 This tool is based on `FASTX-toolkit`__ by Assaf Gordon. | |
80 | |
81 .. __: http://hannonlab.cshl.edu/fastx_toolkit/ | |
82 </help> | |
83 </tool> | |
84 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> |